Prosecution Insights
Last updated: July 05, 2026
Application No. 17/422,083

DOUBLE STRANDED RNA AND USES THEREOF

Non-Final OA §102§103§112
Filed
Jul 09, 2021
Priority
Jan 09, 2019 — PO 115253 +1 more
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Centro De Neurociencias E Biologia Celular
OA Round
1 (Non-Final)
52%
Grant Probability
Moderate
1-2
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
30 granted / 58 resolved
-8.3% vs TC avg
Strong +58% interview lift
Without
With
+58.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
41 currently pending
Career history
101
Total Applications
across all art units

Statute-Specific Performance

§101
0.4%
-39.6% vs TC avg
§103
44.4%
+4.4% vs TC avg
§102
6.6%
-33.4% vs TC avg
§112
10.8%
-29.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 58 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status Applicant’s amendments to the claims filed January 30, 2026 are acknowledged. Claims 1-30 were cancelled, and claims 31-47 were introduced. Claims 31-47 are pending and under consideration hereinafter. Priority Applicant’s priority claims to Application Nos. PT115253 and PCT/IB2020/050141 are acknowledged. Claims 31-47 find support in Application No. PT115253, and therefore, the effective filing date of the claims under examination is January 9, 2019. Drawings The drawings are objected to because of the following informalities: The view numbers are preceded by the abbreviation “Fig.” in the Drawings. 37 C.F.R. 1.84(u)(1) states that view numbers must be preceded by the abbreviation "FIG." The lines, numbers, and letters of many figures are not sufficient to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.” In the instant case, many figures contain illegible numbers and letters in the diagrams and graphs. For example, the axes of the graphs in Fig. 5, 11, and 15 contain numbers and/or letters which are of poor resolution such that the values are illegible. As another example, the diagrams of Fig. 12, and 15 contain letters which are of poor resolution, such that portions of the diagram are illegible. Appropriate correction is required. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The specification is objected to because of the following informalities: The title of the invention is not descriptive. A new title is required that is clearly indicative of the invention to which the claims are directed. The use of the terms which are trade names or marks used in commerce, has been noted in this application, e.g., NanoDrop™ 2000 (“Nanodrop 2000”, [00073]), iScript™ (“iScript”, [00074]), StepOnePlus (“StepOnePlus”, [00076]). Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. The terms, including the exemplary terms above, should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Appropriate correction is required. Claim Objections Claims 41, 43, and 46 are objected to because of the following informalities: Claims 41 and 46 recite “an SNP” which should be amended to “a SNP”. Claim 43 recites “the antisense ribonucleotide… the sense ribonucleotide has the nucleotide sequence of is SEQ ID NO: 1,” which should be amended to “the antisense ribonucleotide sequence…the sense ribonucleotide sequence has the nucleotide sequence of [[is]] SEQ ID NO: 1.” Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 31-47 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 31 recites that the “ribonucleotide complementary to the [SNP] is 10 ribonucleotides apart from the ribonucleotide at the 5’ end of the antisense RNA sequence.” The nucleotide corresponding to the “5’ end of the antisense RNA sequence” is not clear. Consider, for example, I) RNA molecules in which the antisense ribonucleotide sequence and sense ribonucleotide sequence base-paired thereto are located in internal positions of a stem-loop structure, e.g., in an shRNA, or an artificial miRNA scaffold structure shown in Fig. 16, or II) RNA molecules which are siRNAs comprising overhanging nucleotides, or asymmetric nucleotides. The skilled artisan would not know whether the “5’ end” corresponds to the 5’ most nucleotide which base-pairs to the substantially complementary sense ribonucleotide sequence, the 5’ most nucleotide which is complementary to the target mRNA, and/or whether surrounding structures (stem-loop nucleotides, overhangs, etc.) which were not part of the “designed” antisense ribonucleotide sequence, should be considered a “5’ end” if complementary to the target mRNA and/or sense ribonucleotide sequence. The sense ribonucleotide sequence need not be fully complementary to the antisense ribonucleotide sequence, which adds additional confusion as to the nucleotide which would be considered the “5’ end.” Taken together, the skilled artisan would not know which nucleotide corresponds to the “5’ end of the antisense RNA sequence” based on the structures encompassed by the claim. The skilled artisan could not reasonably determine which RNA molecules comprise a SNP-complementary nucleotide 10 ribonucleotides apart from the ribonucleotide at the 5’ end, which renders the scope of the RNA molecules encompassed by the claim unclear. Claim 32-47 are rejected for depending from claim 31 and failing to remedy the indefiniteness. Claim 35, which recites that the “antisense ribonucleotide sequence has the nucleotide sequence of SEQ ID NO. 2, 3, 4, 5, 6…” is also confusing for similar reasons. The SEQ ID NOs set forth a sequence in which the 5’ most ribonucleotide of each SEQ ID NO is 10 ribonucleotides apart from the SNP-complementary ribonucleotide ([000170]. However, given its plain meaning, this claim encompasses RNA molecules in which the antisense ribonucleotide sequence comprises (“has”) SEQ ID NO. 2, 3, 4, 5, or 6, etc., and any number of 3’ or 5’ nucleotides. It is not clear whether the skilled artisan should interpret the claim as, for example, excluding RNA molecules in which the antisense ribonucleotide sequence comprises additional nucleotides 5’ of the SEQ ID NO, or whether the skilled artisan should interpret the claim with its plain meaning, such that the “5’ end of the antisense RNA sequence” may be located in an internal position of the sequence. Claims 37 and 38 also refer to the “5’ and 3’ ends” of the antisense RNA sequence. These terms are confusing for the reasons described immediately above with respect to claim 31. The skilled artisan could not reasonably determine which ribonucleotides correspond to the 5’ end or 3’ end of the antisense ribonucleotide sequence. The skilled artisan could not reasonably determine which RNA molecules comprise 5’ and 3’ ends at least 17, or 17, 18, 19, 20, or 21 ribonucleotides apart, which renders the scope of the RNA molecules encompassed by the claims unclear. Claim Rejections - 35 USC § 102 - Davidson The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 31, 33-35, 37-39, 42, 44-45, and 47 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Davidson (Davidson et al., US 9,487,779 B2, published 8 November 2016). The RNA molecule of claim 1 is interpreted as comprising the following structural elements: “an antisense ribonucleotide sequence,” (understood to be interchangeable with the term “antisense RNA sequence), and base-paired thereto, “a substantially complementary sense ribonucleotide sequence.” The antisense ribonucleotide sequence and sense ribonucleotide sequence base-paired thereto may be located in any region of the RNA molecule, e.g., in internal positions. Each ribonucleotide of the antisense ribonucleotide sequence must be complementary to a ribonucleotide of a mutant human ataxin-3 mRNA which comprises a SNP in linkage disequilibrium with a MJD allele, e.g., “rs1048755,” or “rs12895357.” Finally, the term “substantially” is understood to mean a level of complementarity permissive for hybridization between the sense and antisense ribonucleotide sequence. In view of the indefiniteness described above, the terms “5’ end” and “3’ end” of the antisense RNA sequence are interpreted as referring to ribonucleotides 5’ of or 3’ of a reference ribonucleotide, e.g., a ribonucleotide 10 ribonucleotides 5’ of the SNP-complementary ribonucleotide, or a ribonucleotide 17 ribonucleotides 3’ of a more 5’ ribonucleotide. Regarding claim 31, Davidson teaches an RNA molecule (“siC10”) comprising an antisense ribonucleotide sequence base-paired to a substantially complementary sense ribonucleotide sequence (Fig. 6, “siC10”, “5’ CAGCAGCAGCGGGACCTATC 3’” base-paired to “5’ CTGATAGGTCCCGCTGCTGC 3’ ”). Davidson teaches the target sequence of siC10 is a SNP-containing region of mutant human ataxin-3 mRNA (“In further efforts to selectively inactivate the mutant allele the inventors took advantage of a SNP in the MJD1 gene, a G to C transition immediately 3’ to the CAG repeat (G987C)”, col. 50-51; “(B) Schematic of human ataxin-3 cDNA with bars indicating regions targeted by siRNAs”, col. 7; Fig. 5B, cDNA of target sequence “…CAGCAGCAGCAGg/cGGGACCTATCAGGAC…). Davidson teaches the target SNP (“G987C”) is in linkage disequilibrium with the MJD allele of the mutant human ataxin-3 gene (“This SNP is in linkage disequilibrium with the disease-causing expansion, in most families segregating perfectly with the disease allele”, col. 51). Figure A below illustrates that each ribonucleotide of the antisense ribonucleotide sequence is complementary to a corresponding ribonucleotide of the SNP-containing region of the mutant human ataxin-3 mRNA based on Davidson, Fig. 5. Also shown below in Fig. A, the ribonucleotide of the antisense ribonucleotide sequence that is complementary to the SNP of the mutant human ataxin-3 mRNA (bolded) is 10 ribonucleotides apart from the ribonucleotide at the 5’ end of the antisense RNA sequence, wherein the 5’ end refers to the underlined “T” in the overhang region (“To optimize differential suppression,… siRNAs were designed that place the C of the SNP at position 10 (siC10), preceded by the final three triplets in the CAG repeat”, col. 51; Fig. 5B, Fig. 6). FIGURE A. 5’ CAGCAGCAGCAGCGGGACCTATCAGGAC 3’ SNP-containing target, Fig. 5B 3’ CGTCGTCGCCCTGGATAGTC 5’ antisense siC10 5’ CAGCAGCAGCGGGACCTATC 3’ sense siC10 Regarding claim 33, as shown above, the antisense ribonucleotide sequence is at least 90% complementary to the sense ribonucleotide sequence. Regarding claim 34, as shown in Figure B below, the antisense ribonucleotide sequence is complementary to the nucleotide sequence of SEQ ID NO: 1. FIGURE B. 5’ AGCAGCAGCAGCGGGACCUAUCA 3’ SEQ ID NO: 1 3’ CGTCGTCGCCCTGGATAGTC 5’ antisense siC10 Regarding claim 35, as shown in Figure C below, the antisense ribonucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 4. FIGURE C. 5’ UGAUAGGUCCCGCUGCUGC 3’ SEQ ID NO: 4 5’ CTGATAGGTCCCGCTGCTGC 3’ antisense siC10 Regarding claims 37 and 38, as shown in Figure D below, the 5’ and 3’-ends of the antisense ribonucleotide sequence are 17 nucleotides apart, wherein the “5’ end” is interpreted as the “T” above (underlined), and the “3’ end” is interpreted as the 3’ most “C” (also underlined). FIGURE D. 5’ CTGATAGGTCCCGCTGCTGC 3’ antisense siC10 Regarding claim 39, the RNA molecule of Davidson is a single RNA molecule. Regarding claim 42, the term “therapeutically effective,” is not defined by the specification, and is interpreted as requiring that the RNA molecule selectively silence the expression of the mutant ataxin-3 allele, but not the wildtype allele. Davidson teaches the RNA molecule causes allele-specific suppression of the mutant ataxin-3 allele (col. 51, lines 30-35; Fig. 5; col. 52, lines 11-43). Regarding claim 44, Davidson teaches adeno-associated viral vectors comprising the RNA molecule operably linked to a promoter (col. 14, lines 24-55; col. 40, lines 12-16). Regarding claim 45, Davidson teaches a method for selectively silencing expression of mutant human ataxin-3 allele having a SNP in linkage disequilibrium with a MJD allele of the mutant human ataxin-3, comprising administering an adeno-associated viral vector comprising the RNA molecule (col. 43, lines 45-57; col. 47, line 30 to col. 48, line 36; col. 50, line 62 to col. 52, line 43; col. 38, line 40 to col. 43, line 40; col. 11, lines 8-54) Regarding claim 47, Davidson teaches systemic administration (col. 42, lines 16-52). Claim Rejections - 35 USC § 102 – Davidson as evidenced by Lopes Claims 41 and 46 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Davidson (Davidson et al., US 9,487,779 B2, published 8 November 2016) as applied to claims 31, 33-35, 37-39, 42, 44-45, and 47, as evidenced by Lopes (Lopes et al., June 2020, The Journal of Molecular Diagnostics, Vol. 22, No. 6, pg. 782-793). The teachings of Davidson are described above and applied as to claims 31, 33-35, 37-39, 42, 44-45, and 47 therein. Davidson does not teach that the “G987C” SNP corresponds to rs12895357. However, Lopes teaches that the SNP taught by Davidson as “G987C” is also referred to as rs12895357 (“allele-specific reduction of the mutant protein has been successfully achieved in in vitro and in vivo models of the disease using RNA interference strategies directed against a single nucleotide polymorphism (SNP) located at the 3’ end of the expanded CAG tract (C 987GG/G 987GG: rs12895357),” pg. 783, right col.). Thus, Davidson meets the limitations of instant claims 41 and 46 as evidenced by Lopes. Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – Davidson in view of Wu The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim 32 is rejected under 35 U.S.C. 103 as being unpatentable over Davidson (Davidson et al., US 9,487,779 B2, published 8 November 2016) as applied to claims 31, 33-35, 37-39, 42, 44-45, and 47, in view of Wu (Wu et al., 2011, PLoS ONE, Vol. 6, Issue 12, e28580, pg. 1-9). The teachings of Davidson are described above and applied as to claims 31, 33-35, 37-39, 42, 44-45, and 47 therein. Davidson does not teach that the base-paired sense ribonucleotide sequence is not fully complementary to the antisense ribonucleotide sequence (claim 32). However, Wu teaches that siRNA functionality can be improved if conventional siRNA is changed to have a miRNA-duplex like structure by increasing the length to 22 nt and introducing mismatches into the passenger strand of the duplex” (Abstract; pg. 1, right col.; pg. 2; Fig. 2). Wu teaches that that the passenger strand mismatches may “increase the loading efficiency and thereby improve functionality” of the siRNA (pg. 6, right col.). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have designed the sense ribonucleotide sequence of the RNA molecule of Davidson to comprise a mismatch in view of Wu. It would have amounted to applying a known design to a known RNA molecule, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing Davidson’s RNA molecule with a mismatch in the sense ribonucleotide strand because this design was known in the art, and means to prepare RNA molecules with a specific sequence were known as evidenced by Wu and Davidson. The skilled artisan would have reasonably expected the mismatch to improve the function of Davidson’s RNA molecule because Wu teaches that mismatches improve siRNA functionality. The skilled artisan would have been motivated to prepare Davidson’s RNA molecule with a mismatch in an effort to further improve the function of the molecule, e.g., for the therapeutic purposes described by Davidson. Claim Rejections - 35 USC § 103 – Davidson Claim 36 is rejected under 35 U.S.C. 103 as being unpatentable over Davidson (Davidson et al., US 9,487,779 B2, published 8 November 2016) as applied to claims 31, 33-35, 37-39, 42, 44-45, and 47. The teachings of Davidson are described above and applied as to claims 31, 33-35, 37-39, 42, 44-45, and 47 therein. Davidson does not teach that the antisense ribonucleotide sequence comprises the nucleotide sequence of SEQ ID NO: 2. However, as described above, Davidson teaches the target sequence to which the RNA molecule (“siC10”) was designed. Davidson also teaches additional RNA molecules designed to target this region (e.g., “siC7,” “siC7/8,” Fig. 6). Davidson teaches that the additional RNA molecules, like siC10, result in allele-specific silencing of the mutant ataxin-3 allele, although to differing degrees of effectivity (col. 51, lines 7-44; Fig. 5). As shown in Fig. E below, SEQ ID NO: 2 is 100% complementary to the target sequence taught by Davidson, and is shifted only 2 nucleotides relative to Davidson’s siC10. Relative to Davidson’s siC10 in which the duplexed region is 20-nts in length, SEQ ID NO: 2 has a duplexed region 22-nts in length. The other effective siRNAs of Davidson have a duplexed region 22-nts in length (“siC7,” “siC7/8,” Fig. 6). FIGURE E. 5’ CAGCAGCAGCAGCGGGACCTATCAGGAC 3’ SNP-containing target, Fig. 5B 3’ CGTCGTCGCCCTGGATAGTC 5’ antisense siC10 5’ CAGCAGCAGCGGGACCTATC 3’ sense siC10 3’ CGUCGUCGUCGCCCUGGAUAGU 5’ SEQ ID NO: 2 5’ GCAGCAGCAGCGGGACCUAUCA 3’ sense strand It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared additional RNA molecules targeting Davidson’s target region, with a duplex length of 22-nts, to arrive at an RNA molecule comprising an antisense ribonucleotide sequence comprising SEQ ID NO: 2 and a sense strand 100% complementary thereto (as shown in Fig. E above). It would have amounted to preparing additional RNA molecules to a known target sequence, by known means to yield predictable results. The skilled artisan would have recognized that RNA molecules of different sequences have different effectivities in allele-specific silencing based on Davidson. The skilled artisan would have recognized changing the target sequence of the RNA molecule as a means to find the most effective RNA molecule for allele-specific silencing. The skilled artisan could have arrived at an RNA molecule comprising SEQ ID NO: 2 because it is among the 14 possible solutions 20-nts or 22-nts in length, and 100% complementary to the target region of Davidson (i.e., where possible solutions = (28 total nucleotides – 22 nts) + (28 total nucleotides – 20 nts). The skilled artisan could have pursued these possible solutions because as evidenced by Davidson, designing RNA molecules targeting this region was well within the purview of the skilled artisan, and because the RNA molecules of Davidson are effective at silencing the mutant ataxin-3 allele, although to differing degrees. The skilled artisan would have been motivated to prepare additional RNA molecules in an effort to identify the most effective RNA molecules for the therapeutic purposes described by Davidson. Claim Rejections - 35 USC § 103 – Davidson in view of Chung Claims 40 and 43 are rejected under 35 U.S.C. 103 as being unpatentable over Davidson (Davidson et al., US 9,487,779 B2, published 8 November 2016) as applied to claims 31, 33-39, 42, 44-45, and 47, in view of Chung (Chung et al., 2006, Nucleic Acids Research, Vol. 34, No. 7, pg. 2-14). Regarding claim 37, the phrase “is a miRNA” is interpreted as encompassing RNA molecules comprising miRNA elements, e.g., a miRNA scaffold, and artificial miRNAs, etc. ([00029]-[00030]). The elements of claim 43 are, therefore, interpreted as meeting the limitations of claim 40. The teachings of Davidson are described above and applied as to claims 31, 33-39, 42, 44-45, and 47 therein. As described above, Davidson renders obvious an RNA molecule comprising an antisense ribonucleotide sequence comprising SEQ ID NO: 2 and a sense strand 100% complementary thereto (see Fig. E). Davidson does not teach that the RNA molecule comprises a miRNA scaffold derived from miR-155, wherein the antisense ribonucleotide sequence has the nucleotide sequence of SEQ ID NO: 2, and the sense ribonucleotide sequence has the nucleotide sequence of SEQ ID NO: 1. Regarding the sequence of the sense ribonucleotide sequence, as shown in Fig. F below, the sense strand of the RNA molecule rendered obvious above is missing the 5’ most nucleotide of SEQ ID NO: 1 (underlined). However, Davidson teaches that the siRNA may have a 3’ or 5’ overhang outside of the duplex region, between 1-6 nucleotides in length (col. 14, lines 31-34). FIGURE F. 3’ CGUCGUCGUCGCCCUGGAUAGU 5’ SEQ ID NO: 2 5’ GCAGCAGCAGCGGGACCUAUCA 3’ sense strand 5’ AGCAGCAGCAGCGGGACCUAUCA 3’ SEQ ID NO: 1 It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have prepared the RNA molecule rendered obvious above with a 3’ or 5’ overhang, to arrive at an RNA molecule comprising an antisense ribonucleotide sequence comprising SEQ ID NO: 2 and a sense ribonucleotide sequence comprising SEQ ID NO: 1. It would have amounted to preparing an obvious RNA molecule with a 3’ or 5’ overhang, by known means to yield predictable results. The skilled artisan would have recognized that RNA molecules of different sequences have different effectivities in allele-specific silencing based on Davidson. The skilled artisan would have recognized changing the sequence of the RNA molecule as a means to find the most effective RNA molecule for allele-specific silencing. The skilled artisan could have arrived at an RNA molecule comprising SEQ ID NO: 1 because it is among the 12 possible solutions (i.e., a 3’ overhang 1-6 nucleotides in length, or a 5’ overhang 1-6 nucleotides in length). The skilled artisan could have pursued these possible solutions because as evidenced by Davidson, designing RNA molecules targeting this region was well within the purview of the skilled artisan, and because the RNA molecules of Davidson are effective at silencing the mutant ataxin-3 allele, although to differing degrees. The skilled artisan would have been motivated to prepare additional RNA molecules in an effort to identify the most effective RNA molecule for the therapeutic purposes described by Davidson. Regarding the miR-155-derived scaffold, Davidson describes the use of plasmids and viral vectors which encode the RNA molecule in the form of an shRNA (pg. 49, lines 30-38). Chung teaches a vector (“SIBR vector”) comprising a miR-155-derived scaffold, which is used to express an RNA molecule (i.e., “siRNA”) directed against a target mRNA, and provides effective inhibition of the target mRNA in mammalian cells (pg. 2, left col.). Chung teaches that the vectors provide similar levels of target mRNA inhibition to shRNA-based vectors (pg. 10, left col.). Chung teaches that there are several advantages of the miR-155-derived scaffold vectors compared to shRNA-based vectors, e.g., the ability to include a marker protein, or multiple copies of an siRNA to enhance inhibition, siRNAs directed against two different targets, etc. (pg. 10, right col.; pg. 13, left col.). Chung teaches that the vectors comprising the miR-155-derived scaffold are functional in a variety of rodent and human cell lines, and have been effective for functional analyses in primary mouse neural progenitors and differentiating neurons (pg. 13, left col.). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have encoded the RNA molecule rendered obvious above in the form of a miR-155-derived scaffold in view of Chung. It would have amounted to preparing an obvious RNA molecule in a known miR-155-derived scaffold, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success because Chung teaches that the miR-155-derived scaffold is suitable to encode RNA molecules like Davidson’s, vectors comprising the miR-155-derived scaffold encoded RNA molecules provide similar levels of target mRNA inhibition to shRNA-based vectors, and are functional in a variety of human and rodent cell types, including neurons, which are used by Davidson. The skilled artisan would have been motivated to encode the RNA molecule rendered obvious above in the form of a miR-155-derived scaffold because Chung teaches several advantages relative to shRNA-based vectors used by Davidson, which would be useful for further evaluating the therapeutic potential of siRNA for mutant ataxin-3 allele-specific silencing. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Jul 09, 2021
Application Filed
Jan 30, 2026
Response after Non-Final Action
Apr 01, 2026
Non-Final Rejection mailed — §102, §103, §112
Jun 19, 2026
Interview Requested
Jun 30, 2026
Examiner Interview Summary
Jun 30, 2026
Applicant Interview (Telephonic)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12668800
METHODS AND COMPOSITIONS FOR TARGETED TRANS-SPLICING
1y 7m to grant Granted Jun 30, 2026
Patent 12655424
METHODS AND COMPOSITIONS FOR TRANS-SPLICING UTILIZING SMALL NUCLEAR RNAS AND SMALL NUCLEOLAR RNAS
1y 7m to grant Granted Jun 16, 2026
Patent 12644148
IN VITRO DETECTION OF NUCLEIC ACID
5y 3m to grant Granted Jun 02, 2026
Patent 12606835
AUTO-INDUCTION REGULATORY SYSTEM BASED ON QUORUM SENSING AND APPLICATION THEREOF
3y 9m to grant Granted Apr 21, 2026
Patent 12595484
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 5m to grant Granted Apr 07, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+58.4%)
3y 6m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 58 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month