DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 06/30/2025 has been entered.
Election/Restrictions
Claims 1, 4-11, 15-17, 20-27 are pending.
The Applicant elected Group I, i.e. the product claims, and Group II was withdrawn from further consideration, as noted in prior Action of 09/28/2024. Thus, claims 6, 9, 15, 16 and 17 are effectively considered to be of the non-elected Group II, and will be considered withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 05/30/2024.
Claims 1, 4-5, 7-8, 10-11, 20-27 and elected species of SEQ ID NO: 6 are considered here.
Priority
Benefit of priority to foreign application, Finland 20186118, filed on 12/20/2018, via its PCT/FI2019/050906, filed on 12/19/2019, is recognized.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
All the examined claims enjoy the priority to the ‘118 filing date.
35 U.S.C. 112(b):
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 25 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 25 depends on a canceled claim 24, therefore is indefinite. The claim is interpreted to depend on claim 1.
35 U.S.C. 112(d):
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 27 rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 27 does not further limit claim 1. Claim 27, depending on cl. 1, recites “wherein the sequence is at least 80% identical . . . to . . . the entire sequence of SEQ ID NO: 6,” and claim 1 recites “a sequence which is at least 80% identical to the sequence of . . . SEQ ID NO: 6.” Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 101
The rejection of claims 1-2, 4-5, 7-8, 10-11, 20-25 is withdrawn due to the claim amendment of claim 1.
Section 33(a) of the America Invents Act reads as follows:
Notwithstanding any other provision of law, no patent may issue on a claim directed to or encompassing a human organism.
Claim 11 is rejected under 35 U.S.C. 101 and section 33(a) of the America Invents Act as being directed to or encompassing a human organism. See also Animals - Patentability, 1077 Off. Gaz. Pat. Office 24 (April 21, 1987) (indicating that human organisms are excluded from the scope of patentable subject matter under 35 U.S.C. 101).
Claim 11 recites a cell comprising the recombinant expression vector of claim 10. Furthermore the subject to be treated is a human subject (see pages 17, line 20; 26, line 16 [a “method of modulating the expression of a target protein in human”]), thus cells of the human subject will comprise the claimed expression vector. Therefore, the scope of the claims would encompass cells in a human organism and the human organism itself.
Amending the claim to an isolated cell or a cell in vitro or ex vivo will be remedial.
Claim Rejections - 35 USC § 102
Rejection of claims 1, 4-5, 7-8, 10-11, 20-23, 25 under 102 is withdrawn due to claim amendments, claim 1 recites a specific nucleotide length range of the miRNA mimic.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 4-5, 7-8, 10-11, 20-23, 25-27 are rejected under 35 U.S.C. 103 as being unpatentable over Otte et al. (US20170044541, pub. 02/16/2017, referred as Otte) and Zhang et al. (2013, PLoS ONE, 8, e72062, pp. 1-7).
Regarding instant claim 1, the language of “binds to a promoter region of human target gene or a 3’ Untranslated Region (UTR) of a human target gene” is considered the inherent property of the structural limitation of the sequence recited in the body of the claim, since the phrase does not provide further structural limitation.
Otte discloses a nucleic acid construct comprising at least two different regions each encoding at least one miRNA or miRNA-inhibitor having distinct functions such as stimulating cellular production of a biomolecule, regulating cell survival and/or regulating proliferation (par. 1); discloses a SEQ ID NO: 505, a mmu-miR-466b-5p, comprising a 22 nt. with the following sequence ugauguguguguacauguacau (Table 7, par. 22, relevant to instant cl. 1, 25, 26). miR-466b-5p, based on bioinformatics analysis, is predicted to be an miRNA involved with promoting cell death (Table 3) or necrosis (Table 5). The SEQ ID NO: 505 has 13 nt. that are identical to instant elected SEQ ID NO: 6 and comprises the seed sequence of GAUGUGU (relevant to cl. 1). Otte discloses that the nucleic acid construct is an expression vector for expressing miRNA and/or miRNA inhibitor introduced into the cell (par. 31, relevant to cl. 10, 11); and the miRNA nucleic acid incorporated into rAAV vector were complexed into lipofectamine lipoplex (par. 58, relevant to cl. 7, 8). Otte discloses that miRNA can bind not only to the 3’-UTR of an mRNA transcript (par. 18) but also to complementary sequence of a miRNA or also notes as miRNA inhibitor as binding to the regulatory element of an miRNA of interest, its promoter or enhancer (par. 24).
Otte does not specifically disclose a sequence at least 80%, 98%, 99%, or 100% identical to the elected SEQ ID NO: 6 or “identical by sequence to the” elected SEQ ID NO: 6 (cl. 1, 21, 22, 23, 26, 27).
Zhang discloses examining artificial miRNA mimics with either centered-site complementarity or seed-site complementarity, which include both seed site and a 3’-end site, to determine if miRNA mimics (miR-mimics) designed to target the “centered sites” without the full “seed sites” complementarity can repress gene expression as natural miRNAs (abstract, Fig. 1, see excerpt below). Zhang suggests that based on evidence that single miRNA can target multiple mRNAs that actions of miRNA are not gene specific, but sequence motif specific for they can act on all genes that carry motifs matching their seed sites (pg. 2). Thus, Zhang proposes designing miRNA-mimics in such a way to reduce off-target effects, “or in other words, centered-site complementary can generate more gene-specific actions with tremendously less target genes” (pg. 2). Excerpt of Fig. 1 (left hand sequence panel) below displays the differences between the centered site (CS) and seed site (SS) complementary designed miRNAs targeting two different genes (BCL2 or AKT1, PS=passenger strand; GS=guide strand).
Fig. 1 miR-mimic sequences (left) and Fig. 2 line graph (right) from Zhang
PNG
media_image1.png
418
574
media_image1.png
Greyscale
It should be noted that in either centered site or seed site complementary, the total number of complementary nt. are 12/13 nt. or 14 nt., respectively. The results demonstrate that complementarity in centered site is more or equally effective in decreasing mRNA levels (Fig. 2, pg. 4, see line graphs above; CS=centered site and SS= seed site; NC – neg. control). The results lead the authors to conclude that centered sites miR-mimics may be used as a new tool for miRNA research. Thus a full complementarity is not required for a functional miR-mimic as long as there is Watson-Crick hybridization at critical sites between the target and the miRNA-mimic.
Here, Otte’s SEQ ID NO: 505 has identical seed sequence and most of centered site, thus has total of 13 nt. that are identical at 5’ end to instant SEQ ID NO: 6.
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Zhang discloses that the problem with miRNAs function is due to an imperfect complementarity can bind to many different targets, and suggests that focusing the hybridization of the target gene at the critical sites (i.e. seed-site or centered-site) will result in reduced off-target effects that will bind to its complementary site. Thus, a skilled artisan could have pursued alternative sites of the miRNA to bind to target for efficacy and reduce off-target binding, such as seed site, centered-site or even combining the seed site, positions 2-8, and portions of central site, including positions 9-13 or 9-14 to reduce off-target effects and still carry out the binding of target gene.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried to modify the miRNA 466b-5p of Otte in view of Zhang and arrive at the claimed invention with a reasonable expectation of success. Based on Zhang’s success of altering the binding site, i.e. to a centered site, as opposed to canonical seed-site position for complementary, and still have silencing of target gene and to confirm the bioinformatic prediction of miR-466b-5p’s apoptotic function of Otte, a skilled artisan would reasonably expect success in taking the miR-466b-5p of Otte and reducing the complementarity between the miR-466b-5p and its target gene and still have silencing with reduced off-target effects as taught by Zhang. Thus a full 80%-100% identity is not required for the same or even an improved silencing effect as demonstrated by Zhang. Thus, claims 1, 7-8, 10-11, 21-23, 25-27 examined claims are obvious.
Claims 4-5, 20 are interpreted as reciting inherent properties of the claimed product. The claims do not provide further structural limitations of the claims from which they depend. Claim 4 recites the target gene is human VEGFA, VEGFD or HIG1A. Claim 5 recites the target gene is human VEGFA. Claim 20 refers to binding increasing the expression of the human target gene.
The miRNA construct expressing the miRNA or the miRNA inhibitor recites the structural limitation of claimed subject matter, thus would inherently bind to its complementary sequence, which encompasses either a promoter region or a 3’-UTR of a target gene, regardless of the target gene, which here is VEGFA.
Allowable Subject Matter
No claim allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600