Prosecution Insights
Last updated: July 17, 2026
Application No. 17/413,384

METHODS OF TREATING SCHIZOPHRENIA AND OTHER NEUROPSYCHIATRIC DISORDERS

Final Rejection §103
Filed
Jun 11, 2021
Priority
Dec 11, 2018 — provisional 62/778,145 +1 more
Examiner
MCKILLOP, JOHN CHARLES
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Rochester
OA Round
4 (Final)
57%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
97%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allowance Rate
27 granted / 47 resolved
-2.6% vs TC avg
Strong +39% interview lift
Without
With
+39.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
20 currently pending
Career history
81
Total Applications
across all art units

Statute-Specific Performance

§101
1.8%
-38.2% vs TC avg
§103
62.7%
+22.7% vs TC avg
§102
2.4%
-37.6% vs TC avg
§112
4.1%
-35.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 47 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claims 1-24 and 26 are pending. Applicant’s election without traverse of group 1 (claims 1-25) in the Response filed July 29 2024 remains acknowledged. Applicant elected the species of 1. the nucleic acid SMAD4 shRNA inhibitor; 2. Astrocyte cell type; and 3. Schizophrenia neuropsychiatric disorder. Claims 2, 3, 6, 10, 11, 15, 17 and 26 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claims 1, 7, 9, and 23 have been amended. Examination on the merits commences on claims 1, 4, 5, 7-9, 12-14, 16, and 18-24. Applicants are informed that the rejections and/or objections of the previous Office action not stated below have been withdrawn from consideration in view of the Applicant' s arguments and/or amendments. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Claim Rejections - 35 USC § 103 – Modified Maintained The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims under pre-AIA 35 U.S.C. 103(a), the examiner presumes that the subject matter of the various claims was commonly owned at the time any inventions covered therein were made absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and invention dates of each claim that was not commonly owned at the time a later invention was made in order for the examiner to consider the applicability of pre-AIA 35 U.S.C. 103(c) and potential pre-AIA 35 U.S.C. 102(e), (f) or (g) prior art under pre-AIA 35 U.S.C. 103(a). Claim(s) 1, 4, 5, 9, 12-14, 16, and 21-24 is/are rejected under 35 U.S.C. 103 as being unpatentable over Mukai of record (Mukai, T., et al. (2018), published August 5 2018) of record, as evidenced by Mao of record (Mao, Shaowei, et al. Molecular medicine reports 16.5 (2017): 6190-6199) of record, in view of Peyman of record (Peyman, G., US 20140056815 A1) of record, and Bettencourt of record (Bettencourt, B., US-20160186172-A1), and Khan of record (Khanizadeh, Sayyad, et al. "Blocking of SMAD4 expression by shRNA effectively inhibits fibrogenesis of human hepatic stellate cells." Gastroenterology and Hepatology from bed to bench 8.4 (2015): 262.). Regarding claim 1, Mukai teaches administering valproic acid to astrocyte glial cells to increase the expression of an inwardly rectifying dysfunctional potassium channel known as Kir4.1 (pg 2 col 1 para 2, Fig. 2-4). Valproic acid is a known inhibitor of SMAD4 expression, as evidenced by Mao (pg 6190 para 1). Examiner notes that Applicant’s claim 6 includes valproic acid as a SMAD4 inhibitor. Mukai teaches valproate administration (SMAD4 inhibition) alleviates epileptogenesis (development of seizure susceptibility) of Lgi1L385R mutant rats (pg 6 col 2 para 1). Mukai teaches antiepileptic drugs reduce neural excitability and contribute to an acute inhibitory action on seizure induction (pg 7 para 1) where in particular, valproate up-regulates astrocytic Kir4.1 potassium channels in the amygdala and contributes to clinical efficacy in chronic epilepsy (pg 8 col 2 para 1), i.e. restored K+ uptake in astrocyte cells via delivery of the valproic acid. Mukai is silent as to whether valproic acid is a SMAD4 inhibitor, however, Mao teaches valproic acid is a SMAD4 inhibitor (pg 6190 para 1). Although Mukai teaches restoring impaired glial cell potassium uptake in rat astrocytes, Mukai does not teach the method applied to human astrocytes. Peyman teaches combination mechanisms to correct, reduce, and/or prevent physiological electro-sensory damage or electromotor damage and promote functional recovery of excitable cells, e.g., neurons in the central nervous system (i.e., brain and spinal cord) and neuronal cells involved with visual, auditory, vocal, olfactory responses [0007] as a treatment method for epilepsy, retinal degeneration, and central nervous system pathologies such as Alzheimer's disease and Parkinson disease, dopamine-regulated disorders such as migraines, autism, mood disorders, and schizophrenia [001]. Peyman teaches these compositions in a CNS delivery method to treat disease states with dysfunctional neuronal synapse ion homeostasis as mediated by glial cell activation which results in ganglion cells hyperpolarization by activating A1 receptors and opening neuronal K+ channels [0049]. Peyman teaches the therapeutic effects of quantum dots are achieved by the effects that quantum dots exert on membrane potential when stimulated, thus enhancing or maintaining the cell membrane potential (e.g., nerve cell, glial cells, astrocytes, etc.) [0090]. Peyman teaches this process preserves the function of such cells (nerve cells, glial cells, astrocytes, etc.) by maintaining their membrane potentials, thus maintaining cell viability and function [0104]. Peyman teaches in one embodiment nucleic acids targeting the SMAD4 gene are covalently conjugated to the quantum delivery dots to mediate the glial cell activation ([0090] and claim 24). Peyman further teaches the quantum dots can be conjugated with an RNAi, siRNA, shRNA, mRNA, tRNA, rRNA, microRNA biomolecule which can inhibit the target gene and be delivered to a target cell cytoplasm or nucleus [0067] where the target is a variety of organisms such as human, plant, bacterial, and yeast [0067]. Bettencourt teaches that advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes mediated by SMAD4 expression and where such models are used for in vivo testing of dsRNA (i.e., an RNAi expression inhibition method), as well as for determining a therapeutically effective dose ([0248]). Bettencourt teaches the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans [0249]. Although Mukai, Peyman, and Bettencourt do not teach use of a SMAD4 inhibitor as a nucleic acid which is complementary to claimed SEQ ID NO: 2 SMAD4 mRNA, Khan teaches effective SMAD4 expression knockdown is achieved in human cells by SMAD4 shRNA (Fig 1A and pg 263 col 2 para 4). Khan further teaches SMAD4 shRNA which targets the SMAD4 sequence 5'ATTGAAAGTTTGGTAAAGAAGCTGAAGGA3' which is 100% identical to claimed SEQ ID NO: 2 SMAD4 mRNA (pg 264 col 1 para 1, Table 2). PNG media_image1.png 211 664 media_image1.png Greyscale It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed Peyman’s quantum dot method targeting human SMAD4 using Khan’s SMAD4 targeting shRNA complementary to the claimed SEQ ID NO: 2 SMAD4 mRNA wherein the inhibitory nucleic acid molecule binds to a SMAD4 mRNA, in place of the valproate SMAD4 inhibition in Mukai’s method of restoring impaired glial cell potassium uptake and applied to human astrocytes. It would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that shRNA mediated inhibition of SMAD4 would effectively target SMAD4 mRNA and restore potassium channel function in astrocytes because Mukai teaches SMAD4 inhibition effectively restores potassium channel function in astrocytes and Mao teaches valproic acid is a SMAD4 expression inhibitor. It would have been predictable that SMAD4 inhibition via Khan’s SMAD4 shRNA conjugated to Peyman’s CNS targeting delivery system could influence potassium channel function equivalent to valproic acid because Peyman teaches effective target expression inhibition with quantum dot delivered SMAD4 shRNA and Khan demonstrates SMAD4 effectively knocked down in human cells with shRNA targeting SMAD4 mRNA (instant SEQ ID NO: 2). The skilled artisan would be motivated to employ Khan’s known shRNA SMAD4 sequence within Peyman’s modified SMAD4 shRNA inhibitors, which are already taught in Peyman’s method as a potential influencer of neuron polarization, to augment or replace valproic acid in Mukai’s method because both Peyman and Mukai teach the known side effects of Valproic acid such that shRNA inhibitors of SMAD4 in a targeted delivery system would offer diminished off target effects. Furthermore, it would have been predictable that Mukai’s method of influencing neuron polarization in rat cells would be a similarly effective platform applied to human glial cells because Bettencourt teaches SMAD4 rodent knockdown models can be effectively applied to humans. Regarding claims 4 and 12, Mukai teaches the glial cell subjects are astrocyte cells (pg 2 col 1 para 2, Fig. 2-4). Regarding claims 5 and 14, Mukai does not teach RNAi such as shRNA or siRNA as the inhibitor of SMAD4 in the method to retore potassium synapse polarization in astrocytes, however, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed Peyman’s quantum dot method targeting human SMAD4 using Khan’s SMAD4 shRNA in place of valproate SMAD4 inhibition in Mukai’s method of restoring impaired glial cell potassium uptake in astrocytes, given the obviousness rationale applied above for claim 1. Regarding claims, 9, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed Peyman’s quantum dot method targeting human SMAD4 cells using Khan’s SMAD4 shRNA (complementary to instant SEQ ID NO: 2 SMAD4 mRNA) in place of valproate for SMAD4 inhibition in Mukai’s method of restoring impaired glial cell potassium uptake in astrocytes, given the obviousness rationale applied above for claim 1. Regarding claim 13, Mukai teaches the above applied to claim 1, i.e. a method of restoring potassium uptake of glial cells of impaired kir4.1 potassium channels by administering to the subject a valproate SMAD4 inhibitor under conditions effective to restore K uptake by said glial cells through upregulated expression of Kir4.1 potassium channels ((pg 8 col 2 para 1). Regarding claim 16, Peyman teaches delivery and intercellular and/or intracellular localization of nano- and micro-particle solar cells within and/or among excitable biological cells to regulate membrane polarization of biological cells combined with other methods to promote functional recovery of damaged excitable cells in the eye and central nervous system [0013], i.e. a nano-particle delivery system. Regarding claim 21, Mukai teaches valproate reduces neural excitability and contributes to an acute inhibitory action on seizure induction (pg 7 para 1). Mukai teaches that besides the acute actions, repeated treatments with these antiepileptics are known to exert prophylactic effects in chronic epilepsy as well as acute epilepsy, although such usage are sometimes limited by their side effects and/or drug interactions (pg 7 para 1). Regarding claim 22, through valproate administration (SMAD4 inhibition), Mukai demonstrates alleviated epileptogenesis, development of seizure susceptibility, of Lgi1L385R mutant rats (pg 6 col 2 para 1). Regarding claim 23, Examiner notes that Mukai’s valproate SMAD4 inhibition administration leads to acute and chronic enhanced neuronal function with diminished seizures by stabilized neuronal polarity which is interpreted to also at least partially improve cognitive symptoms related to such depolarization related disorders, given less frequent epileptic events would involve enhanced periods of unhindered cognition. Regarding claim 24, Peyman teaches the disclosed quantum dot-nucleic acid complex may be introduced into the cerebrospinal fluid, ventricles, CNS, spinal cord, etc. for therapy of numerous CNS diseases [0078], i.e. delivery via the brain ventricles. Claim(s) 1, 7, 8, 9, 18, 19, and 20 is/are rejected under 35 U.S.C. 103 as being unpatentable over Mukai of record (Mukai, T., et al. (2018), published August 5 2018) of record, as evidenced by Mao of record (Mao, Shaowei, et al. Molecular medicine reports 16.5 (2017): 6190-6199) of record, in view of Peyman of record (Peyman, G., US 20140056815 A1) of record, and Bettencourt of record (Bettencourt, B., US-20160186172-A1) and Khan of record (Khanizadeh, Sayyad, et al. "Blocking of SMAD4 expression by shRNA effectively inhibits fibrogenesis of human hepatic stellate cells." Gastroenterology and Hepatology from bed to bench 8.4 (2015): 262.) as applied to claims 1 and 9, and in further view of Tseng of record (Tseng, Ping-Tao, et al. Medicine 95.4 (2016): e2475.) of record. The teachings of Mukai, Mao, Peyman, Bettencourt, and Khan as applied above for claims 1 and 9 are incorporated here. Regarding claims 7, 8, 18, 19, and 20, Although Mukai teaches treatment of epilepsy, Mukai does not teach wherein an inhibitor of SMAD4 restores potassium synapse polarization in astrocytes for the treatment of a neuropsychiatric disorder such as schizophrenia. Briefly, Peyman teaches combination mechanisms to correct, reduce, and/or prevent physiological electro-sensory damage or electromotor damage and promote functional recovery of excitable cells, e.g., neurons in the central nervous system (i.e., brain and spinal cord) and neuronal cells involved with visual, auditory, vocal, olfactory responses [0007] as a treatment method for epilepsy, retinal degeneration, and central nervous system pathologies such as Alzheimer's disease and Parkinson disease, dopamine-regulated disorders such as migraines, autism, mood disorders, and schizophrenia [001]. Peyman teaches in one embodiment nucleic acids targeting the SMAD4 gene are covalently conjugated to the quantum delivery dots to mediate the glial cell activation and influence synapse ion polarization ([0090] and claim 24). Peyman further teaches the light sensitive molecules may be provided to specific neurons for therapy [0009]. Peyman teaches that when glutamate transport in the retina neurons is blocked, both the amplitude and the duration of ganglion cell polarity EPSCs are increased [0049]. Peyman teaches glial cell modulation of electrical activation of retinal neurons is mediated by regulating extracellular K+ and H+ levels such that neuronal activity leads to substantial variations in the concentration of K+ and H+ in the extracellular space, which can alter synaptic transmission [0049]. Peyman teaches an increase of K+ depolarizes synaptic terminals, while an increase of H+ blocks presynaptic Ca2+ channels and NMDA receptors [0049]. Peyman teaches that glial cells like Muller cells regulate extracellular concentrations of K+ and H+, thus influencing the effect of these ions on synaptic transmission [0049]. Tseng teaches significantly better treatment effect with valproate augmentation therapy in patients with schizophrenia, and provides important evidence for supporting the practice of valproate augmentation therapy in these patients (pg 1 col 2 para 3). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have applied Mukai’s method for treatment of epilepsy, as modified given the obviousness rationale applied above for claims 1 and 9, towards the treatment of schizophrenia. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that valproate and other SMAD4 inhibitors could effectively treat CNS disorders related to synapse polarization dysfunction because Mukai teaches that valproic acid effectively restores potassium channel function to treat epilepsy, Tseng teaches valproic acid has significant advantages in the treatment of schizophrenia, and Bettencourt and Khan demonstrate the effectiveness of applying rodent knockdown SMAD4 models to human cells. It would have been predictable that Peyman’s embodiments of neuron synapse activating SMAD4 inhibitors could be applied to Mukai’s valproic acid SMAD4 inhibition to treat other CNS related diseases such as schizophrenia. The skilled artisan would be motivated to employ Peyman’s SMAD4 inhibitor method, which is are already taught as a potential influencer of neuron polarization, to augment valproic acid in Mukai’s method because both Peyman and Mukai teach the known side effects of Valproic acid such that other inhibitors of SMAD4 in a targeted delivery system would offer diminished off target effects in the treatment of schizophrenia. Response to Arguments Regarding the §103 rejection of record, Applicants argue (Remarks pg 6-7) that given the numerous and distinct signal-transduction pathways in which valproic acid (valproate) might be implicated, a person of ordinary skill in the art would not have had a motivation-or a reasonable expectation of success-to isolate SMAD4 as the target and employ an inhibitory nucleic acid molecule directed to SMAD4 mRNA to restore K+ uptake in human glial cells, as required by claims 1 and 9, based on Mukai. Applicant’s arguments have been thoroughly reviewed and found unpersuasive. Although valproic acid is widely studied and known to have implications in a variety of cellular functions, Mukai clearly established the focus of valproic acid within his study to be astrocyte glial cell potassium channel function influence during epileptogenesis. For example, Mukai teaches administering valproic acid to astrocyte glial cells to increase the expression of an inwardly rectifying dysfunctional potassium channel known as Kir4.1 (pg 2 col 1 para 2, Fig. 2-4) to alleviate epileptogenesis (pg 6 col 2 para 1). Therefore, although the function of valproic acid can be widespread, the specific influence over potassium channel function is clearly established, as described in the §103 rejection above applied to claim 1. In this case, Examiner’s §103 rejection describes the reference combination teaches where Mukai employs a known SMAD4 inhibitor (valproic acid) to increase Kir4.1 channel expression. Examiner establishes in the rejection that a skilled artisan would find it sufficiently predictable that other known SMAD4 inhibitors such as the claimed nucleic acid SMAD4 inhibitors complementary to SEQ ID NO: 2 would similarly influence potassium channels. Examiner further notes that obviousness can be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so. In re Kahn, 441 F.3d 977, 986, 78 USPQ2d 1329, 1335 (Fed. Cir. 2006) (discussing rationale underlying the motivation-suggestion-teaching test as a guard against using hindsight in an obviousness analysis). A "motivation to combine may be found explicitly or implicitly in market forces; design incentives; the ‘interrelated teachings of multiple patents’; ‘any need or problem known in the field of endeavor at the time of invention and addressed by the patent’; and the background knowledge, creativity, and common sense of the person of ordinary skill." Zup v. Nash Mfg., 896 F.3d 1365, 1371, 127 USPQ2d 1423, 1427 (Fed. Cir. 2018) (quoting Plantronics, Inc. v. Aliph, Inc., 724 F.3d 1343, 1354 [107 USPQ2d 1706] (Fed. Cir. 2013) (citing Perfect Web Techs., Inc. v. InfoUSA, Inc., 587 F.3d 1324, 1328 [92 USPQ2d 1849] (Fed. Cir. 2009) (quoting KSR, 550 U.S. at 418-21)). Applicants further argue (Remarks pg 7) that Mukai is entirely silent with respect to increasing the expression of Kir4.1 using a SMAD4 inhibitor. Applicant’s arguments have been thoroughly reviewed and found unpersuasive. In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., increasing the expression of Kir4.1 using a SMAD4 inhibitor) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Applicants further argue (Remarks pg 7), that the Peyman, Bettencourt, Khan, and Tseng do not rectify the deficiencies of Mukai, given the amendments to claim 1 and 9 including “wherein the inhibitory nucleic acid molecule binds to a SMAD4 mRNA transcript.” However, these amendment elements have been addressed in response to the previous amendment “Where the inhibitory nucleic acid is complementary to the SMAD4 mRNA SEQ ID NO: 2” as responded to in the last non-final of record and in the §103 rejection above which specifies the shRNA of Khan as targeting the exact SMAD4 mRNA sequence of SEQ ID NO: 2. Applicants again argue (Remarks pg 7) (addressed in the previous office action) that the references do not disclose or suggest use of a SMAD4 inhibitor to restore potassium uptake in specifically human glial cells or comprise a nucleic acid inhibitor that inhibits SMAD4 which is complementary to SEQ ID NO: 2, the SMAD4 mRNA. Applicants argue that human and mouse astrocytes are not predictable comparable and describe the teachings of Khakh et al. from 2023 published years after the instant application filing of 2018. Applicant’s arguments have been thoroughly reviewed and found unpersuasive. As described above, Examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). However, in this case, the combination teachings of Mukai, Mao, Peyman, Khan, Bettencourt, and Tseng demonstrate obviousness that one skilled in the art before the effective filing date of the claimed invention could have employed with reasonable predictability Peyman’s quantum dot method targeting human SMAD4 using Khan’s SMAD4 shRNA in place of valproate SMAD4 inhibition in Mukai’s method of restoring impaired glial cell potassium uptake and applied to human astrocytes, as detailed in the modified §103 obviousness rationale applied above to independent claim 1. Specifically, a person of ordinary skill before the time of filing would appreciate that a mouse and rat models of cellular neurons are effective equivalent platforms for study and development of human neurodegenerative therapies. As an example, Bettencourt of record teaches that advances in mouse genetics have generated a number of mouse models for the study of various human diseases, such as pathological processes mediated by SMAD4 expression and where such models are used for in vivo testing of dsRNA (i.e., an RNAi expression inhibition method), as well as for determining a therapeutically effective dose ([0248]; (Bettencourt, B., US-20160186172-A1)). Bettencourt teaches the data obtained from cell culture assays and animal studies can be used in formulating a range of dosage for use in humans [0249]. Additionally, Khan of record teaches shRNA SMAD4 expression knockdown in human LX-2 SCC cells (Fig 1A and pg 263 col 2 para 4; Khanizadeh, Sayyad, et al. "Blocking of SMAD4 expression by shRNA effectively inhibits fibrogenesis of human hepatic stellate cells." Gastroenterology and Hepatology from bed to bench 8.4 (2015): 262.) Therefore, the skilled artisan would have reasonable expectation of success of using Khan’s SMAD4 nucleic acid inhibitors to knockdown SMAD4 in human glial cells. Conclusion No claims are allowable. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JOHN CHARLES MCKILLOP whose telephone number is (703)756-1089. The examiner can normally be reached Mon-Fri 8:30-5:30. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner' s supervisor, Jennifer Dunston, can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JOHN CHARLES MCKILLOP/Examiner, Art Unit 1637 /EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Show 3 earlier events
Feb 25, 2025
Final Rejection mailed — §103
Apr 22, 2025
Response after Non-Final Action
Jul 09, 2025
Request for Continued Examination
Jul 16, 2025
Response after Non-Final Action
Dec 18, 2025
Non-Final Rejection mailed — §103
Mar 10, 2026
Response Filed
Jun 01, 2026
Final Rejection mailed — §103
Jul 09, 2026
Interview Requested

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12680124
METHOD FOR DETECTION OF SPECIFIC NUCLEIC ACIDS
5y 2m to grant Granted Jul 14, 2026
Patent 12655433
VDAC1 SILENCING MOLECULES AND USE THEREOF
5y 1m to grant Granted Jun 16, 2026
Patent 12649007
GENE THERAPY FOR RETINAL DISEASE
4y 7m to grant Granted Jun 09, 2026
Patent 12594253
HIV INHIBITORS
5y 2m to grant Granted Apr 07, 2026
Patent 12570973
Compositions and Methods for Inhibiting Intermediate Filament Tetramerization
4y 11m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
57%
Grant Probability
97%
With Interview (+39.4%)
3y 9m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 47 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month