Prosecution Insights
Last updated: April 17, 2026
Application No. 17/419,239

CAR T CELL METHODS AND CONSTRUCTS

Non-Final OA §103§112
Filed
Jun 28, 2021
Examiner
KIM, TAEYOON
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Abintus Bio Inc.
OA Round
1 (Non-Final)
52%
Grant Probability
Moderate
1-2
OA Rounds
3y 11m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
450 granted / 874 resolved
-8.5% vs TC avg
Strong +51% interview lift
Without
With
+51.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
74 currently pending
Career history
948
Total Applications
across all art units

Statute-Specific Performance

§101
4.8%
-35.2% vs TC avg
§103
34.9%
-5.1% vs TC avg
§102
15.4%
-24.6% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 874 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I (claims 1-10, 12-14, 16-30) in the reply filed on 10/16/2024 is acknowledged. Applicant’s election of “CD19” as the species disclosed in claim 28 is also acknowledged. Claims 8-9, 11, 16 have been canceled, claims 31-50 have been withdrawn from consideration as being drawn to non-elected subject matter, and claims 1-7, 10, 12-14, 16-30 have been considered on the merits. Information Disclosure Statement It is noted that there are references listed in the instant specification. The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Claim Objections Claims 10 and 28 are objected to because of the following informalities: The term “MLV” in claim 10 should be in a full name followed by the abbreviation in a parenthesis. The term “BORIS or Brother of the Regulator ofImprinted Sites” in claim 28 should be “BORIS or Brother of the Regulator of Imprinted Sites”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-7, 10, 12-14, 16-30 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 discloses the term “CAR-like”. It is not clear what the metes and bounds for the term are. The claims and the instant specification do not define what the term “CAR-like” is intended to point out and thus, the term is considered indefinite. Claim 12 discloses that the non-replicating viral vector comprises an envelope comprising envelope proteins and lipid membrane. It is not clear how the vector comprises proteins and lipid membrane as the vector per se is a polynucleotide. It appears that the virus comprising RNV would comprise envelope proteins and lipid membrane. For examination purpose, claim 12 is interpreted as the composition comprising an envelope and the nucleic acid. Claim 28 discloses “Tn ag”. It is not clear what subject matter this term intends to point out. There is no indication what this term is or if it is an abbreviation, what the full name of the term is. Clarification is required. Claim 30 discloses that the viral vector is produced by expression of a sequence selected from SEQ ID NOs: 18-22. It is not clear what the phrase “produced by expression of a sequence” means. It is understood that the viral vector would have the sequence defined by one of the listed SEQ ID NOs, and the sequence would be expressed to form a virus in a host cell. Clarification is required. It is suggested to amend the phrase as, for example, “the viral vector comprises a sequence selected from the group …” instead. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 1-7, 10, 13-16 and 19-29 is/are rejected under 35 U.S.C. 103 as being unpatentable over Campana et al. (US2013026551; IDS ref.) in view of Gruber et al. (US2017/0175137; IDS ref.) Regarding claims 1-6, 22, 28, Campana et al. teach a retroviral vector encoding CD19-CAR comprising anti-CD19 scFv, CD8a signal peptide, hinge and transmembrane domain, CD28 intracellular domain; 4-1BB intracellular domain (paras. 24, 82-83, 103, 105, 108 and 143; Fig. 1). As the anti-CD19 CAR of Campana et al. specifically binds to CD19, an elected species for the antigen-binding domain, it is considered that the anti-CD19 CAR of Campana et al. would meet the limitation that a CAR product having an immune activating effect. Regarding the wherein clause of claim 1 directed to the non-replicating viral vector transducing or integrating into blood cells of the subject in vivo, the limitation does not provide any structure to the claimed composition and it is directed to the intended result and/or purpose. Thus, it does not limit the claim. While Campana et al. teach the vector is based on a retrovirus, they do not teach they are non-replicating viral vector. Gruber et al. teach a retroviral vector having immune-stimulating activity for treating cancer (abstract), and the vector comprises a retroviral non-replicating vector (RNV) (para. 109). The RNV of Gruber et al. includes pBA-9b encoding IFNg or IL2 (para. 24, 27 and 181; Example 17). It is noted that the RNV utilized in the instant application includes pBA-9b vector (paras. 99-100 of the PGPub). It would have been obvious to a person skilled in the art to utilize the RNV such as pBA-9b vector taught by Gruber et al. for the retroviral vector utilized in the method of Campana et al. in order to producing the anti-CD19 CAR with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because the pBA-9b or RNV taught by Gruber et al. would be considered as a suitable retroviral vector known in the art for expressing transgene. Furthermore, the method of Campana et al. contemplates stimulating a T cell-mediated immune response to us the anti-CD19 CAR (see para. 27), and thus, anti-CD19 CAR is considered as an immune-stimulating component. As Gruber et al. teach that polynucleotides encoding, for example, IFNg, CD, PD1 and other immune-stimulating components can be incorporated into any one of a variety of expression vectors (para. 64), one skilled in the art would recognize that anti-CD19 CAR of Campana et al. would be expressed using the pBA-9b vector of Gruber et al. Regarding Claims 2-5 directed to the subject being a mammal or a human, or being administered intraperitoneally or intravascularly, the wherein clause of these claims are directed to the intended use of the claimed composition and thus, these limitations do not provide any structure to the claimed composition. Thus, they do not limit the claimed product. Regarding claims 7 and 10, Gruber et al. teach that the pBA-9b vector is derived from pBA-5b and encodes MLV-based retroviral non-replicating vector containing an extended packaging region, and MLV is murine leukemia virus (paras. 69-70 and 181). Regarding claim 13 directed to the immune activating effect being an immune mediated activity, the limitation does not provide any structural limitation and the anti-CD19 CAR of Campana et al. is intended to stimulate immune response, it is considered that the viral construct encoding anti-CD19 CAR of Campana et al. in view of Gruber et al. would meet the limitation. Regarding claim 14, the wherein clause is directed to the intended method of using the claimed product and it does no limit the structure of the claimed composition. Thus, the wherein clause does not limit the claimed product. Regardless Campana et al. teach that the anti-CD19 CAR is expressed in T cell (para. 24). Regarding claims 16 and 20-21, the anti-CD19 CAR of Campana et al. contains antigen binding domain (i.e. anti-CD19), a transmembrane domain, and intracellular domain (signaling domain) (para. 21, 26 and 102). Campana et al. further teach human CD8a transmembrane domain (para. 26 and 108). Regarding the SEQ ID NO:1, the SEQ ID NO:1 is identical to SEQ ID NO: 13 of Campana et al. (see alignment below). PNG media_image1.png 259 729 media_image1.png Greyscale Regarding claim 23 directed to the optional spacer encoded by SEQ ID NO:2, the limitation is directed to an optional component of claim 16, and thus, the limitation of claim 23 is interpreted the same as claim 16. Even if the spacer is considered as a part of the vector, SEQ ID NO:2 of the instant application is identical to SEQ ID NO: 11 of Campana et al. (see alignment below). Campana et al. teach that SEQ ID NO:11 is CD8a hinge (para. 44). PNG media_image2.png 333 743 media_image2.png Greyscale Regarding claims 24 and 27 directed to the optional intracellular domain comprising a CD3z domain and SEQ ID NO: 4, the limitation is directed to an optional component of claim 16, and thus, the limitation of claim 23 is interpreted the same as claim 16. Regardless, Campana et al. teach the use of CD3z domain (para. 15). The SEQ ID NO: 17 of Campana et al. (para. 22) is 99.5% identical to SEQ ID NO: 4 of the instant application (see below). PNG media_image3.png 474 643 media_image3.png Greyscale Regarding claims 25-26 directed to the optional intracellular domain comprising 41BB, and the corresponding SEQ ID NO: 5, the limitation is directed to an optional component of claim 16, and thus, the limitation of claim 23 is interpreted the same as claim 16. Regardless, Campana et al. teach the signaling domain of 4-1BB (para. 15), encoded by SEQ ID NO: 15 (para. 22). The SEQ ID NO: 5 is identical to SEQ ID NO: 15 of Campana et al. PNG media_image4.png 339 736 media_image4.png Greyscale Regarding claim 29 directed to the self-inactivating nucleic acid sequence (SIN), Campana et al. in view of Gruber et al. do not particularly teach the limitation. However, it is considered that pBA-9b vector of Gruber et al. is considered to inherently contain SIN as the pBA-9b vector is non-replicating viral vector and the instant specification defines the SIN vector as replication-defective vectors (para. 74). Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim(s) 12 is/are rejected under 35 U.S.C. 103 as being unpatentable over Campana et al. in view of Gruber et al. as applied to claims 1-7, 10, 13-16 and 19-29 above, and further in view of Lin et al. (2014, Journal of Virology) and Aguilar-Cordova (US 2006/0057553), and as evidenced by Moloney murine leukemia virus complete genome (2024, GenBank, NCBI). Regarding claim 12 directed to the envelope comprising envelope protein and lipid membrane, Gruber et al. teach that pBA9b encoding hIFNg is pseudotyped with VSV-G (envelope protein) for subsequent transduction into HA-L2g1, HA-L2g2 and HA-L2g3 producer cell lines (para. 186). This is understood as the use of an envelope proteins and packaging the non-replicating retroviral vector in a lipid membrane (i.e. forming a viral particle comprising the non-replicating pBA9b vector). Lin et al. also teach the production of nonreplicating viral particles, virus-like particles comprising pBA9b (p.10067, 2nd col.) by using amphotropic envelope protein (MLV-A), VSV-G or both (MLV-A+G). This teaching is considered to form the viral particle comprising the pBA-9b-CD19 CAR contemplated by the combined teachings of Campana et al. in view of Gruber et al. The formed viral particle by pseudotyping as discussed above would contain an envelope comprising envelope proteins and lipid membrane. Regarding claim 12 directed to SEQ ID NO:12, the pBA-9b vector of Gruber et al. would meet the requirement of the claim as SEQ ID NO:12 of the instant claim is pBA-9b vector as SEQ ID NO:12 is pBA-9b vRNA genome according to the instant specification. Regarding the RNA sequence encoding a CAR being in between the nucleotide 1-1050 and 1101-1662, Gruber et al. do not particularly teach the limitation. Lin et al. teach pBA-9b vector (Fig. 5) and the diagram of pBA-9b shows that the vector contains a portion of Gag of MLV, and this portion of Gag sequence is corresponding to the nucleotides 1-1050 of SEQ ID NO:12 of the instant application. This is based on the alignment analysis of MLV complete genome (GenBank J02255.1) and SEQ ID NO:12 of the instant application (see below). The nucleotide sequence of 1-1050 of SEQ ID NO: 12 has identity of 99% (matching 1040 out of 1050) to the MLV. This is consistent with the diagram in Fig. 5 of Lin et al. that pBA-9b vector contains a portion of MLV genome sequence (Gag sequence). RESULT 1 NASEQ2_12052024_170417 Query Match 62.6%; Score 1041.2; DB 1; Length 8332; Best Local Similarity 72.1%; Matches 789; Conservative 272; Mismatches 33; Indels 0; Gaps 0; Qy 1 GCGCCAGUCCUCCGAUUGACUGAGUCGCCCGGGUACCCGUGUAUCCAAUAAACCCUCUUG 60 |||||||:||:||||::|||:|||:||||||||:|||||:|:|:||||:||||||:|::| Db 1 GCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTG 60 Qy 61 CAGUUGCAUCCGACUUGUGGUCUCGCUGUUCCUUGGGAGGGUCUCCUCUGAGUGAUUGAC 120 |||::|||:|||||::|:||:|:|||:|::||::|||||||:|:||:|:|||:||::||| Db 61 CAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGAC 120 Qy 121 UACCCGUCAGCGGGGGUCUUUCAUUUGGGGGCUCGUCCGGGAUCGGGAGACCCCUGCCCA 180 :|||||:|||||||||:|:::||:::||||||:||:||||||:|||||||||||:||||| Db 121 TACCCGTCAGCGGGGGTCTTTCATTTGGGGGCTCGTCCGGGATCGGGAGACCCCTGCCCA 180 Qy 181 GGGACCACCGACCCACCACCGGGAGGUAAGCUGGCCAGCAACUUAUCUGUGUCUGUCCGA 240 ||||||||||||||||||||||||||:||||:||||||||||::|:|:|:|:|:|:|||| Db 181 GGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTTATCTGTGTCTGTCCGA 240 Qy 241 UUGUCUAGUGUCUAUGACUGAUUUUAUGCGCCUGCGUCGGUACUAGUUAGCUAACUAGCU 300 ::|:|:||:|:|:|:|||:||::::|:|||||:|||:|||:||:||::|||:|||:|||: Db 241 TTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCT 300 Qy 301 CUGUAUCUGGCGGACCCGUGGUGGAACUGACGAGUUCGGAACACCCGGCCGCAACCCUGG 360 |:|:|:|:||||||||||:||:|||||:||||||::|||||||||||||||||||||:|| Db 301 CTGTATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGG 360 Qy 361 GAGACGUCCCAGGGACUUCGGGGGCCGUUUUUGUGGCCCGACCUGAGUCCAAAAAUCCCG 420 ||||||:|||||||||::|||||||||:::::|:|||||||||:|||:|||||||:|||| Db 361 GAGACGTCCCAGGGACTTCGGGGGCCGTTTTTGTGGCCCGACCTGAGTCCAAAAATCCCG 420 Qy 421 AUCGUUUUGGACUCUUUGGUGCACCCCCCUUAGAGGAGGGAUAUGUGGUUCUGGUAGGAG 480 |:||::::||||:|:::||:|||||||||::||||||||||:|:|:||::|:||:||||| Db 421 ATCGTTTTGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATATGTGGTTCTGGTAGGAG 480 Qy 481 ACGAGAACCUAAAACAGUUCCCGCCUCCGUCUGAAUUUUUGCUUUCGGUUUGGGACCGAA 540 |||||||||:|||||||::||||||:|||:|:|||:::::||:::|||:::||||||||| Db 481 ACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAA 540 Qy 541 GCCGCGCCGCGCGUCUUGUCUGCUGCAGCAUCGUUCUGUGUUGUCUCUGUCUGACUGUGU 600 |||||||||||||:|::|:|:||:||||||:||::|:|:|::|:|:|:|:|:|||:|:|: Db 541 GCCGCGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGT 600 Qy 601 UUCUGUAUUUGUCUGAGAAUUAAGGCCAGACUGUUACCACUCCCUGAAGUUUGACCUUAG 660 ::|:|:|:::|:|:|||||: ||||||||:|::|||||:|||: |||:::||||::|| Db 601 TTCTGTATTTGTCTGAGAATATGGGCCAGACTGTTACCACTCCCTTAAGTTTGACCTTAG 660 Qy 661 GUCACUGGAAAGAUGUCGAGCGGAUCGCUCACAACCAGUCGGUAGAUGUCAAGAAGAGAC 720 |:|||:|||||||:|:||||||||:|||:|||||||||:|||:|||:|:||||||||||| Db 661 GTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCGGTAGATGTCAAGAAGAGAC 720 Qy 721 GUUGGGUUACCUUCUGCUCUGCAGAAUGGCCAACCUUUAACGUCGGAUGGCCGCGAGACG 780 |::|||::|||::|:||:|:||||||:||||||||:::||||:||||:|||||||||||| Db 721 GTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACG 780 Qy 781 GCACCUUUAACCGAGACCUCAUCACCCAGGUUAAGAUCAAGGUCUUUUCACCUGGCCCGC 840 |||||:::||||||||||:||:||||||||::||||:|||||:|::::||||:||||||| Db 781 GCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGC 840 Qy 841 AUGGACACCCAGACCAGGUCCCCUACAUCGUGACCUGGGAAGCCUUGGCUUUUGACCCCC 900 |:||||||||||||||||:||||:|||:||:||||:||||||||::|||::::||||||| Db 841 ATGGACACCCAGACCAGGTCCCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCC 900 Qy 901 CUCCCUGGGUCAAGCCCUUUGUACACCCUAAGCCUCCGCCUCCUCUUCCUCCAUCCGCCC 960 |:|||:|||:|||||||:::|:||||||:|||||:|||||:||:|::||:|||:|||||| Db 901 CTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCGCCTCCTCTTCCTCCATCCGCCC 960 Qy 961 CGUCUCUCCCCCUUGAACCUCCUCGUUCGACCCCGCCUCGAUCCUCCCUUUAUCCAGCCC 1020 ||:|:|:|||||::|||||:||:||::||||||||||:|||:||:|||:::|:||||||| Db 961 CGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGCCTCGATCCTCCCTTTATCCAGCCC 1020 Qy 1021 UCACUCCUUCUCUAGGCGCCGGAAUUAAUUCUCGAGGGGCCCAGAUCUGCGGCCGCUCGC 1080 :|||:||::|:|:||||||| | :|| |:| || | | || | ||| Db 1021 TCACTCCTTCTCTAGGCGCCAAACCTAAACCTCAAGTTCTTTCTGACAGTGGGGGGCCGC 1080 Qy 1081 GAGUCGACAAGCUU 1094 :|||| |:: Db 1081 TCATCGACCTACTT 1094 As pBA-9b contains a multiple cloning site (MCS) followed by the partial Gag sequence, one skilled in the art would insert a transgene/gene of interest, i.e. anti-CD19 CAR, in the MCS of pBA-9b as taught by Lin et al. for the composition of Campana et al. in view of Gruber et al. with a reasonable expectation of success. It is also noted that the nucleotides 1-1047 of the SEQ ID NO:12 of the instant application is identical to the portion of SEQ ID NO:13 of Aguilar-Cordova (search results #8 below), which is a Gag/Pol of retroviral structural genes (see para. 67 of Aguilar-Cordova). Thus, the pBA-9b vector of Gruber et al. would contain a portion of Gag sequence consistent with the teaching of Lin et al. discussed above. RESULT 8 US-10-297-341-13/c Sequence 13, US/10297341 Publication No. US20060057553A1 GENERAL INFORMATION APPLICANT: Aguilar-Cordova, Estuardo TITLE OF INVENTION: Chimeric Viral Vectors for Gene Therapy FILE REFERENCE: HO-P01908US1 CURRENT APPLICATION NUMBER: US/10/297,341 CURRENT FILING DATE: 2002-11-26 PRIOR APPLICATION NUMBER: US 01/017,453 PRIOR FILING DATE: 2001-05-30 PRIOR APPLICATION NUMBER: US 60/207,845 PRIOR FILING DATE: 2000-05-30 NUMBER OF SEQ ID NOS: 25 SEQ ID NO 13 LENGTH: 2354 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Vector FEATURE: NAME/KEY: misc_feature LOCATION: (1)..(2354) OTHER INFORMATION: N = A, C, G, or T Query Match 65.4%; Score 1086.4; Length 2354; Best Local Similarity 70.8%; Matches 856; Conservative 294; Mismatches 37; Indels 22; Gaps 2; Qy 1 GCGCCAGUCCUCCGAUUGACUGAGUCGCCCGGGUACCCGUGUAUCCAAUAAACCCUCUUG 60 |||||||:||:||||::|||:|||:||||||||:|||||:|:|:||||:||||||:|::| Db 1735 GCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCCAATAAACCCTCTTG 1676 Qy 61 CAGUUGCAUCCGACUUGUGGUCUCGCUGUUCCUUGGGAGGGUCUCCUCUGAGUGAUUGAC 120 |||::|||:|||||::|:||:|:|||:|::||::|||||||:|:||:|:|||:||::||| Db 1675 CAGTTGCATCCGACTTGTGGTCTCGCTGTTCCTTGGGAGGGTCTCCTCTGAGTGATTGAC 1616 Qy 121 UACCCGUCAGCGGGGGUCUUUCAUUUGGGGGCUCGUCCGGGAUCGGGAGACCCCUGCCCA 180 :|||||:|||||||||:|::: |:::||||||:||:||||||:|||||||||||:||||| Db 1615 TACCCGTCAGCGGGGGTCTTTGATTTGGGGGCTCGTCCGGGATCGGGAGACCCCTGCCCA 1556 Qy 181 GGGACCACCGACCCACCACCGGGAGGUAAGCUGGCCAGCAACUUAUCUGUGUCUGUCCGA 240 ||||||||||||||||||||||||||:||||:||||||||||::|:|:|:|:|:|:|||| Db 1555 GGGACCACCGACCCACCACCGGGAGGTAAGCTGGCCAGCAACTTATCTGTGTCTGTCCGA 1496 Qy 241 UUGUCUAGUGUCUAUGACUGAUUUUAUGCGCCUGCGUCGGUACUAGUUAGCUAACUAGCU 300 ::|:|:||:|:|:|:|||:||::::|:|||||:|||:|||:||:||::|||:|||:|||: Db 1495 TTGTCTAGTGTCTATGACTGATTTTATGCGCCTGCGTCGGTACTAGTTAGCTAACTAGCT 1436 Qy 301 CUGUAUCUGGCGGACCCGUGGUGGAACUGACGAGUUCGGAACACCCGGCCGCAACCCUGG 360 |:|:|:|:||||||||||:||:|||||:||||||::|||||||||||||||||||||:|| Db 1435 CTGTATCTGGCGGACCCGTGGTGGAACTGACGAGTTCGGAACACCCGGCCGCAACCCTGG 1376 Qy 361 GAGACGUCCCAGGGACUUCGGGGGCCGUUUUUGUGGCCCGACCUGAGUCCAAAAAUCCCG 420 ||||||:|||||||||::|||||||||:::::|:|||||||||:|||:|||||||:|||| Db 1375 GAGACGTCCCAGGGACTTCGGGGGCCGTTTTTGTGGCCCGACCTGAGTCCAAAAATCCCG 1316 Qy 421 AUCGUUUUGGACUCUUUGGUGCACCCCCCUUAGAGGAGGGAUAUGUGGUUCUGGUAGGAG 480 |:||::::||||:|:::||:|||||||||::||||||||||:|:|:||::|:||:||||| Db 1315 ATCGTTTTGGACTCTTTGGTGCACCCCCCTTAGAGGAGGGATATGTGGTTCTGGTAGGAG 1256 Qy 481 ACGAGAACCUAAAACAGUUCCCGCCUCCGUCUGAAUUUUUGCUUUCGGUUUGGGACCGAA 540 |||||||||:|||||||::||||||:|||:|:|||:::::||:::|||:::||||||||| Db 1255 ACGAGAACCTAAAACAGTTCCCGCCTCCGTCTGAATTTTTGCTTTCGGTTTGGGACCGAA 1196 Qy 541 GCCGCGCCGCGCGUCUUGUCUGCUGCAGCAUCGUUCUGUGUUGUCUCUGUCUGACUGUGU 600 |||||||||||||:|::|:|:||:||||||:||::|:|:|::|:|:|:|:|:|||:|:|: Db 1195 GCCGCGCCGCGCGTCTTGTCTGCTGCAGCATCGTTCTGTGTTGTCTCTGTCTGACTGTGT 1136 Qy 601 UUCUGUAUUUGUCUGAGAAUUAAGGCCAGACUGUUACCACUCCCUGAAGUUUGACCUUAG 660 ::|:|:|:::|:|:|||||::||||||||||:|::|||||:|||: |||:::||||::|| Db 1135 TTCTGTATTTGTCTGAGAATTAAGGCCAGACTGTTACCACTCCCTTAAGTTTGACCTTAG 1076 Qy 661 GUCACUGGAAAGAUGUCGAGCGGAUCGCUCACAACCAGUCGGUAGAUGUCAAGAAGAGAC 720 |:|||:|||||||:|:||||||||:|||:|||||||||:|||:|||:|:||||||||||| Db 1075 GTCACTGGAAAGATGTCGAGCGGATCGCTCACAACCAGTCGGTAGATGTCAAGAAGAGAC 1016 Qy 721 GUUGGGUUACCUUCUGCUCUGCAGAAUGGCCAACCUUUAACGUCGGAUGGCCGCGAGACG 780 |::|||::|||::|:||:|:||||||:||||||||:::||||:||||:|||||||||||| Db 1015 GTTGGGTTACCTTCTGCTCTGCAGAATGGCCAACCTTTAACGTCGGATGGCCGCGAGACG 956 Qy 781 GCACCUUUAACCGAGACCUCAUCACCCAGGUUAAGAUCAAGGUCUUUUCACCUGGCCCGC 840 |||||:::||||||||||:||:||||||||::||||:|||||:|::::||||:||||||| Db 955 GCACCTTTAACCGAGACCTCATCACCCAGGTTAAGATCAAGGTCTTTTCACCTGGCCCGC 896 Qy 841 AUGGACACCCAGACCAGGUCCCCUACAUCGUGACCUGGGAAGCCUUGGCUUUUGACCCCC 900 |:||||||||||||||||:||||:|||:||:||||:||||||||::|||::::||||||| Db 895 ATGGACACCCAGACCAGGTCCCCTACATCGTGACCTGGGAAGCCTTGGCTTTTGACCCCC 836 Qy 901 CUCCCUGGGUCAAGCCCUUUGUACACCCUAAGCCUCCGCCUCCUCUUCCUCCAUCCGCCC 960 |:|||:|||:|||||||:::|:||||||:|||||:|||||:||:|::||:|||:|||||| Db 835 CTCCCTGGGTCAAGCCCTTTGTACACCCTAAGCCTCCGCCTCCTCTTCCTCCATCCGCCC 776 Qy 961 CGUCUCUCCCCCUUGAACCUCCUCGUUCGACCCCGCCUCGAUCCUCCCUUUAUCCAGCCC 1020 ||:|:|:|||||::|||||:||:||::|||||||| |:|||:||:|||:::|:||||||| Db 775 CGTCTCTCCCCCTTGAACCTCCTCGTTCGACCCCGNCTCGATCCTCCCTTTATCCAGCCC 716 Qy 1021 UCACUCCUUCUCUAGGCGCCGGAAUUAAUUCUCG---AGGGGCCCAGAUCUGCGGCCGCU 1077 :|||:||::|:|:|||||||||||::| || | | || : || | Db 715 TCACTCCTTCTCTAGGCGCCGGAATTAGGGGCCGCTCTAGCCTCGAGGAATTCGATATCA 656 Qy 1078 CGCGAGUCGACAAGCUUG-------------------GAUCCAUCGAUAAAAUAAAAGAU 1118 || :||| | : | || |||: ||:||| :||||||: Db 655 AGCTTATCGATACCGTCGACTGTTTAAACCTGAGTACGAGCCATAGATAAATTAAAAGAT 596 Qy 1119 UUUAUUUAGUCUCCAGAAAAAGGGGGGAAUGAAAGACCCCACCUGUAGGUUUGGCAAGCU 1178 :::|:::||:|:|||||||||||||||||:|||||||||||||:|:|||:::|||||||: Db 595 TTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCACCTGTAGGTTTGGCAAGCT 536 Qy 1179 AGCUUAAGU 1187 |||: ||: Db 535 AGCTATAGT 527 Regarding the nucleotides 1101-1662 of SEQ ID NO:12, it is noted that this portion of SEQ ID NO:12 is corresponding to the nucleotides 7771-8332 of Moloney leukemia virus (see below). As the pBA-9b vector contains U3-R after the multiple cloning site, it is considered that the portion of SEQ ID NO:12 (i.e. 1101-1662) is U3-R portion of pBA-9b vector of Gruber et al. based on the diagram taught by Lin et al. Moloney murine leukemia virus, complete genome Sequence ID: NC_001501.1 Length: 8332 Number of Matches: 4 Range 1: 7507 to 8068 Alignment statistics for match #1 Score Expect Identities Gaps 1027 bits(556) 0.0 560/562(99%) 0/562(0%) Query 1 ATCGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCAC 60 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7507 ATAGATAAAATAAAAGATTTTATTTAGTCTCCAGAAAAAGGGGGGAATGAAAGACCCCAC 7566 Query 61 CTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7567 CTGTAGGTTTGGCAAGCTAGCTTAAGTAACGCCATTTTGCAAGGCATGGAAAAATACATA 7626 Query 121 ACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7627 ACTGAGAATAGAGAAGTTCAGATCAAGGTCAGGAACAGATGGAACAGCTGAATATGGGCC 7686 Query 181 AAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7687 AAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCCAAGAACAGATGGAAC 7746 Query 241 AGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7747 AGCTGAATATGGGCCAAACAGGATATCTGTGGTAAGCAGTTCCTGCCCCGGCTCAGGGCC 7806 Query 301 AAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7807 AAGAACAGATGGTCCCCAGATGCGGTCCAGCCCTCAGCAGTTTCTAGAGAACCATCAGAT 7866 Query 361 GTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7867 GTTTCCAGGGTGCCCCAAGGACCTGAAATGACCCTGTGCCTTATTTGAACTAACCAATCA 7926 Query 421 GTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7927 GTTCGCTTCTCGCTTCTGTTCGCGCGCTTCTGCTCCCCGAGCTCAATAAAAGAGCCCACA 7986 Query 481 ACCCCTCACTCGGCGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCC 540 ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7987 ACCCCTCACTCGGGGCGCCAGTCCTCCGATTGACTGAGTCGCCCGGGTACCCGTGTATCC 8046 Query 541 AATAAACCCTCTTGCAGTTGCA 562 |||||||||||||||||||||| Sbjct 8047 AATAAACCCTCTTGCAGTTGCA 8068 Regarding the wherein clause of claim 12 directed to the RNV can infect dividing cells and being integrated into the dividing cells, the limitation does not limit the product as it does not provide any structure to the claimed composition. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Claim(s) 17-18 is/are rejected under 35 U.S.C. 103 as being unpatentable over Campana et al. in view of Gruber et al. as applied to claims 1-7, 10, 13-16 and 19-29 above, and further in view of Han et al. (2017, Molecular Therapy). Regarding claims 17-18 directed to the antigen binding domain being a non-Ig binding domain and comprising a scaffold protein, Campana et al. in view of Gruber et al. do not particularly teach the limitation. Han et al. teach that adnectin-based CAR for T cell engineering (see entire document). Han et al. teach that adnectin is derived from a single domain scaffold of type III human fibronectin, and the 10Fn3 domain is a member of the Ig superfamily which resembles an Ig variable domain but has no disulfide bonds (p.2467, 1st col.). Thus, adnectin is considered as a non-Ig binding domain. Further, the instant specification discloses that adnectin is one of known non-Ig scaffold proteins (Table 1). Han et al. compared that scFv-based CARs and adnectin-based CARs, and have concluded that adnectin-based CARs exhibited equivalent effect compared to the scFv-based CARs (Abstract). It would have been obvious to a person skilled in the art to replace the anti-CD19-CAR of Campana et al. in view of Gruber et al. to with the scFv based anti-CD19-CAR with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because the adnectin-based CARs are equivalent to scFv-based CARs according to Han et al. and the anti-CD19-CAR of Campana et al. in view of Gruber et al. is a scFv based CAR. Substituting equivalents known for the same purpose is obvious. See M.P.E.P. §2144.06 Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached on 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TAEYOON KIM/Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Jun 28, 2021
Application Filed
Dec 06, 2024
Non-Final Rejection — §103, §112
Jun 27, 2025
Response after Non-Final Action

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594301
COMPOSITIONS AND METHODS FOR TREATMENT OF LIQUID CANCERS
2y 5m to grant Granted Apr 07, 2026
Patent 12583894
MATERIALS AND METHODS FOR THE TREATMENT OF LEWY BODY DISORDERS
2y 5m to grant Granted Mar 24, 2026
Patent 12582699
COMPOSITIONS AND METHODS FOR ENHANCED LYMPHOCYTE-MEDIATED IMMUNOTHERAPY
2y 5m to grant Granted Mar 24, 2026
Patent 12582724
Compositions and Methods for the Treatment of Genetic Diseases
2y 5m to grant Granted Mar 24, 2026
Patent 12577535
GENERATION OF A MESENCHYMAL STROMAL CELL BANK FROM THE POOLED MONONUCLEAR CELLS OF MULTIPLE BONE MARROW DONORS
2y 5m to grant Granted Mar 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+51.1%)
3y 11m
Median Time to Grant
Low
PTA Risk
Based on 874 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in for Full Analysis

Enter your email to receive a magic link. No password needed.

Free tier: 3 strategy analyses per month