Prosecution Insights
Last updated: September 17, 2026
Application No. 17/419,569

OLIGOMERIC NUCLEIC ACID MOLECULE AND APPLICATION THEREOF

Final Rejection §103
Filed
Jun 29, 2021
Priority
Dec 29, 2018 — CN 201811634268.5 +1 more
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Ractigen Therapeutics
OA Round
4 (Final)
49%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
98%
With Interview

Examiner Intelligence

Grants 49% of resolved cases
49%
Career Allowance Rate
29 granted / 59 resolved
-10.8% vs TC avg
Strong +48% interview lift
Without
With
+48.3%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
51 currently pending
Career history
113
Total Applications
across all art units

Statute-Specific Performance

§101
5.6%
-34.4% vs TC avg
§103
33.8%
-6.2% vs TC avg
§102
12.3%
-27.7% vs TC avg
§112
35.3%
-4.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 59 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant’s amendments and remarks filed on June 16, 2026 are acknowledged. Claims 12-16, 18, 22-34, 36-41, and 44 have been canceled. Claim 1 was amended. Claims 1-11, 17, 19-21, 35, 42, 43, and 45-47 are pending. Claims 20, 21, and 35 are withdrawn. Claims 1-11, 17, 19, 42, 43, and 45-47 are examined on the merits herein as they read on the elected species of (a) SEQ ID NO: 342, and (b) and (c) SEQ ID NOS: 28 and 185. Priority This application claims priority to PCT/CN2019/129025 filed on December 27, 2019 which claims priority to CN201811634268.5 filed on December 29, 2018. While certified copies of the foreign priority documents were received, translation of the priority document was not provided. Therefore, priority is given with the effective filing date of December 27, 2019, which is the PCT filing date. Withdrawn Objections In view of Applicant’s amendments and response, the objection to the abstract is withdrawn. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-11, 17, 42, 43, and 45-47 are rejected under 35 U.S.C. 103 as being unpatentable over Saetrom et al. (US 2018/0305689; reference cited by the Applicant) in view of Li (RNA Activation, Advances in Experimental Medicine and Biology 2017; reference cited by Applicant). Regarding claims 1-10, 42, 43, and 45-47, Saetrom et al. teaches oligonucleotides, e.g., saRNAs useful in upregulating the expression of a target gene and therapeutic compositions comprising such oligonucleotides [abstract]. Saetrom et al. teaches that the target gene which can be modulated by the saRNA includes SMN2 [0100]. Further, the saRNA may have two strands (an antisense strand and a sense strand) that form a duplex [0071]. The region of alignment between the target antisense RNA transcript and the promoter region of the target gene may be partial and may be as short as a single nucleotide in length although it may be at least 15 or at least 20 nucleotides in length [0042]. Saetrom et al. also teaches that the saRNA duplex may also be formed from a single molecule that is at least partly self-complementary forming a hairpin structure, including a duplex region [0076]. In some embodiments, the saRNA may be single or double stranded [0089]. Further, a double-stranded saRNA may include one or more single-stranded nucleotide overhangs [0082]. In one embodiment, the antisense strand of a double-stranded saRNA has a 1-10 nucleotide overhang at the 3′ end and/or the 5′ end. The overhang comprises one or more deoxyribonucleoside (e.g., dTdT) [0083]. Regarding claim 11, Saetrom et al. teaches that the saRNA may include any useful modification, such as to the sugar, the nucleobase, or the internucleoside linkage (e.g. to a linking phosphate/to a phosphodiester linkage/to the phosphodiester backbone) [0116]. Regarding claim 17, Saetrom et al. teaches pharmaceutical compositions comprising a small activating RNA (saRNA) that upregulates a target gene, and at least one pharmaceutically acceptable carrier [0142]. Further, the pharmaceutical compositions of saRNA include liposomes [0164]. However, Saetrom et al. does not particularly teach the sequence of the sense fragment or antisense fragment having 100% homology or complementarity to SEQ ID NO: 476. As disclosed in the instant specification, SEQ ID NO: 476 is the promoter region of SMN2 gene at positions -1639 to -1481 [0006]. Saetrom et al. also does not teach that the saRNA activates or upregulates the expression of SMN2 by at least 10% relative to untreated or control treated cells. Li teaches that RNAa generally upregulates genes by a magnitude of twofold to fivefold as assessed by the levels of steady-state mRNA and the change is considered to be within the physiological range [Section 1.3.4]. Li also teaches design rules for effective saRNAs on gene promoters which include: (1) use the sense DNA sequence of the promoter as the template for saRNA design; (2) targets can be selected within a promoter region between at -100 and -1000 bp upstream of the transcription start site (TSS); (3) targets should be 19-nt in size; (4) targets should have a GC content of 40–60%, GC-rich regions or CpG islands should be avoided; (5) the corresponding saRNA duplexes should have lower thermodynamic stability at the 3’ end than the 5’ end; (6) the 18th and 19th positions counted from the 5’ end of targets should be “A/T”s, preferably “A”s; (7) avoid sequences that have five or more consecutive nucleotides; (8) avoid simple repeat sequences such as di- or tri-nucleotide repeats; and (9) the 20–23rd nucleotides (flanking the 3’ end of a target) should preferably be “A/T”s [Section 1.4]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to select the claimed sequence (i.e. positions -1639 to -1481; SEQ ID NO: 476) for the sense and antisense sequence fragments for saRNA to activate or upregulate the expression of SMN2 gene as taught by Saetrom et al. because Saetrom et al. taught that the target sequence of the saRNA can be within the TSS (transcription starting site) core between 2000 nucleotides upstream and 2000 nucleotides downstream of the TSS [0056]. SEQ ID NO: 318559 is a TSS core [0070] of SMN2. As shown in the sequence search results below, SEQ ID NO: 318559 (designated as Db) has a 100% match to instant SEQ ID NO: 476 (designated as Qy). Therefore, it is expected that one would obtain the claimed saRNA by designing saRNA based on the target position being at less than 250 or less than 100 nucleotides upstream of the TSS of SEQ ID NO: 318559 (SMN2 TSS) as taught by Saetrom et al. with a reasonable expectation of success. Query Match 100.0%; Score 159; DB 1; Length 4001; Qy 1 AGTCGCACTCTGTCACTCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGCAACCTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3640 AGTCGCACTCTGTCACTCAGGCTGGAGTGCAGTGGCGTGATCTTGGCTCACTGCAACCTC 3581 Qy 61 CGCCTCCCGAGTTCAAGTGATTCTCCTGGCTCAGCCTCCCAAGCAGCTGTCATTACAGGC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3580 CGCCTCCCGAGTTCAAGTGATTCTCCTGGCTCAGCCTCCCAAGCAGCTGTCATTACAGGC 3521 Qy 121 CTGCACCACCACACCCGGCTGATTTTTGTATTTTTAGGA 159 ||||||||||||||||||||||||||||||||||||||| Db 3520 CTGCACCACCACACCCGGCTGATTTTTGTATTTTTAGGA 3482 SEQ ID NO: 342 1 CTGTCATTACAGGCCTGCA 19 ||||||||||||||||||| Saetrom et al., SEQ ID NO: 318559 3534 CTGTCATTACAGGCCTGCA 3516 SEQ ID NO: 28 1 CUGUCAUUACAGGCCUGCA 19 |:|:||::|||||||:||| Saetrom et al., SEQ ID NO: 318559 3534 CTGTCATTACAGGCCTGCA 3516 SEQ ID NO: 185 1 UGCAGGCCUGUAAUGACAGTT 21 :|||||||:|:||:||||| | Saetrom et al., SEQ ID NO: 318559 3516 TGCAGGCCTGTAATGACAGCT 3536 It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a small activating RNA according to claim 1 using the design principles taught by Saetrom et al. and Li because it would have amounted to applying known design principles to a TSS core sequence of SMN2 to yield predictable results. One of ordinary skill in the art would have been motivated to do so because Li taught that RNAa generally upregulates genes by a magnitude of twofold to fivefold. Claim 19 is rejected under 35 U.S.C. 103 as being unpatentable over Saetrom et al. (US 2018/0305689; reference cited by the Applicant) in view of Li (RNA Activation, Advances in Experimental Medicine and Biology 2017; reference cited by Applicant) as applied to claims 1-11, 17, 42, 43, and 45-47 above, and further in view of Janowski et al. (Nature Chemical Biology 2007; reference cited by the Applicant) and Li et al. (US 2010/0210707; reference cited by the Applicant). Regarding claim 19, the teachings of Saetrom et al. and Li are discussed above. However, Saetrom et al. and Li do not teach the concentration of saRNA in the composition. Janowski et al. teaches that chromosome targeted RNAs activate gene expression and identified multiple duplex RNAs complementary to the progesterone receptor (PR) promoter that increase expression of PR protein [abstract]. Janowski et al. teaches the use of 6 nM up to 100 nM of saRNA for PR protein [Figure 1]. Li et al. teaches compositions, pharmaceutical preparations, kits and methods for increasing expression of a gene product in a cell by contacting the cell with a small activating RNA (saRNA) molecule comprising a ribonucleic strand that is complementary to a non-coding nucleic acid sequence of the gene [abstract]. Further, Li et al. teaches the use of saEcad-P2 saRNA at concentrations ranging from 0.1 nM to 50 nM [Figure 4]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to optimize the concentration of the saRNA in a composition taught by Saetrom et al. and arrive at the instantly claimed range because Janowski et al. and Li et al. taught ranges within the instantly claimed range to activate gene expression. Response to Arguments Applicant's arguments filed June 16, 2026 have been fully considered but they are not persuasive. Applicant asserts that the cited art does not identify the claimed hotspot regions as predictable solutions and does not provide a reasonable expectation of success for the claimed saRNAs. Applicant further asserts the following: PNG media_image1.png 618 798 media_image1.png Greyscale Applicant further asserts that Saetrom et al. provides a broad exploration direction and does not identify/predict any specific functional hotspot, let alone identify any particular saRNA targeting the SMN2 promoter or provide any data concerning activity that can be generated. Applicant asserts that the mere inclusion of a particular sequence within a known larger genomic sequence does not establish the particular sequence as having a recognized functional significance. Further, the cited art provides no teaching as to why a specific region corresponding to SEQ ID NOS: 476-479 should have been selected nor does it provide any basis for expecting such a region to exhibit enriched biological activity. Finally, Applicant asserts that the instant application demonstrates that the relevant discovery includes the recognition of a previously unknown functional organization within the SMN2 promoter. Applicant points to Figure 3 asserting that active saRNA target sites were not distributed uniformly throughout the promoter region and instead functional activity was concentrated within a limited number of discrete regions designated as H1-H4. These arguments are not found persuasive. Saetrom et al. taught oligonucleotides such as saRNAs useful in upregulating the expression of a target gene and therapeutic compositions comprising such oligonucleotides. Further, the saRNA can be a single-stranded RNA (14-30 nucleotides) or double-stranded RNA (each strand comprising 14-30 nucleotides) that upregulates or has a positive effect on the expression of a specific gene. The target gene can be any gene of interest and has a promoter region on the template strand [0019]. While Saetrom et al. provides general teachings, it would have been obvious to select the claimed sequence (i.e. positions -1639 to -1481; SEQ ID NO: 476) for the sense and antisense sequence fragments for saRNA to activate the expression of SMN2 gene with a reasonable expectation of success. Saetrom et al. taught that the target sequence of the saRNA can be within the TSS (transcription starting site) core between 2000 nucleotides upstream and 2000 nucleotides downstream of the TSS. Therefore, Saetrom et al. suggests targeting the TSS core of SMN2 gene and thus does not teach away from targeting the TSS core of SMN2 gene. Therefore, it would have been obvious to try to develop small activating nucleic acid molecules that can activate SMN2 transcription with high specificity by targeting SMN2 promoter because small-molecule HDAC inhibitors do not have clinical efficacy in human patients with SMA. Even if the number of possible target sequences within a 4,000 nucleotide window is combinatorially immense, this is a finite number of saRNAs. In addition, contrary to Applicant’s assertions, as evidenced by Figure 3, targeting within the H1 region does not provide unexpectedly better results for the entirety of the sequence because some saRNAs provide lower expression while others provide elevated expression. Applicant asserts that Li provides general design rules for saRNA construction including targeting windows of -100 to -1,000 bp relative to the TSS, 19 nucleotide target length, and 40-60% GC content and does not provide the requisite reasonable expectation of success for the claimed sequences. Applicant further asserts that applying the Li rules provides a low predictability of success and fails to account for the complex nature of identifying an saRNA hotspot. Applicant points to Section 1.4 of Li asserting the limitations of the rules. These arguments are not found persuasive. Li discloses in Section 1.4 that designing effective saRNAs on gene promoters is largely a hit-or-miss process due to a lack of full understanding of RNAa mechanism. However, Li published a set of saRNA design rules which allows a success rate of 10-20%. Although the success rate is 10-20%, Li does disclose rules for designing effective saRNAs on gene promoters. It is noted that an opinion as to the complex nature of identifying an saRNA hotspot has been made; however, no evidentiary support has been provided for the opinion. The arguments of counsel cannot take the place of evidence in the record. In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re Geisler, 116 F.3d 1465, 43 USPQ2d 1362 (Fed. Cir. 1997) ("An assertion of what seems to follow from common experience is just attorney argument and not the kind of factual evidence that is required to rebut a prima facie case of obviousness."). See MPEP 2145(I) and 716.01(c)(II). Applicant asserts the following: PNG media_image2.png 204 798 media_image2.png Greyscale These arguments are not found persuasive. Saetrom et al. and Li taught a composition comprising the saRNA of claim 1 and a pharmaceutically acceptable carrier. Saetrom et al. also taught that the saRNA may have sequence identity to a sequence that aligns with the promoter region of the target gene [0084]. However, Saetrom et al. and Li do not teach the concentration of saRNA in the composition. Therefore, Janowski et al. and Li et al. were used in combination with Saetrom et al. and Li to render obvious the limitation of the saRNA concentration in the composition. Although Janowski et al. does not teach a SMN2 promoter, Janowski et al. taught that chromosome targeted RNAs activate gene expression and identified multiple duplex RNAs complementary to the progesterone receptor (PR) promoter that increase expression of PR protein and also taught the use of 6 nM up to 100 nM of saRNA for PR protein. Although Li et al. does not teach a SMN2 promoter, Li et al. taught compositions, pharmaceutical preparations, kits and methods for increasing expression of a gene product in a cell by contacting the cell with a small activating RNA (saRNA) molecule and also taught the use of saEcad-P2 saRNA at concentrations ranging from 0.1 nM to 50 nM. Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to optimize the concentration of the saRNA in a composition taught by Saetrom et al. and arrive at the instantly claimed range because Janowski et al. and Li et al. taught ranges within the instantly claimed range to activate gene expression. One skilled in the art would readily modify the concentration range of saRNA for SMN2 taught by Saetrom et al. for the desired outcome of activating gene expression of SMN2 with a reasonable expectation of success. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Show 1 earlier event
Nov 20, 2024
Non-Final Rejection mailed — §103
Apr 21, 2025
Response Filed
May 13, 2025
Final Rejection mailed — §103
Nov 12, 2025
Request for Continued Examination
Nov 13, 2025
Response after Non-Final Action
Dec 16, 2025
Non-Final Rejection mailed — §103
Jun 16, 2026
Response Filed
Jul 29, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12721858
DOUBLE-STRANDED OLIGONUCLEOTIDE TARGETING DKK1 GENE, CONSTRUCT INCLUDING SAME, AND HAIR LOSS PREVENTION OR HAIR GROWTH COMPOSITION CONTAINING SAME
5y 1m to grant Granted Sep 01, 2026
Patent 12723247
METHODS FOR INHIBITION OF HAO1 (HYDROXYACID OXIDASE 1 (GLYCOLATE OXIDASE)) GENE EXPRESSION
4y 7m to grant Granted Sep 01, 2026
Patent 12649004
HIGHLY EFFICIENT TRANSDUCTION AND LATERAL SPREAD IN THE RETINA BY A NOVEL AAV VIRUS ENHANCED BY RATIONAL DESIGN
4y 10m to grant Granted Jun 09, 2026
Patent 12624362
MUTANT REVERSE TETRACYCLINE TRANSACTIVATORS FOR EXPRESSION OF GENES
5y 1m to grant Granted May 12, 2026
Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
5y 3m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
49%
Grant Probability
98%
With Interview (+48.3%)
4y 0m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 59 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month