Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Applicant’s amendments and remarks filed on November 12, 2025 are acknowledged. Claims 12, 14-16, 18, 22-34, and 36-41 have been canceled. Claims 11 and 17 were amended. Claims 1-11, 13, 17, 19-21, 35, and 42-44 are pending. Claims 20, 21, and 35 are withdrawn.
Claims 1-11, 13, 17, 19, and 42-44 are examined on the merits herein as they read on the elected species of (a) SEQ ID NO: 342, and (b) and (c) SEQ ID NOS: 28 and 185.
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on November 12, 2025 has been entered.
Priority
This application claims priority to PCT/CN2019/129025 filed on December 27, 2019 which claims priority to CN201811634268.5 filed on December 29, 2018.
While certified copies of the foreign priority documents were received, translation of the priority document was not provided. Therefore, priority is given with the effective filing date of December 27, 2019, which is the PCT filing date.
Withdrawn Objections
In view of Applicant’s amendments and response, the claim objection is withdrawn.
Withdrawn Rejections
In view of Applicant’s amendments and response, the 35 U.S.C 112(b) rejection is withdrawn.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on November 12, 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Specification
Applicant is reminded of the proper language and format for an abstract of the disclosure.
The abstract should be in narrative form and generally limited to a single paragraph on a separate sheet within the range of 50 to 150 words in length. The abstract should describe the disclosure sufficiently to assist readers in deciding whether there is a need for consulting the full patent text for details.
The language should be clear and concise and should not repeat information given in the title. It should avoid using phrases which can be implied, such as, “The disclosure concerns,” “The disclosure defined by this invention,” “The disclosure describes,” etc. In addition, the form and legal phraseology often used in patent claims, such as “means” and “said,” should be avoided.
The abstract of the disclosure is objected to because the abstract exceeds 150 words in length. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3-11, 17, 42, and 43 are rejected under 35 U.S.C. 103 as being unpatentable over Saetrom et al. (US 2018/0305689; reference cited by the Applicant).
Regarding claims 1, 3-10, 42, and 43, Saetrom et al. teaches oligonucleotides, e.g., saRNAs useful in upregulating the expression of a target gene and therapeutic compositions comprising such oligonucleotides [abstract]. Saetrom et al. teaches that the target gene which can be modulated by the saRNA includes SMN2 [0100]. Further, the saRNA may have two strands (an antisense strand and a sense strand) that form a duplex [0071]. The region of alignment between the target antisense RNA transcript and the promoter region of the target gene may be partial and may be as short as a single nucleotide in length although it may be at least 15 or at least 20 nucleotides in length [0042]. Saetrom et al. also teaches that the saRNA duplex may also be formed from a single molecule that is at least partly self-complementary forming a hairpin structure, including a duplex region [0076]. In some embodiments, the saRNA may be single or double stranded [0089]. Further, a double-stranded saRNA may include one or more single-stranded nucleotide overhangs [0082]. In one embodiment, the antisense strand of a double-stranded saRNA has a 1-10 nucleotide overhang at the 3′ end and/or the 5′ end. The overhang comprises one or more deoxyribonucleoside (e.g., dTdT) [0083].
Saetrom et al. does not particularly teach the sequence of the sense fragment or antisense fragment having 100% homology or complementarity to any one of SEQ ID NOS: 476 to 479. As disclosed in the instant specification, SEQ ID NO: 476 is the promoter region of SMN2 gene at positions 1639 to 1481 [0006].
It would have been obvious to a person skilled in the art to select the claimed sequence (i.e. positions 1639 to 1481; SEQ ID NO: 476) for the sense and antisense sequence fragments for saRNA to activate the expression of SMN2 gene as taught by Saetrom et al. because Saetrom et al. taught that the target sequence of the saRNA can be within the TSS (transcription starting site) core between 2000 nucleotides upstream and 2000 nucleotides downstream of the TSS [0056]. SEQ ID NO: 318559 is a TSS core [0070] of SMN2. As shown in the sequence search results below, SEQ ID NO: 318559 (designated as Db) has a 100% match to instant SEQ ID NO: 476 (designated as Qy). Therefore, it is expected that one would obtain the claimed saRNA by designing saRNA based on the target position being at less than 250 or less than 100 nucleotides upstream of the TSS of SEQ ID NO: 318559 (SMN2 TSS) as taught by Saetrom et al. with a reasonable expectation of success.
Query Match 100.0%; Score 159; DB 1; Length 4001;
Qy 1 AGTCGCACTCTGTCACTCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGCAACCTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 3640 AGTCGCACTCTGTCACTCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGCAACCTC 3581
Qy 61 CGCCTCCCGAGTTCAAGTGATTCTCCTGGCTCAGCCTCCCAAGCAGCTGTCATTACAGGC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 3580 CGCCTCCCGAGTTCAAGTGATTCTCCTGGCTCAGCCTCCCAAGCAGCTGTCATTACAGGC 3521
Qy 121 CTGCACCACCACACCCGGCTGATTTTTGTATTTTTAGGA 159
|||||||||||||||||||||||||||||||||||||||
Db 3520 CTGCACCACCACACCCGGCTGATTTTTGTATTTTTAGGA 3482
SEQ ID NO: 342 1 CTGTCATTACAGGCCTGCA 19
|||||||||||||||||||
Saetrom et al., SEQ ID NO: 318559 3534 CTGTCATTACAGGCCTGCA 3516
SEQ ID NO: 28 1 CUGUCAUUACAGGCCUGCA 19
|:|:||::|||||||:|||
Saetrom et al., SEQ ID NO: 318559 3534 CTGTCATTACAGGCCTGCA 3516
SEQ ID NO: 185 1 UGCAGGCCUGUAAUGACAGTT 21
:|||||||:|:||:||||| |
Saetrom et al., SEQ ID NO: 318559 3516 TGCAGGCCTGTAATGACAGCT 3536
Regarding claim 11, Saetrom et al. teaches that the saRNA may include any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage (e.g. to a linking phosphate/to a phosphodiester linkage/to the phosphodiester backbone) [0116].
Regarding claim 17, Saetrom et al. teaches pharmaceutical compositions comprising a small activating RNA (saRNA) that upregulates a target gene, and at least one pharmaceutically acceptable carrier [0142]. Further, the pharmaceutical compositions of saRNA include liposomes [0164].
Claims 2, 13, and 44 are rejected under 35 U.S.C. 103 as being unpatentable over Saetrom et al. (US 2018/0305689; reference cited by the Applicant) as applied to claims 1, 3-11, 17, 42, and 43 above, and further in view of Li (RNA Activation, Advances in Experimental Medicine and Biology 2017; reference cited by Applicant).
Regarding claims 2, 13, and 44, the teachings of Saetrom et al. are discussed above.
However, Saetrom et al. does not teach that the saRNA activates or upregulates the expression of SMN2 by at least 10% relative to untreated or control treated cells.
Li teaches that RNAa generally upregulates genes by a magnitude of twofold to fivefold as assessed by the levels of steady-state mRNA and the change is considered to be within the physiological range [Section 1.3.4]. Li also teaches design rules for effective saRNAs on gene promoters which include: (1) use the sense DNA sequence of the promoter as the template for saRNA design; (2) targets can be selected within a promoter region between at -100 and -1000 bp upstream of the transcription start site (TSS); (3) targets should be 19-nt in size; (4) targets should have a GC content of 40–60%, GC-rich regions or CpG islands should be avoided; (5) the corresponding saRNA duplexes should have lower thermodynamic stability at the 3’ end than the 5’ end; (6) the 18th and 19th positions counted from the 5’ end of targets should be “A/T”s, preferably “A”s; (7) avoid sequences that have five or more consecutive nucleotides; (8) avoid simple repeat sequences such as di- or tri-nucleotide repeats; and (9) the 20–23rd nucleotides (flanking the 3’ end of a target) should preferably be “A/T”s [Section 1.4].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a small activating RNA according to claim 1 using the design principles taught by Saetrom et al. and Li because it would have amounted to applying known design principles to a TSS core sequence of SMN2 to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Li taught that RNAa generally upregulates genes by a magnitude of twofold to fivefold.
Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Saetrom et al. (US 2018/0305689; reference cited by the Applicant) as applied to claims 1, 3-11, 17, 42, and 43 above, and further in view of Janowski et al. (Nature Chemical Biology 2007; reference cited by the Applicant) and Li et al. (US 2010/0210707; reference cited by the Applicant).
Regarding claim 19, the teachings of Saetrom et al. are discussed above.
However, Saetrom et al. does not teach the concentration of saRNA in the composition.
Janowski et al. teaches that chromosome targeted RNAs activate gene expression and identified multiple duplex RNAs complementary to the progesterone receptor (PR) promoter that increase expression of PR protein [abstract]. Janowski et al. teaches the use of 6 nM up to 100 nM of saRNA for PR protein [Figure 1].
Li et al. teaches compositions, pharmaceutical preparations, kits and methods for increasing expression of a gene product in a cell by contacting the cell with a small activating RNA (saRNA) molecule comprising a ribonucleic strand that is complementary to a non-coding nucleic acid sequence of the gene [abstract]. Further, Li et al. teaches the use of saEcad-P2 saRNA at concentrations ranging from 0.1 nM to 50 nM [Figure 4].
It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to optimize the concentration of the saRNA in a composition taught by Saetrom et al. and arrive at the instantly claimed range because Janowski et al. and Li et al. taught ranges within the instantly claimed range to activate gene expression.
Response to Arguments
Applicant's arguments filed November 12, 2025 have been fully considered but they are not persuasive.
Applicant asserts that Saetrom et al. does not specifically direct a person having ordinary skill in the art to the hot spots provided by any of SEQ ID NOS: 476-479 or provide a reasonable expectation of targeting these specific regions. Applicant further asserts the following:
PNG
media_image1.png
646
808
media_image1.png
Greyscale
These arguments are not found persuasive. While Saetrom et al. provides general teachings, it would have been obvious to select the claimed sequence (i.e. positions 1639 to 1481; SEQ ID NO: 476) for the sense and antisense sequence fragments for saRNA to activate the expression of SMN2 gene with a reasonable expectation of success. As Applicant indicates, Saetrom et al. suggests targeting the TSS core of SMN2 gene and thus does not teach away from targeting the TSS core of SMN2 gene. Therefore, it would have been obvious to try to develop small activating nucleic acid molecules that can activate SMN2 transcription with high specificity by targeting SMN2 promoter because small-molecule HDAC inhibitors do not have clinical efficacy in human patients with SMA. Even if the number of possible target sequences within a 4,000 nucleotide window is combinatorially immense as Applicant asserts, this is a finite number of saRNAs.
Applicant points to the data in Figure 3 which illustrates the unpredictability in finding saRNA target regions throughout the SMN2 promoter and demonstrates that saRNA directed to the H1 region (SEQ ID NO: 476) has a significantly greater likelihood of increasing expression than randomly targeting the promoter. Applicant asserts that pronounced differences in efficacy among various regions within the SMN2 promoter were observed and the identification of a specific sub-region identified hotspots that consistently yielded functional saRNA.
These arguments are not found persuasive. As evidenced by Figure 3, targeting anywhere within the H1 region does not provide unexpectedly better results for the entirety of the sequence because some saRNAs provide lower expression while others provide elevated expression.
Applicant asserts that the rejection to claim 13 argues that activity is an inherent part of the structure and asserts that the rejection failed to provide a particular reference structure for inherency or support for an argument that all the possible saRNA activate or upregulate the expression of SMN2.
This argument is found persuasive. However, upon further consideration, a new ground of rejection is made in view of Li (RNA Activation, Advances in Experimental Medicine and Biology 2017; reference cited by Applicant). Li teaches design rules for effective saRNAs on gene promoters which includes selecting targets within a promoter region between at -100 and -1000 bp upstream of the transcription start site (TSS). Further, Li teaches that RNAa generally upregulates genes by a magnitude of twofold to fivefold as assessed by the levels of steady-state mRNA and the change is considered to be within the physiological range.
Applicant asserts that claims 8-10 and 42 provide for different oligonucleotide descriptions or combinations. Applicant further asserts that the rejection failed to indicate where such descriptions are provided for in the prior art. It is noted that Applicant elected SEQ ID NOS: 28 and 185 and an alignment was previously provided of Saetrom et al. SEQ ID NO: 318559 with instant SEQ ID NOS: 28 and 185. In addition, an alignment has been provided of Saetrom et al. SEQ ID NO: 318559 with instant SEQ ID NO: 342 in the 35 U.S.C. 103 rejection above.
Applicant indicates that Janowski et al. and Li et al. are cited for possible dosages of a different saRNA and fail to cure the noted deficiencies in Saetrom et al. Further, Applicant asserts that the rejection based on the Saetrom et al., Janowski et al., and Li et al. references fail to provide a rationale why a particular saRNA dose directed to PR protein would be applicable to saRNA targeting SMN2.
These arguments are not found persuasive. Janowski et al. and Li et al. were used to demonstrate that different saRNAs use different concentrations for activating the desired gene. Thus, one skilled in the art would readily modify the range of saRNA for SMN2 taught by Saetrom et al. for the desired outcome of activating gene expression of SMN2 with a reasonable expectation of success.
Therefore, the Examiner is maintaining the 35 U.S.C. 103 rejections.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/C.T./
Examiner, Art Unit 1637
/CELINE X QIAN/ Primary Examiner, Art Unit 1637