Prosecution Insights
Last updated: April 19, 2026
Application No. 17/413,973

RECOMBINANT VECTORS FOR THE LONG TERM TREATMENT OF MUCCHOPOLYSACHARIDOSIS

Final Rejection §103§112
Filed
Jun 15, 2021
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITA AUTÒNOMA DE BARCELONA
OA Round
3 (Final)
43%
Grant Probability
Moderate
4-5
OA Rounds
4y 2m
To Grant
98%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
19 granted / 44 resolved
-16.8% vs TC avg
Strong +54% interview lift
Without
With
+54.4%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
55 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
6.5%
-33.5% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.3%
-4.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant’s amendments and remarks filed on December 12, 2024 are acknowledged. Claims 1-15 have been canceled. Claims 16, 25, 26, and 27 were amended. Claims 16-29 are pending and are examined on the merits herein. This action is NON-FINAL due to new grounds of rejection not necessitated by amendment. Withdrawn Objections In view of Applicant’s amendments and response, the objections to the specification and claims 16, 25, and 27 are withdrawn. Withdrawn Rejections In view of Applicant’s amendments and response, the 35 U.S.C 112(b) and 35 U.S.C. 102 rejections are withdrawn. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 16-26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The terms “prolonged” and “sustained” in claim 16 are relative terms which render the claim indefinite. The terms “prolonged” and “sustained” are not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The limitation “resulting in prolonged and sustained production of sulfamidase protein” has been rendered indefinite because the specification does not define the terms “prolonged” and “sustained” and the claim does not make clear the metes and bounds of the terms. Claims 17-26 are indefinite because the claims depend from a rejected claim (claim 16) without addressing the issue in claim 16. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 16-18 and 21-26 are rejected under 35 U.S.C. 103 as being obvious over Bosch Tubert et al. (WO 2011/154520; reference previously cited by the Examiner) and Haurigot et al. (The Journal of Clinical Investigation 2013; reference cited by Applicant) as evidenced by Zollers et al. (Journal of Veterinary Pharmacology and Therapeutics 2017). Regarding claims 16-18, Bosch Tubert et al. teaches vectors and nucleic acid sequences helpful for the treatment of mucopolysaccharidoses (MPS), and in particular, for the treatment of mucopolysaccharidoses type III or Sanfilippo syndrome [page 1]. Bosch Tubert et al. teaches that within the mucopolysaccharidosis type III syndrome the subtype A is especially amenable to respond to treatment [page 16, third full paragraph]. Further, Bosch Tubert et al. teaches SEQ ID NO: 1, a nucleotide sequence that is a codon optimized sequence of human sulfamidase and produces higher yields of the sulfamidase enzyme [pages 4-5], which has a 100% match to instant SEQ ID NO: 1 as shown in the sequence search results below. Instant SEQ ID NO: 1 is designated as Qy and Bosch Tubert et al. SEQ ID NO: 1 is designated as Db. Qy 1 GCCACCATGAGCTGCCCTGTGCCCGCCTGTTGTGCCCTGCTGCTGGTGCTGGGACTGTGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GCCACCATGAGCTGCCCTGTGCCCGCCTGTTGTGCCCTGCTGCTGGTGCTGGGACTGTGC 60 Qy 61 AGAGCCAGACCCCGGAACGCTCTGCTGCTGCTGGCCGACGATGGCGGATTTGAGAGCGGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 AGAGCCAGACCCCGGAACGCTCTGCTGCTGCTGGCCGACGATGGCGGATTTGAGAGCGGC 120 Qy 121 GCCTACAACAACAGCGCCATTGCCACCCCTCATCTGGACGCCCTGGCCAGAAGAAGCCTG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCCTACAACAACAGCGCCATTGCCACCCCTCATCTGGACGCCCTGGCCAGAAGAAGCCTG 180 Qy 181 CTGTTCCGGAACGCCTTCACCAGCGTGTCCAGCTGCAGCCCTAGCAGAGCTTCCCTGCTG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTGTTCCGGAACGCCTTCACCAGCGTGTCCAGCTGCAGCCCTAGCAGAGCTTCCCTGCTG 240 Qy 241 ACAGGCCTGCCCCAGCATCAGAATGGCATGTACGGCCTGCACCAGGATGTGCATCACTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACAGGCCTGCCCCAGCATCAGAATGGCATGTACGGCCTGCACCAGGATGTGCATCACTTC 300 Qy 301 AACAGCTTCGACAAAGTGCGGAGCCTGCCACTGCTCCTGTCACAGGCTGGCGTGAGAACC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AACAGCTTCGACAAAGTGCGGAGCCTGCCACTGCTCCTGTCACAGGCTGGCGTGAGAACC 360 Qy 361 GGCATCATCGGCAAGAAACACGTGGGCCCCGAGACAGTGTACCCCTTCGACTTCGCCTAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GGCATCATCGGCAAGAAACACGTGGGCCCCGAGACAGTGTACCCCTTCGACTTCGCCTAC 420 Qy 421 ACCGAAGAGAACGGCAGCGTGCTGCAGGTCGGCCGGAACATCACCCGGATCAAGCTGCTC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 ACCGAAGAGAACGGCAGCGTGCTGCAGGTCGGCCGGAACATCACCCGGATCAAGCTGCTC 480 Qy 481 GTGCGGAAGTTTCTCCAGACCCAGGACGACCGGCCCTTCTTCCTGTACGTGGCCTTCCAC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GTGCGGAAGTTTCTCCAGACCCAGGACGACCGGCCCTTCTTCCTGTACGTGGCCTTCCAC 540 Qy 541 GACCCTCACAGATGCGGCCACAGCCAGCCCCAGTACGGCACCTTCTGCGAGAAGTTCGGC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GACCCTCACAGATGCGGCCACAGCCAGCCCCAGTACGGCACCTTCTGCGAGAAGTTCGGC 600 Qy 601 AACGGCGAGAGCGGCATGGGCAGAATCCCCGACTGGACCCCCCAGGCATACGACCCTCTG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AACGGCGAGAGCGGCATGGGCAGAATCCCCGACTGGACCCCCCAGGCATACGACCCTCTG 660 Qy 661 GACGTGCTGGTGCCCTACTTCGTGCCCAACACCCCTGCCGCCAGAGCTGATCTGGCCGCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GACGTGCTGGTGCCCTACTTCGTGCCCAACACCCCTGCCGCCAGAGCTGATCTGGCCGCC 720 Qy 721 CAGTACACCACCGTGGGCAGAATGGATCAGGGCGTGGGCCTGGTGCTGCAGGAACTGAGG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CAGTACACCACCGTGGGCAGAATGGATCAGGGCGTGGGCCTGGTGCTGCAGGAACTGAGG 780 Qy 781 GACGCTGGCGTGCTGAACGACACCCTGGTCATCTTCACCTCCGACAACGGCATCCCATTC 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 GACGCTGGCGTGCTGAACGACACCCTGGTCATCTTCACCTCCGACAACGGCATCCCATTC 840 Qy 841 CCCAGCGGCCGGACCAATCTGTACTGGCCCGGCACAGCCGAACCTCTGCTGGTGTCCAGC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CCCAGCGGCCGGACCAATCTGTACTGGCCCGGCACAGCCGAACCTCTGCTGGTGTCCAGC 900 Qy 901 CCCGAGCACCCTAAGAGATGGGGCCAGGTGTCCGAGGCCTACGTGTCCCTGCTGGACCTG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 CCCGAGCACCCTAAGAGATGGGGCCAGGTGTCCGAGGCCTACGTGTCCCTGCTGGACCTG 960 Qy 961 ACCCCCACCATCCTGGACTGGTTCAGCATCCCCTACCCCAGCTACGCCATCTTTGGAAGC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ACCCCCACCATCCTGGACTGGTTCAGCATCCCCTACCCCAGCTACGCCATCTTTGGAAGC 1020 Qy 1021 AAGACCATCCACCTGACCGGCAGATCTCTGCTGCCTGCCCTGGAAGCTGAGCCTCTGTGG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 AAGACCATCCACCTGACCGGCAGATCTCTGCTGCCTGCCCTGGAAGCTGAGCCTCTGTGG 1080 Qy 1081 GCCACCGTGTTCGGCAGCCAGAGCCACCACGAAGTGACCATGAGCTACCCCATGCGGAGC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GCCACCGTGTTCGGCAGCCAGAGCCACCACGAAGTGACCATGAGCTACCCCATGCGGAGC 1140 Qy 1141 GTGCAGCACCGGCACTTCCGGCTGGTGCACAACCTGAACTTCAAGATGCCCTTCCCAATC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GTGCAGCACCGGCACTTCCGGCTGGTGCACAACCTGAACTTCAAGATGCCCTTCCCAATC 1200 Qy 1201 GACCAGGACTTTTACGTGTCCCCCACCTTCCAGGACCTGCTGAACAGAACCACAGCCGGC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GACCAGGACTTTTACGTGTCCCCCACCTTCCAGGACCTGCTGAACAGAACCACAGCCGGC 1260 Qy 1261 CAGCCCACCGGCTGGTACAAGGACCTGCGGCACTACTACTACCGGGCCAGATGGGAGCTG 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CAGCCCACCGGCTGGTACAAGGACCTGCGGCACTACTACTACCGGGCCAGATGGGAGCTG 1320 Qy 1321 TACGACAGAAGCCGGGACCCCCACGAGACACAGAACCTGGCCACCGACCCCAGATTCGCC 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 TACGACAGAAGCCGGGACCCCCACGAGACACAGAACCTGGCCACCGACCCCAGATTCGCC 1380 Qy 1381 CAGCTCCTGGAAATGCTGCGGGACCAGCTGGCCAAGTGGCAGTGGGAGACACACGACCCT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CAGCTCCTGGAAATGCTGCGGGACCAGCTGGCCAAGTGGCAGTGGGAGACACACGACCCT 1440 Qy 1441 TGGGTCTGCGCTCCCGACGGCGTGCTGGAAGAGAAGCTGTCCCCCCAGTGCCAGCCACTG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 TGGGTCTGCGCTCCCGACGGCGTGCTGGAAGAGAAGCTGTCCCCCCAGTGCCAGCCACTG 1500 Qy 1501 CACAACGAGCTGTGA 1515 ||||||||||||||| Db 1501 CACAACGAGCTGTGA 1515 Bosch Tubert et al. also teaches that the pharmaceutical composition is administered by parenteral administration which includes intravenous, subcutaneous, intracisternal and intramuscular injections [page 15]. Further, a single parenteral administration is enough to get a long-term effect because the promoter and the nucleotide sequence of the sulfamidase located between the inverted terminal repeats are incorporated in the genome of the cells of the individual [page 6]. The limitation “resulting in prolonged and sustained production of sulfamidase protein” is inherent in the method absent evidence to the contrary. See MPEP 2112. Regarding claims 21-26, the outcomes recited in claims 21-26 are inherent in the method of claim 16 absent evidence to the contrary. However, Bosch Tubert et al. does not teach that the pharmaceutical composition is administered intracerebroventricularly or the dosage amount for intracerebroventricular administration. Haurigot et al. teaches that intracerebrospinal fluid (intra-CSF) administration of serotype 9 adenoassociated viral vectors (AAV9s) encoding sulfamidase corrects both CNS and somatic pathology in MPS IIIA mice. Following vector administration, enzymatic activity increased throughout the brain and in serum, leading to whole body correction of GAG accumulation and lysosomal pathology, normalization of behavioral deficits, and prolonged survival. To test this strategy in a larger animal, beagle dogs were treated using intracisternal or intracerebroventricular delivery [abstract]. Haurigot et al. also teaches delivering an AAV9 vector encoding for human sulfamidase (AAV9-SGSH) to the cisterna magna of healthy beagle dogs, scaling up the therapeutic dose used in mice to 2 x 1013 vg, based on the body weight of mice compared with dogs [page 3259, right column, first full paragraph]. Zollers et al. studied the effects in dogs of oral capromorelin [abstract]. Mature beagle dogs were used in the study whose body weights ranged from 9-15 kg [page 141, left column, third paragraph]. It would have been obvious for Haurigot et al. to use dogs in this weight range, accordingly, the limitations of claim 18 were prima facie obvious. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to administer intracerebroventricularly a single dose of the pharmaceutical composition of Bosch Tubert et al. in an amount taught by Haurigot et al. as a means for drug delivery to treat Sanfilippo syndrome type A because Haurigot et al. taught intra-CSF administration of AAV9s encoding sulfamidase increases enzymatic activity. Claims 19-20 are rejected under 35 U.S.C. 103 as being unpatentable over Bosch Tubert et al. (WO 2011/154520; reference previously cited by the Examiner) and Haurigot et al. (The Journal of Clinical Investigation 2013; reference cited by Applicant) as evidenced by Zollers et al. (Journal of Veterinary Pharmacology and Therapeutics 2017) as applied to claim 16 above, and further in view of Davidson et al. (WO 2018/209317, claims priority to US provisional application 62/505,423 filed on May 12, 2017; reference cited by Applicant). Regarding claims 19-20, the teachings of Bosch Tubert et al. and Haurigot et al. as evidenced by Zollers et al. are discussed above. However, Bosch Tubert et al., Haurigot et al., and Zollers et al. do not teach the dosage amounts recited in claims 19-20. Davidson et al. teaches in certain embodiments rAAV-SGSH particles are administered at a dose of about 1 x 1013 vg/kg, about 5 x 1013 vg/kg, about 1 x 1014 vg/kg, or about 1 x 1015 vg/kg [0161]. Davidson et al. also teaches in certain embodiments the rAAV particle is administered in single or multiple doses to any of the mammal’s cisterna magna, intraventricular space, brain ventricle, subarachnoid space, intrathecal space and/or ependyma [0029]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to administer intracerebroventricularly a single dose of the pharmaceutical composition of Bosch Tubert et al. in an amount taught by Davidson et al. as a means for drug delivery to treat Sanfilippo syndrome type A. Claims 16-18 and 21-29 are rejected under 35 U.S.C. 103 as being obvious over Wilson et al. (US 20200291429, claims priority to US provisional application 62/593,081 filed on November 30, 2017; reference previously cited by the Examiner), Bosch Tubert et al. (WO 2011/154520; reference previously cited by the Examiner), and Haurigot et al. (The Journal of Clinical Investigation 2013; reference cited by Applicant) as evidenced by Zollers et al. (Journal of Veterinary Pharmacology and Therapeutics 2017). Regarding claims 16-18 and 27-29, Wilson et al. teaches a pharmaceutical composition comprising a rAAV in a formulation buffer and a method of treating a human subject diagnosed with MPS IIIA [abstract]. Wilson et al. also teaches that pharmaceutical compositions are designed for delivery to subjects in need thereof by any suitable route or a combination of different routes such as delivery via intracerebroventricular (ICV), intrathecal (IT), or intracisternal injection [0103]. Further, Wilson et al. teaches compositions and methods that achieve efficacy in treating a subject in need with MPS IIIA. Efficacy of the method in a subject can be shown by assessing (a) an increase in SGSH enzymatic activity; (b) amelioration of a MPS IIIA symptom; (c) improvement of MPS IIIA-related biomarkers, e.g., GAG levels polyamine (e.g., spermine) levels in the cerebrospinal fluid (CSF), serum, urine and/or other biological samples; or (e) facilitation of any treatment(s) for MPS IIIA. In certain embodiments, efficacy may be determined by monitoring cognitive improvement and/or anxiety correction, gait and/or mobility improvement, reduction in tremor frequency and/or severity, reduction in clasping/spasms, improvements in posture, improvements in corneal opacity [0109]. In addition, Wilson et al. discloses that MPS IIIa mice were monitored for 7 months post injection to evaluate the long term effects of AAV hSGSH administration where the mice were assigned clinical scores weekly and underwent behavioral and cognitive testing [0161]. The limitation “resulting in prolonged and sustained production of sulfamidase protein” is inherent in the method absent evidence to the contrary. See MPEP 2112. Regarding claims 21-26, the outcomes recited in claims 21-26 are inherent in the method of claim 16 absent evidence to the contrary. However, Wilson et al. does not teach administering a single dose of a pharmaceutical composition comprising a recombinant adeno-associated viral vector comprising a nucleotide sequence as set forth in SEQ ID NO: 1. Wilson et al. also does not teach the dosage amount for intracerebroventricular administration. Bosch Tubert et al. teaches vectors and nucleic acid sequences helpful for the treatment of mucopolysaccharidoses (MPS), and in particular, for the treatment of mucopolysaccharidoses type III or Sanfilippo syndrome [page 1]. Bosch Tubert et al. teaches SEQ ID NO: 1, a nucleotide sequence that is a codon optimized sequence of human sulfamidase [pages 4-5], which has a 100% match to instant SEQ ID NO: 1. Bosch Tubert et al. also teaches that the pharmaceutical composition is administered by parenteral administration which includes intravenous, subcutaneous, intracisternal and intramuscular injections [page 15]. Further, a single parenteral administration is enough to get a long-term effect because the promoter and the nucleotide sequence of the sulfamidase located between the inverted terminal repeats are incorporated in the genome of the cells of the individual [page 6]. Haurigot et al. teaches that intracerebrospinal fluid (intra-CSF) administration of serotype 9 adenoassociated viral vectors (AAV9s) encoding sulfamidase corrects both CNS and somatic pathology in MPS IIIA mice. Following vector administration, enzymatic activity increased throughout the brain and in serum, leading to whole body correction of GAG accumulation and lysosomal pathology, normalization of behavioral deficits, and prolonged survival. To test this strategy in a larger animal, beagle dogs were treated using intracisternal or intracerebroventricular delivery [abstract]. Haurigot et al. also teaches delivering an AAV9 vector encoding for human sulfamidase (AAV9-SGSH) to the cisterna magna of healthy beagle dogs, scaling up the therapeutic dose used in mice to 2 x 1013 vg, based on the body weight of mice compared with dogs [page 3259, right column, first full paragraph]. Zollers et al. studied the effects in dogs of oral capromorelin [abstract]. Mature beagle dogs were used in the study whose body weights ranged from 9-15 kg [page 141, left column, third paragraph]. It would have been obvious for Haurigot et al. to use dogs in this weight range, accordingly, the limitations of claim 18 were prima facie obvious. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Wilson et al. by administering intracerebroventricularly a single dose of the pharmaceutical composition of Bosch Tubert et al. in an amount taught by Haurigot et al. and to subsequently evaluate and/or monitor the efficacy of treating Sanfilippo syndrome type A as taught by Wilson et al. because Bosch Tubert et al. taught vectors and nucleic acid sequences for treatment of Sanfilippo syndrome. In addition, Bosch Tubert et al. taught that long-term effect can be achieved by single parenteral administration and Haurigot et al. taught intra-CSF administration of AAV9s encoding sulfamidase increases enzymatic activity. Claims 19-20 are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al. (US 20200291429, claims priority to US provisional application 62/593,081 filed on November 30, 2017; reference previously cited by the Examiner), Bosch Tubert et al. (WO 2011/154520; reference previously cited by the Examiner), and Haurigot et al. (The Journal of Clinical Investigation 2013; reference cited by Applicant) as evidenced by Zollers et al. (Journal of Veterinary Pharmacology and Therapeutics 2017) as applied to claim 16 above, and further in view of Davidson et al. (WO 2018/209317, claims priority to US provisional application 62/505,423 filed on May 12, 2017; reference cited by Applicant). Regarding claims 19-20, the teachings of Wilson et al., Bosch Tubert et al., and Haurigot et al. as evidenced by Zollers et al. are discussed above. However, Wilson et al., Bosch Tubert et al., Haurigot et al., and Zollers et al. do not teach the dosage amounts recited in claims 19-20. Davidson et al. teaches in certain embodiments rAAV-SGSH particles are administered at a dose of about 1 x 1013 vg/kg, about 5 x 1013 vg/kg, about 1 x 1014 vg/kg, or about 1 x 1015 vg/kg [0161]. Davidson et al. also teaches in certain embodiments the rAAV particle is administered in single or multiple doses to any of the mammal’s cisterna magna, intraventricular space, brain ventricle, subarachnoid space, intrathecal space and/or ependyma [0029]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of Wilson et al. by administering intracerebroventricularly a single dose of the pharmaceutical composition of Bosch Tubert et al. in an amount taught by Davidson et al. as a means for drug delivery to treat Sanfilippo syndrome type A because Bosch Tubert et al. taught vectors and nucleic acid sequences for treatment of Sanfilippo syndrome. In addition, Bosch Tubert et al. taught that long-term effect can be achieved by single parenteral administration. Response to Arguments Applicant's arguments filed December 12, 2024 have been fully considered but they are not persuasive. Applicant argues that the Bosch Tubert et al. reference is silent with regard to a method comprising administering to a Sanfilippo syndrome type A patient; however, it is noted that Bosch Tubert et al. teaches that within the mucopolysaccharidosis type III syndrome the subtype A is especially amenable to respond to treatment [page 16, third full paragraph]. Applicant also indicates that the Bosch Tubert et al. reference is silent to administering a pharmaceutical composition comprising a recombinant adeno-associated viral vector intracerebroventricularly. Therefore, the 35 U.S.C. 102 rejection was withdrawn. Applicant argues that Davidson et al. teaches that native SGSH is poorly secreted; whereas, the modified SGSH variant exhibited increased secretion and cellular uptake by cells [0236]. Therefore, Applicant asserts that one skilled in the art would not have been motivated to intraventricularly administer an AAV expressing an unmodified SGSH protein based on the teachings of Davidson et al. Further, Applicant indicates that paragraph [0232] of Davidson et al. teaches that intraventricular administration of an AAV-SGSH, which expresses a native SGSH, provides therapeutic properties similar to untreated animals. Davidson et al. is not relied on for the rejection of claims 16-18 and 21-26. With respect to Applicant’s arguments, disclosed examples and preferred embodiments do not constitute a teaching away from a broader disclosure or nonpreferred embodiments. In re Susi, 440 F.2d 442, 169 USPQ 423 (CCPA 1971). See MPEP 2123(II). Davidson et al. teaches that in certain embodiments, an SGSH variant exhibits greater secretion by transduced cells compared to non-variant SGSH set forth as SEQ ID NO: 1 [0055] and an SGSH variant exhibits increased uptake by cells compared to uptake of non-variant SGSH set forth as SEQ ID NO: 1 [0056]. Therefore, Davidson et al. teaches that you could use non-variant SGSH. To the extent that Davidson et al. could be considered to teach away from expressing the native protein due to lack of secretion, this teaching away is outweighed by the fact that Haurigot et al. achieved therapeutic results by expressing the native protein in mice and achieved expression in the cerebrospinal fluid of dogs for 3 months by the same method. Detection of SGSH in the cerebrospinal fluid of dogs implies secretion of the protein from cells. Moreover the dog is a larger animal than the mouse and provides a more relevant model in that regard. Given these results, one of ordinary skill would have had a reasonable expectation of successfully employing vectors encoding the native SGSH. In response to Applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, Bosch Tubert et al. teaches vectors and nucleic acid sequences helpful for the treatment of mucopolysaccharidoses (MPS), and in particular, for the treatment of mucopolysaccharidoses type III or Sanfilippo syndrome [page 1]. Bosch Tubert et al. teaches that within the mucopolysaccharidosis type III syndrome the subtype A is especially amenable to respond to treatment [page 16, third full paragraph]. Davidson et al. teaches methods of treating a disease in a mammal caused by a deficiency or defect in sulfamidase (SGSH) expression or function. The limitation “resulting in prolonged and sustained production of sulfamidase protein” is inherent in the method absent evidence to the contrary. See MPEP 2112. Moreover, Haurigot demonstrated expression dog CSF for at least 3 months using the method steps of the instant claims. In addition, both references disclose methods of treating a disease (mucopolysaccharidoses type III or Sanfilippo syndrome and deficiency or defect in sulfamidase (SGSH) expression or function). Thus one of ordinary skill in the art would be motivated to administer intracerebroventricularly a single dose of the pharmaceutical composition of Bosch Tubert et al. in an amount taught by Davidson et al. as a means for drug delivery to treat Sanfilippo syndrome type A because Davidson et al. taught administering a pharmaceutical composition to the brain ventricle for disease treatment. Applicant asserts that the instantly claimed method is surprising and may not be expected based on the understanding of those skilled in the art at the time of the invention. In an assertion of unexpected results, one must compare the claimed subject matter with the closest prior art to be effective to rebut a prima facie case of obviousness. In re Burckel, 592 F.2d 1175, 201 USPQ 67 (CCPA 1979). See MPEP 716.02(e). In this case, there is no quantitative comparison of the amounts of SGSH present in the CSF in each method. With regard to the arguments against the Wilson et al. reference, while the AAV vector taught by Wilson et al. is not the same AAV vector of the instant claims, Wilson et al. teaches a method of treating a human subject diagnosed with MPS IIIA and a method that achieves efficacy in treating a subject in need with MPS IIIA. Thus, the references are considered analogous in art. Applicant’s arguments against the Davidson et al. reference in this combination are effectively addressed above. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /RICHARD A SCHNIZER/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jun 15, 2021
Application Filed
Jun 06, 2024
Non-Final Rejection — §103, §112
Dec 12, 2024
Response Filed
Feb 17, 2025
Non-Final Rejection — §103, §112
Aug 20, 2025
Response after Non-Final Action
Aug 20, 2025
Response Filed
Sep 26, 2025
Final Rejection — §103, §112
Oct 09, 2025
Examiner Interview Summary
Oct 09, 2025
Applicant Interview (Telephonic)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

4-5
Expected OA Rounds
43%
Grant Probability
98%
With Interview (+54.4%)
4y 2m
Median Time to Grant
High
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month