DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment/Status of Claims
Receipt of Arguments/Remarks filed on 05/27/2026 is acknowledged. Claims 53 and 160-163 were amended. Claims 53,54,72,148-153,155,156 and 160-163 are pending and under examination.
Maintained Rejections
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 53,54,72,148-153,155,156 and 160-163 are rejected under 35 U.S.C. 103 as being unpatentable over Memorial (WO 2017180989), Published 19 October 2017, cited on an IDS in view of Jacquemin et al. (JCI Insight, Published 20 Dec 2018; 3(24), pages 1-12), Diem Vu et al. (Blood, 1 Oct 2007, Vol 110, No 7 pages 2501-2510) and Meissner et al. (US 20190309259), Published 10 Oct. 2019.
Claim Interpretation: TNFRSF4 is also known as OX40 (see instant specification paragraph 00126). Regarding the functional limitation in claim 53, “wherein the reduced expression and/or function of the one or more endogenous genes enhances and immunosuppressive function of the Treg”, and the functional limitations recited in claims 151-153, the function would necessarily be carried out as a result of the structure of the gene regulating system comprising a gRNA/Cas9 with a gRNA of SEQ ID NO: 3. Therefore, art that teaches the same structure as the gRNA of instant SEQ ID NO: 3 would perform the same functions recited in instant claims 53 and 151-153.
Regarding claims 53,148 and 151-153, Memorial teaches T cells derived from a human (paragraphs 0030, 0050, 00143, 00642), including immunoinhibitory T cells (paragraph 0060), specifically, a modified regulatory T cell (Treg) (paragraphs 00186, 00193) comprising a homologous recombination system suitable for targeted integration of the transgene (paragraph 00564), and that methods can be used to disrupt the expression of an endogenous gene (paragraph 00192). Memorial teaches wherein the gene-regulating system comprises an enzymatic protein and a nucleic acid molecule, which is a gRNA (paragraph 00673), or Cas9/gRNA (paragraph 00682).
Memorial does not teach a Treg comprising an endogenous gene comprising TNFRSF4, or reducing the expression and/or function of an endogenous target gene comprising TNFRSF4 (OX40).
Before the effective filing date, Diem Vu et al. taught OX40 is a T cell co-stimulatory molecule belonging to the TNF/TNFR superfamily, and that OX40 can be expressed by both activated T effector cells and Foxp3+ Tregs (Abstract, Intro, page 2501). Diem Vu et al. taught that stimulating OX40 on Foxp3+ Tregs abrogated their ability to suppress T effector cell proliferation, IFN-gamma production and T effector cell-mediated allograft rejection, and also profoundly inhibited Foxp3 gene expression (Abstract) and their data suggest that OX40 costimulation to the Foxp3+ Tregs results in the loss of their suppressor functions (page 2505). Diem Vu et al. taught OX40 as a key negative regulator of Foxp3+ Tregs and may have important clinical implications in models of transplantation and autoimmunity (Abstract).
Diem Vu et al. taught, “Here, we have demonstrated that OX40 is highly expressed on both natural and induced Foxp3+ Tregs. Importantly, in contrast to its costimulatory role to T effector cells, OX40 is rather a potent negative regulator of Foxp3+ Tregs. Clearly, stimulation of OX40 on CD4+Foxp3+ Tregs using either an agonist anti-OX40 mAb or OX40Ltg APCs consistently abolished their suppressor activities in vitro. Furthermore, stimulation of OX40 on the Foxp3+ Tregs also abrogated the effect of Foxp3+ Tregs in suppressing T effector cell-mediated skin allograft rejection in vivo. The loss of suppressor functions triggered by OX40 stimulation is not due to the altered proliferation of Foxp3+ Tregs or to the death of Foxp3+ Tregs, but appears to be associated with the inhibition of Foxp3 gene expression. Moreover, we showed for the first time that OX40 signaling has marked inhibitory effects on the induction of new inducible Foxp3+ Tregs from activated effector T cells. In our studies, conversion of Foxp3 T effector cells to Foxp3+ Tregs is consistently prevented by OX40 costimulation to T effector cells. These new findings strongly suggest that the overall effects of OX40 on the T-cell response are likely mediated not only by costimulating T effector cells but also by suppressing the Foxp3+ Tregs. Our data also suggest that OX40 likely controls a critical checkpoint where antigen-specific Tregs in the periphery are induced. Clearly, the clinical implication of our finding is likely to be significant. For example, in transplant models in which antigen-specific Tregs are required for tolerance induction, OX40 costimulation is likely to be antagonistic to the acquisition of tolerance, and blocking OX40 costimulation may be critically important in the establishment of donor specific tolerance” (page 2508, left column). Diem et al. taught blocking OX40 signaling may be required for suppressing autoimmunity and restoring self-tolerance (page 2509, left column).
Therefore, Diem Vu et al. taught the effects of OX40 stimulation on Tregs as resulting in the loss of their suppressor functions and that OX40 is a potent negative regulator of Foxp3+ Tregs and suggests that blocking OX40 signaling may be required to suppress autoimmunity and restore self-tolerance. Therefore, one skilled in the art would recognize that when the opposite effect is desired, i.e. not lose suppressor function, then reduction of OX40 expression would be desired. Since suppressor function is important for suppressing autoimmunity and restoring self-tolerance, this provides the motivation to one skilled in the art to reduce the expression and/or activity of OX40 to achieve this desired effect.
Additionally, Jacquemin et al. taught that systemic lupus erythematosus (SLE) is an autoimmune disease and the need to better understand human SLE pathogenesis, as only a few drugs are effective (Introduction, page 1). Jacquemin et al. taught Foxp3+ Tregs are important for maintenance of immunological tolerance (Introduction, page 1). Jacquemin et al. taught that OX40L was expressed by myeloid antigen-presenting cells both in blood and in inflamed tissues of adult and pediatric SLE patients and the frequency of circulating OX40L-expressing myeloid APCs correlated with disease activity as well as the frequency of activated blood follicular helper T cells, and also that OX40L has been shown to block Treg functions both in mice and humans, and therefore led to investigating the role of the OX40L/OX40 axis on the functions of Treg cells in human SLE (page 2, first paragraph).
Jacquemin et al. taught that soluble OX40L strongly downregulated Treg-related genes, including Foxp3 and the IKZF2-encoding Helios gene, which suggests that the OX40L/OX40 axis not only promotes Tfh cell differentiation of Th cells but can also affect the generation and/or function of the Treg compartment. Jacquemin et al. taught that sOX40L decreased Treg-mediated suppression of Eff.T4 cell proliferation without inducing Treg cell death and also found the process was OX40L dependent, as Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, and that these results demonstrate that both sOX40L and membrane-bound OX40L block the suppressive function of purified allogeneic FoxP3+ Tregs in vitro (Results, page 2). Jacquemin et al. taught monitoring OX40L and OX40 expression in SLE patients and that SLE patients had higher serum concentration of sOX40L than that in HDs, a positive correlation between sOX40L blood concentration and SLE Disease Activity Index (SLEDAI) was observed in SLE patients (Supplemental Figure 3B), and circulating Tregs from SLE patients had a higher expression of OX40 than those from HDs (Results, page 2). Jacquemin et al. taught, “Altogether, our observations identify the OX40L/OX40 axis as an important enhancing inflammatory loop in SLE patients, as it can promote the differentiation of naive and memory T cells into follicular T lymphocytes while blocking the suppressive function of Tregs and Tfr cells. Therefore, blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus”.
Therefore, Jacquemin et al. taught the effects that OX40L has been shown to block Treg functions both in mice and humans and that Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, and therefore blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus. Therefore, one skilled in the art would recognize in order to restore Treg-suppressive function, then blocking OX40/OX40L interaction or reducing OX40 expression/activity would be desired.
Diem Vu et al. and Jacquemin et al. do not teach using a guide RNA and Cas protein or ortholog gene regulating system to reduce the expression and/or function of the endogenous TNFRSF4.
Meissner et al. taught guide targeting of OX40 in 293T cells (Figure 26G) as well as exemplary gRNA sequences useful for targeting OX40 (paragraph 0107). Meissner et al. taught targets can be modified and/or deleted in universal T cells to improve their function and/or tailor them to a specific therapeutic approach, and that genes encoding for co-stimulatory molecules/receptors that engage cytotoxic T cells can be deleted by genome editing which prevent autoimmunity, including the OX40 receptor on T cells (paragraphs 00327-00329, Table 3). Meissner et al. also taught genes involved in regulatory T cell (Treg) function can be deleted by genome editing, including FoxP3 and Helios (Paragraph 0361). Meissner et al. taught modifying or cleaving target polynucleotide sequences in a cell such that the expression or activity of the encoded product is reduced or eliminated, using CRISPR/Cas systems (paragraph 0182). Meissner et al. taught stem cells comprising a genome in which the OX40 gene has been edited to modify a contiguous stretch of genomic DNA, by contacting the cell with a Cas protein or a nucleic acid encoding the Cas protein, and at least one ribonucleic acid selected from the group consisting of SEQ ID NOs: 231886-234210 (paragraph 00329). SEQ ID NO: 232742 of Meissner et al. has 100% identity to the gRNA of instant SEQ ID NO: 3 that targets TNFRSF4 (OX40). See alignment below:
SEQ ID NO: 3 1 GGATGTGCGTGGGGGCTCGG 20
SEQ ID NO: 232742 1 GGATGTGCGTGGGGGCTCGG 20
Regarding claims 54,149 and 155 Memorial teaches a T cell wherein a recombinant nucleic acid sequence encoding a chimeric antigen receptor (CAR) is integrated at a first site within the genome of the cell such that the CAR is expressed by the cell at the cell surface, and which reduces or prevents expression of a function T cell receptor complex at the surface of the cell (paragraph 00138). Memorial teaches a CAR comprising an extracellular antigen-binding domain fused to a transmembrane domain which is fused to an intracellular domain of the T cell receptor chain (paragraph 00260). Memorial teaches a CAR can have a co-stimulatory domain comprising an intracellular domain of OX40 (tumor necrosis factor receptor superfamily member 4 precursor or CD134) (paragraph 00277).
Regarding claims 72 and 160-163, Memorial recites a pharmaceutical composition comprising a therapeutically effective amount of a T cell and a pharmaceutically acceptable carrier (claim 8).
Regarding claims 150 and 156, Memorial teaches the T cell comprises a transgene encoding a TCR (paragraphs 00257,00527,00528).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the human Treg taught by Memorial with the gene-regulating system of Meissner et al. comprising a guide RNA of SEQ ID NO: 232742 and a Cas protein, wherein the gRNA of SEQ ID NO: 232742 targets OX40 (TNFRSF4) based on the teachings of Diem Vu et al. and Jacquemin et al. with a reasonable expectation of success. There would be a reasonable expectation of success because Memorial suggests disrupting the expression of an endogenous gene in human T cells (paragraph 00192) and includes Tregs, and using a gene regulating system which is a gRNA or Cas9/gRNA in T cells, and because this would amount to combining prior art elements according to known methods to yield predictable results.
One of ordinary skill in the art would have known that OX40 is expressed by Foxp3+ Tregs based on the teachings of Diem Vu et al. and the relationship between stimulating OX40 and the loss of Treg suppressor functions (stimulating OX40 on Foxp3+ Tregs abrogated their ability to suppress T effector cell proliferation, IFN-gamma production and T effector cell-mediated allograft rejection, and also profoundly inhibited Foxp3 gene expression and that OX40 costimulation to the Foxp3+ Tregs results in the loss of their suppressor functions) and therefore that OX40 is a key negative regulator of Foxp3+ Tregs. Therefore, Diem Vu et al. taught the effects of OX40 stimulation on Tregs as resulting in the loss of their suppressor functions and that OX40 is a potent negative regulator of Foxp3+ Tregs and suggests that blocking OX40 signaling may be required to suppress autoimmunity and restore self-tolerance. Therefore, one skilled in the art would recognize that when the opposite effect is desired, i.e. not lose suppressor function, then reduction of OX40 expression would be desired. Since suppressor function is important for suppressing autoimmunity and restoring self-tolerance, this provides the motivation to one skilled in the art to reduce the expression and/or activity of OX40 to achieve this desired effect.
One of ordinary skill in the art would understand based on reading Jacquemin et al. that Foxp3+ Tregs are important for maintenance of immunological tolerance and that OX40L was expressed by myeloid antigen-presenting cells both in blood and in inflamed tissues of adult and pediatric SLE patients and the frequency of circulating OX40L-expressing myeloid APCs correlated with disease activity as well as the frequency of activated blood follicular helper T cells. Jacquemin et al. taught OX40L has been shown to block Treg functions both in mice and humans (page 2, first paragraph), and that soluble OX40L strongly downregulated Treg-related genes, including Foxp3 and the IKZF2-encoding Helios gene, and Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, which demonstrate that both sOX40L and membrane-bound OX40L block the suppressive function of purified allogeneic FoxP3+ Tregs in vitro (Results, page 2). In addition, circulating Tregs from SLE patients had a higher expression of OX40 than those from HDs and Jacquemin et al. taught that blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus. Therefore, Jacquemin et al. taught the effects that OX40L has been shown to block Treg functions both in mice and humans and that Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, and therefore blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus. Therefore, one skilled in the art would recognize in order to restore Treg-suppressive function, then blocking OX40/OX40L interaction or reducing OX40 expression/activity would be desired.
Therefore, both Diem Vu et al. and Jacquemin et al. provide a link between OX40 in human Treg cells and an ordinary artisan would look to these teachings and be motivated to block or reduce OX40 signaling as taught by Diem Vu et al. in order to suppress autoimmunity and restore self-tolerance or block the OX40L/OX40 axis as a target in lupus as taught by Jacquemin et al., and which results in enhancing the immunosuppressive function of the Treg.
One of ordinary skill in the art would know of different ways to reduce the expression and/or function of endogenous target genes based on the teaching of Memorial of using gRNA (paragraph 00673), or Cas9/gRNA and therefore would have been motivated to use the teachings of Meissner regarding the specifically taught gRNA sequence targeting OX40. An ordinary artisan could simply pick from the list of gRNA sequences targeting OX40 taught by Meissner et al., and there would be a reasonable expectation of success that the gRNA and Cas protein would result in reducing the expression and/or function of TNFRSF4 (OX40), and would enhance an immunosuppressive function of the Treg, including increased expression or secretion of an immunosuppressive cytokine which is IL-10, or increased co-expression of Foxp3 and Helios. The structure of the gRNA of SEQ ID NO: 232742 is the same to the gRNA of instant SEQ ID NO: 3. The gRNA of Meissner et al. having the same structure to that of instant SEQ ID NO:3 would necessarily perform the recited functions as a result of the structure. There would be a reasonable expectation of success because Meissner teach CRISPR/Cas system based modifying or cleaving of target polynucleotide sequences in a cell such that expression or activity of the encoded product is reduced or eliminated (paragraph 0182).
Accordingly, the limitations of claims 53,54,72,148-153,155,156 and 160-163 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Response to Arguments
Applicant's arguments filed 05/27/2026 have been fully considered but they are not persuasive.
Applicant states on page 3 that Memorial and Meissner have been discussed in detail in Applicant’s previous responses and the Office Action acknowledges that these references do not indicate a need to improve an immunosuppressive function of Tregs and do not indicate how editing Tregs might achieve this and do not discuss any function of OX40 in Tregs at all. Applicant argues that Diem Vu and Jacquemin fail to remedy these deficiencies because neither provides any indication that reducing OX40 expression or function in human Tregs using a gene-regulatory system would enhance their immunosuppressive function. Applicant argues on pages 3-4 that Diem Vu relates generally to studies in a murine “knockin” model designed to examine the role of Tregs and T effector cells in mice (page 2502, left column), and that stimulation of OX40 on CD4+Foxp3+ Tregs using either an agonist anti-OX40 mAb or OX40Ltg APCs consistently abolished their suppressor activities in vitro. Applicant argues this observation relates to the effect of stimulating OX40, not reducing its expression or function. Applicant cites Diem Vu from page 2504, right column and Fig. 2C that when murine wild-type and OX40 -/- Tregs were compared, both were found to suppress the proliferation of effector T cells and their suppressive activities were “comparable”. According to Diem Vu, this data suggests “that OX40 is unlikely to be critical in the suppressor function of natural FoxP3+ Tregs” (page 2504, right column) and that OX40 was dispensable for suppressor functions of naturally arising CD4+Foxp3+ Tregs (Abstract). Applicant argues that one would not have expected that reducing OX40 expression or function in human Tregs using a gene-regulating system giving the “comparable” suppressive activities in murine wild-type and OX40-/- Tregs would enhance their immunosuppressive activity. Applicant argues regarding page 13 of the Office Action that Diem Vu examined the effect of knocking out OX40 on murine Tregs and reported that suppressive activity of those Tregs was not increased- it was comparable to that of wild-type murine Tregs (page 2504 of Diem Vu), and based on this data, it is simply not plausible to argue that one skilled in the art would have a reasonable expectation that reducing the expression or function of OX40 using a gene-regulating system would enhance the immunosuppressive activity of human Tregs.
This is not found persuasive. The claims are very broad and are directed to a product. No specific sequences of the gRNA molecule are recited, and all that is required is an isolated, modified human Treg comprising a gene regulating system comprising a gRNA molecule and a Cas protein or ortholog thereof, and that the gene regulating system is capable of reducing the expression and/or function of one or more endogenous genes which is TNFRSF4. The reduction of expression and/or function of TNFRSF4 would result from the gene regulating system comprising a gRNA molecule and Cas protein or ortholog in the recited cell (See Claim Interpretation). No limiting definition has been provided for “reducing the expression” or “enhancing an immunosuppressive function of the Treg”, and therefore the claims encompass reducing the expression and/or function of TNFRSF4 to any degree as well as that the immunosuppressive function of the Treg is enhanced to any degree.
Regarding Applicant’s arguments pertaining to page 2504 of Diem Vu that murine wild-type and OX40 -/- Tregs were compared and both were found to suppress the proliferation of effector T cells and their suppressive activities were “comparable”, as the claims encompass any degree of enhancing immunosuppressive function, this does not necessarily teach away from the claims. It is also noted that the Office Action cited other parts of Diem Vu (pages 2505,2508 and 2509 of Diem Vu on pages 8-9 of the non-final action dated 01/27/2026) regarding OX40 stimulation in Tregs and the effects thereof and provided reasonings on why one of ordinary skill in the art would not want those effects, then reducing expression or activity of OX40 would be one way that one of ordinary skill in the art could reasonably expect to achieve the desired results. Page 2505, left column of Diem Vu states that “However, it remains possible that OX40 on natural Foxp3+ Tregs may be capable of modifying their suppressor activities”….and that “Collectively, these data suggest that OX40 costimulation to the Foxp3+ Tregs results in the loss of their suppressor functions”, and “Blocking OX40 signaling may be required for suppressing autoimmunity and restoring self-tolerance (page 2509, left column), cited in the office action. While Diem Vu pertains to stimulation of OX40 rather than reducing the expression of OX40 as argued by Applicant, Diem Vu was provided for the motivation of the effects of stimulating OX40 (loss of suppressor function) and therefore when the opposite effect is desired (increased suppressor function) one would not look to stimulate OX40 but to other ways of blocking OX40 or reducing its expression or activity as known in the art (the teachings of Meissner regarding the specifically taught gRNA sequence targeting OX40).
Applicant argues on page 5 of response that Jacquemin’s approach involves blocking the OX40L ligand to prevent OX40 signaling and concludes that blocking the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus, but that blocking this receptor-ligand interaction is mechanistically distinct from reducing OX40 expression and/or function using gene-regulatory systems in Tregs, and Jacquemin does not provide any guidance regarding using a gene-regulatory system to reduce OX40, let alone any indication that doing so would enhance human Treg immunosuppressive function rather than simply prevent OX40L-mediated inhibition. Jacquemin explains that Tregs are impaired in SLE, and it is unclear whether observations of Tregs from patients with active SLE would be applicable to Tregs generally (unimpaired Tregs). Jacquemin points out that OX40 agonist administration influenced experimental autoimmune encephalomyelitis disease severity in opposite directions, depending on the timing of administration (page 8). Applicant argues given the effects of OX40 agonists differed based on timing even within the same disease, a person of ordinary skill in the art would have no way of predicting how reduction of OX40 using a gene-regulating system (which is not tested in Jacquemin or any of the other references) would affect the immunosuppressive function of unimpaired, non-SLE human Tregs.
This is not found persuasive. While blocking OX40L/OX40 interaction may be mechanistically distinct from reducing OX40 expression, Jacquemin was provided for the relationship between OX40L and OX40 in Treg cells in human SLE and that circulating Tregs from SLE patients had higher expression of OX40 than those from healthy donors. One of ordinary skill in the art would know of different ways to reduce the expression and/or function of endogenous target genes based on the teaching of Memorial of using gRNA (paragraph 00673), or Cas9/gRNA and therefore would have been motivated to use the teachings of Meissner regarding the specifically taught gRNA sequence targeting OX40. There would be a reasonable expectation of success that the gRNA and Cas protein would result in reducing the expression and/or function of TNFRSF4 (OX40), and would enhance an immunosuppressive function of the Treg (See Claim Interpretation). It is also noted that obviousness does not require absolute predictability, however, at least some degree of predictability is required. Evidence showing there was no reasonable expectation of success may support a conclusion of nonobviousness. NOTE: MPEP 2143.02.
Regarding Applicant’s argument pertaining to Jacquemin that it is unclear whether observations of Tregs from patients with active SLE would be applicable to Tregs generally (unimpaired Tregs) and that OX40 agonist administration influenced experimental autoimmune encephalomyelitis disease severity in opposite directions, depending on the timing of administration (page 8), the claims do not require an unimpaired, non-SLE Treg, only an isolated, modified human Treg comprising the recited gene-regulating system. In addition, as stated above, absolute predictability is not required, only a reasonable expectation of success, and Applicant may provide evidence showing there is no reasonable expectation of success or unexpected results.
For these reasons, the 103 rejection stands.
Conclusion
Claims 53,54,72,148-153,155,156 and 160-163 are rejected.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/STEPHANIE L SULLIVAN/Examiner, Art Unit 1635
/ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Prosecution Insights