Prosecution Insights
Last updated: April 19, 2026
Application No. 17/426,059

GENE-REGULATING COMPOSITIONS AND METHODS FOR IMPROVED IMMUNOTHERAPY

Non-Final OA §103
Filed
Jul 27, 2021
Examiner
SULLIVAN, STEPHANIE LAUREN
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Ksq Therapeutics Inc.
OA Round
3 (Non-Final)
62%
Grant Probability
Moderate
3-4
OA Rounds
3y 6m
To Grant
98%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allow Rate
38 granted / 61 resolved
+2.3% vs TC avg
Strong +36% interview lift
Without
With
+35.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
58 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
5.7%
-34.3% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
30.8%
-9.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 61 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 10/23/2025 has been entered. Response to Amendment/Status of Claims Receipt of Arguments/Remarks filed on 10/23/2025 is acknowledged. Claims 154 and 157-159 were cancelled. Claims 53 and 160-163 were amended. Claims 53,54,72,148-153,155,156 and 160-163 are pending. The following rejections and/or objections are either reiterated or newly applied. They constitute the complete set presently being applied to the instant application. Response to Arguments Upon further consideration and in response to Applicant’s arguments (see pages 1-9, filed 10/23/2025), the 35 U.S.C. 103 rejection of claims 53,54,72 and 148-163 as unpatentable over Memorial in view of Meissner is withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of a case of obviousness, providing additional references (Jacquemin et al. and Diem et al.) to support the motivation and reasonable expectation of success for combining Memorial and Meissner. Newly cited references, Jacquemin et al. and Diem et al., show why one would want to combine Memorial and Meissner and why there would be a reasonable expectation of success because stimulating OX40 has the opposite desired effect specifically teach why one would want to block OX40 signaling to suppress autoimmunity. Applicant argues on pages 6-7 that as acknowledged by the examiner, Memorial does not teach reducing the expression and/or function of an endogenous target gene comprising TNFRSF4 and actually teaches that the therapeutic transgene that is expressed in Memorial’s T cells can have a domain of OX40 and therefore does not say anything about reducing the expression or function of TNFRSF4 and only discusses introducing and expressing a domain of OX40 in T cells. The examiner agrees with these statements, but would like to note that Memorial was used to teach the Treg cell, and that Memorial taught disrupting the expression of an endogenous gene (paragraph 00192), and taught using a gene-regulating system which is a gRNA (paragraph 00673), or Cas9/gRNA (paragraph 00682). The examiner then relied upon Meissner which taught using gRNAs in cells, including guide RNAs that specifically targets TNFRSF4 (OX40). Applicant argues on pages 7-8 that Meissner does not discuss deleting OX40 in Tregs or provide any reason to do so, and that Meissner’s teaching to delete OX40 to prevent interaction of “universal” cells with cytotoxic T cell would not provide an ordinary artisan with a reason to delete OX40 in Tregs because Memorial teaches that cytotoxic T cells and Tregs have opposite effects on the immune system. Applicant argues that neither Memorial nor Meissner acknowledge a problem associated with patient’s immune systems rejecting cell therapies and purports to solve this problem by deleting MHC-I/MHC-II and molecules that engage cytotoxic T cells in “universal” therapeutic cells, and do not identify any other problem that could be addressed by reducing OX40 in Tregs. Applicant argues Memorial and Meissner do not indicate the need to improve an immunosuppressive function of Tregs, or how editing Tregs might achieve this. Applicant argues on page 10 that neither references discuss any function of OX40 in Treg at all. This is found persuasive, and therefore additional references are being added to the rejection to support the function of OX40 in Tregs and the motivation of why one would want to reduce the expression or function of TNFRS4 (OX40) in Tregs. Applicant argues on page 10 that there is no reasonable expectation of success in achieving the claimed cells, and that neither Memorial nor Meissner provide information about what function OX40 has in Tregs and could not have a reasonable expectation of success that the gRNA of Meissner would have on Tregs. Applicant argues on page 11 that the Office’s introduction of the journal article Ward-Kavanagh et al. into the response, only further emphasizes that one would not know what to expect from reducing OX40 in Tregs because Ward-Kavanagh teaches “expression of OX40 in regulatory T cells…can expand or suppress and deplete this population depending on the environment”, and therefore shows it would be difficult to product the effect of reducing OX40 in Tregs. Applicant also argues that Ward-Kavanagh teaches in a mouse model of prostate cancer, OX40 stimulation can break tolerance of anergized T cells, and one would avoid deleting OX40 in Tregs to achieve the desired effect of breaking tolerance. Ward-Kavanagh also states expression of OX40 is different in mouse Tregs and human Tregs, and therefore the effect of reducing OX40 in human Tregs could not have been predicted. This is found persuasive, regarding that neither Memorial nor Meissner provide information about what function OX40 has in Tregs and could not have a reasonable expectation of success that the gRNA of Meissner would have on Tregs and that Ward-Kavanagh et al. supports the lack of predictability of the effect of reducing OX40 in Tregs. Therefore, the additional references added to the new rejection provide support for the function of OX40 in Tregs and the motivation of why one would want to reduce the expression or function of TNFRS4 (OX40) in Tregs, and the predictability thereof. . Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 53,54,72,148-153,155,156 and 160-163 are rejected under 35 U.S.C. 103 as being unpatentable over Memorial (WO 2017180989), Published 19 October 2017, cited on an IDS, Jacquemin et al. (JCI Insight, Published 20 Dec 2018; 3(24), pages 1-12), Diem et al. (Blood, 1 Oct 2007, Vol 110, No 7 pages 2501-2510) and Meissner et al. (US 20190309259), Published 10 Oct. 2019. Claim Interpretation: TNFRSF4 is also known as OX40 (see instant specification paragraph 00126). Regarding the functional limitation in claim 53 “wherein the reduced expression and/or function of the one or more endogenous genes enhances and immunosuppressive function of the Treg”, and the functional limitations recited in claims 151-153, the function would necessarily be carried out as a result of the structure of the gene regulating system comprising a gRNA/Cas9 with a gRNA of SEQ ID NO: 3. Therefore, art that teaches the same structure as the gRNA of instant SEQ ID NO: 3 would perform the same functions recited in instant claims 53 and 151-153. Regarding claims 53,148 and 151-153, Memorial teaches T cells derived from a human (paragraphs 0030, 0050, 00143, 00642), including immunoinhibitory T cells (paragraph 0060), specifically, a modified regulatory T cell (Treg) (paragraphs 00186, 00193) comprising a homologous recombination system suitable for targeted integration of the transgene (paragraph 00564), and that methods can be used to disrupt the expression of an endogenous gene (paragraph 00192). Memorial teaches wherein the gene-regulating system comprises an enzymatic protein and a nucleic acid molecule, which is a gRNA (paragraph 00673), or Cas9/gRNA (paragraph 00682). Memorial does not teach a Treg comprising an endogenous gene comprising TNFRSF4, or reducing the expression and/or function of an endogenous target gene comprising TNFRSF4 (OX40). Before the effective filing date, Diem et al. taught OX40 is a T cell co-stimulatory molecule belonging to the TNF/TNFR superfamily, and that OX40 can be expressed by both activated T effector cells and Foxp3+ Tregs (Abstract, Intro, page 2501). Diem et al. taught that stimulating OX40 on Foxp3+ Tregs abrogated their ability to suppress T effector cell proliferation, IFN-gamma production and T effector cell-mediated allograft rejection, and also profoundly inhibited Foxp3 gene expression (Abstract) and their data suggest that OX40 costimulation to the Foxp3+ Tregs results in the loss of their suppressor functions (page 2505). Diem et al. taught OX40 as a key negative regulator of Foxp3+ Tregs and may have important clinical implications in models of transplantation and autoimmunity (Abstract). Diem et al. taught, “Here, we have demonstrated that OX40 is highly expressed on both natural and induced Foxp3+ Tregs. Importantly, in contrast to its costimulatory role to T effector cells, OX40 is rather a potent negative regulator of Foxp3+ Tregs. Clearly, stimulation of OX40 on CD4+Foxp3+ Tregs using either an agonist anti-OX40 mAb or OX40Ltg APCs consistently abolished their suppressor activities in vitro. Furthermore, stimulation of OX40 on the Foxp3+ Tregs also abrogated the effect of Foxp3+ Tregs in suppressing T effector cell-mediated skin allograft rejection in vivo. The loss of suppressor functions triggered by OX40 stimulation is not due to the altered proliferation of Foxp3+ Tregs or to the death of Foxp3+ Tregs, but appears to be associated with the inhibition of Foxp3 gene expression. Moreover, we showed for the first time that OX40 signaling has marked inhibitory effects on the induction of new inducible Foxp3+ Tregs from activated effector T cells. In our studies, conversion of Foxp3 T effector cells to Foxp3+ Tregs is consistently prevented by OX40 costimulation to T effector cells. These new findings strongly suggest that the overall effects of OX40 on the T-cell response are likely mediated not only by costimulating T effector cells but also by suppressing the Foxp3+ Tregs. Our data also suggest that OX40 likely controls a critical checkpoint where antigen-specific Tregs in the periphery are induced. Clearly, the clinical implication of our finding is likely to be significant. For example, in transplant models in which antigen-specific Tregs are required for tolerance induction, OX40 costimulation is likely to be antagonistic to the acquisition of tolerance, and blocking OX40 costimulation may be critically important in the establishment of donor specific tolerance” (page 2508, left column). Diem et al. taught blocking OX40 signaling may be required for suppressing autoimmunity and restoring self-tolerance (page 2509, left column). Therefore, Diem et al. taught the effects of OX40 stimulation on Tregs as resulting in the loss of their suppressor functions and that OX40 is a potent negative regulator of Foxp3+ Tregs and suggests that blocking OX40 signaling may be required to suppress autoimmunity and restore self-tolerance. Therefore, one skilled in the art would recognize that when the opposite effect is desired, i.e. not lose suppressor function, then reduction of OX40 expression would be desired. Since suppressor function is important for suppressing autoimmunity and restoring self-tolerance, this provides the motivation to one skilled in the art to reduce the expression and/or activity of OX40 to achieve this desired effect. Additionally, Jacquemin et al. taught that systemic lupus erythematosus (SLE) is an autoimmune disease and the need to better understand human SLE pathogenesis, as only a few drugs are effective (Introduction, page 1). Jacquemin et al. taught Foxp3+ Tregs are important for maintenance of immunological tolerance (Introduction, page 1). Jacquemin et al. taught that OX40L was expressed by myeloid antigen-presenting cells both in blood and in inflamed tissues of adult and pediatric SLE patients and the frequency of circulating OX40L-expressing myeloid APCs correlated with disease activity as well as the frequency of activated blood follicular helper T cells, and also that OX40L has been shown to block Treg functions both in mice and humans, and therefore led to investigating the role of the OX40L/OX40 axis on the functions of Treg cells in human SLE (page 2, first paragraph). Jacquemin et al. taught that soluble OX40L strongly downregulated Treg-related genes, including Foxp3 and the IKZF2-encoding Helios gene, which suggests that the OX40L/OX40 axis not only promotes Tfh cell differentiation of Th cells but can also affect the generation and/or function of the Treg compartment. Jacquemin et al. taught that sOX40L decreased Treg-mediated suppression of Eff.T4 cell proliferation without inducing Treg cell death and also found the process was OX40L dependent, as Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, and that these results demonstrate that both sOX40L and membrane-bound OX40L block the suppressive function of purified allogeneic FoxP3+ Tregs in vitro (Results, page 2). Jacquemin et al. taught monitoring OX40L and OX40 expression in SLE patients and that SLE patients had higher serum concentration of sOX40L than that in HDs, a positive correlation between sOX40L blood concentration and SLE Disease Activity Index (SLEDAI) was observed in SLE patients (Supplemental Figure 3B), and circulating Tregs from SLE patients had a higher expression of OX40 than those from HDs (Results, page 2). Jacquemin et al. taught, “Altogether, our observations identify the OX40L/OX40 axis as an important enhancing inflammatory loop in SLE patients, as it can promote the differentiation of naive and memory T cells into follicular T lymphocytes while blocking the suppressive function of Tregs and Tfr cells. Therefore, blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus”. Therefore, Jacquemin et al. taught the effects that OX40L has been shown to block Treg functions both in mice and humans and that Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, and therefore blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus. Therefore, one skilled in the art would recognize in order to restore Treg-suppressive function, then blocking OX40/OX40L interaction or reducing OX40 expression/activity would be desired. Diem et al. and Jacquemin et al. do not teach using a guide RNA and Cas protein or ortholog gene regulating system to reduce the expression and/or function of the endogenous TNFRSF4. Meissner et al. taught guide targeting of OX40 in 293T cells (Figure 26G) as well as exemplary gRNA sequences useful for targeting OX40 (paragraph 0107). Meissner et al. taught targets can be modified and/or deleted in universal T cells to improve their function and/or tailor them to a specific therapeutic approach, and that genes encoding for co-stimulatory molecules/receptors that engage cytotoxic T cells can be deleted by genome editing which prevent autoimmunity, including the OX40 receptor on T cells (paragraphs 00327-00329, Table 3). Meissner et al. also taught genes involved in regulatory T cell (Treg) function can be deleted by genome editing, including FoxP3 and Helios (Paragraph 0361). Meissner et al. taught modifying or cleaving target polynucleotide sequences in a cell such that the expression or activity of the encoded product is reduced or eliminated, using CRISPR/Cas systems (paragraph 0182). Meissner et al. taught stem cells comprising a genome in which the OX40 gene has been edited to modify a contiguous stretch of genomic DNA, by contacting the cell with a Cas protein or a nucleic acid encoding the Cas protein, and at least one ribonucleic acid selected from the group consisting of SEQ ID NOs: 231886-234210 (paragraph 00329). SEQ ID NO: 232742 of Meissner et al. has 100% identity to the gRNA of instant SEQ ID NO: 3 that targets TNFRSF4 (OX40). See alignment below: SEQ ID NO: 3 1 GGATGTGCGTGGGGGCTCGG 20 SEQ ID NO: 232742 1 GGATGTGCGTGGGGGCTCGG 20 Regarding claims 54,149 and 155 Memorial teaches a T cell wherein a recombinant nucleic acid sequence encoding a chimeric antigen receptor (CAR) is integrated at a first site within the genome of the cell such that the CAR is expressed by the cell at the cell surface, and which reduces or prevents expression of a function T cell receptor complex at the surface of the cell (paragraph 00138). Memorial teaches a CAR comprising an extracellular antigen-binding domain fused to a transmembrane domain which is fused to an intracellular domain of the T cell receptor chain (paragraph 00260). Memorial teaches a CAR can have a co-stimulatory domain comprising an intracellular domain of OX40 (tumor necrosis factor receptor superfamily member 4 precursor or CD134) (paragraph 00277). Regarding claims 72 and 160-163, Memorial recites a pharmaceutical composition comprising a therapeutically effective amount of a T cell and a pharmaceutically acceptable carrier (claim 8). Regarding claims 150 and 156, Memorial teaches the T cell comprises a transgene encoding a TCR (paragraphs 00257,00527,00528). Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the human Treg taught by Memorial with the gene-regulating system of Meissner et al. comprising a guide RNA of SEQ ID NO: 232742 and a Cas protein, wherein the gRNA of SEQ ID NO: 232742 targets OX40 (TNFRSF4) based on the teachings of Diem et al. and Jacquemin et al. with a reasonable expectation of success. There would be a reasonable expectation of success because Memorial suggests disrupting the expression of an endogenous gene in human T cells (paragraph 00192) and includes Tregs, and using a gene regulating system which is a gRNA or Cas9/gRNA in T cells, and because this would amount to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would have known that OX40 is expressed by Foxp3+ Tregs based on the teachings of Diem et al. and the relationship between stimulating OX40 and the loss of Treg suppressor functions (stimulating OX40 on Foxp3+ Tregs abrogated their ability to suppress T effector cell proliferation, IFN-gamma production and T effector cell-mediated allograft rejection, and also profoundly inhibited Foxp3 gene expression and that OX40 costimulation to the Foxp3+ Tregs results in the loss of their suppressor functions) and therefore that OX40 is a key negative regulator of Foxp3+ Tregs. Therefore, Diem et al. taught the effects of OX40 stimulation on Tregs as resulting in the loss of their suppressor functions and that OX40 is a potent negative regulator of Foxp3+ Tregs and suggests that blocking OX40 signaling may be required to suppress autoimmunity and restore self-tolerance. Therefore, one skilled in the art would recognize that when the opposite effect is desired, i.e. not lose suppressor function, then reduction of OX40 expression would be desired. Since suppressor function is important for suppressing autoimmunity and restoring self-tolerance, this provides the motivation to one skilled in the art to reduce the expression and/or activity of OX40 to achieve this desired effect. One of ordinary skill in the art would understand based on reading Jacquemin et al. that Foxp3+ Tregs are important for maintenance of immunological tolerance and that OX40L was expressed by myeloid antigen-presenting cells both in blood and in inflamed tissues of adult and pediatric SLE patients and the frequency of circulating OX40L-expressing myeloid APCs correlated with disease activity as well as the frequency of activated blood follicular helper T cells. Jacquemin et al. taught OX40L has been shown to block Treg functions both in mice and humans (page 2, first paragraph), and that soluble OX40L strongly downregulated Treg-related genes, including Foxp3 and the IKZF2-encoding Helios gene, and Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, which demonstrate that both sOX40L and membrane-bound OX40L block the suppressive function of purified allogeneic FoxP3+ Tregs in vitro (Results, page 2). In addition, circulating Tregs from SLE patients had a higher expression of OX40 than those from HDs and Jacquemin et al. taught that blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus. Therefore, Jacquemin et al. taught the effects that OX40L has been shown to block Treg functions both in mice and humans and that Treg-suppressive function was restored when SLE DCs were preincubated with a blocking anti-OX40L mAb, and therefore blocking of the OX40L/OX40 axis should be considered as a new target option for future clinical trials in lupus. Therefore, one skilled in the art would recognize in order to restore Treg-suppressive function, then blocking OX40/OX40L interaction or reducing OX40 expression/activity would be desired. Therefore, both Diem et al. and Jacquemin et al. provide a link between OX40 in human Treg cells and an ordinary artisan would look to these teachings and be motivated to block or reduce OX40 signaling as taught by Diem et al. in order to suppress autoimmunity and restore self-tolerance or block the OX40L/OX40 axis as a target in lupus as taught by Jacquemin et al., and which results in enhancing the immunosuppressive function of the Treg. One of ordinary skill in the art would know of different ways to reduce the expression and/or function of endogenous target genes based on the teaching of Memorial of using gRNA (paragraph 00673), or Cas9/gRNA and therefore would have been motivated to use the teachings of Meissner regarding the specifically taught gRNA sequence targeting OX40. An ordinary artisan could simply pick from the list of gRNA sequences targeting OX40 taught by Meissner et al., and there would be a reasonable expectation of success that the gRNA and Cas protein would result in reducing the expression and/or function of TNFRSF4 (OX40), and would enhance an immunosuppressive function of the Treg, including increased expression or secretion of an immunosuppressive cytokine which is IL-10, or increased co-expression of Foxp3 and Helios. The structure of the gRNA of SEQ ID NO: 232742 is the same to the gRNA of instant SEQ ID NO: 3. The gRNA of Meissner et al. having the same structure to that of instant SEQ ID NO:3 would necessarily perform the recited functions as a result of the structure. There would be a reasonable expectation of success because Meissner teach CRISPR/Cas system based modifying or cleaving of target polynucleotide sequences in a cell such that expression or activity of the encoded product is reduced or eliminated (paragraph 0182). Accordingly, the limitations of claims 53,54,72,148-153,155,156 and 160-163 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date. Conclusion Claims 53,54,72,148-153,155,156 and 160-163 are rejected. Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is (703)756-4671. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached at 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /STEPHANIE L SULLIVAN/Examiner, Art Unit 1635 /ABIGAIL VANHORN/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jul 27, 2021
Application Filed
Feb 20, 2025
Non-Final Rejection — §103
May 22, 2025
Response Filed
Jul 21, 2025
Final Rejection — §103
Oct 23, 2025
Request for Continued Examination
Oct 24, 2025
Response after Non-Final Action
Jan 23, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12565648
MICRORNA-MEDIATED METHODS FOR REJUVENATING CNS GLIAL POPULATIONS
2y 5m to grant Granted Mar 03, 2026
Patent 12534727
NOVEL TARGET TO TREAT A METABOLIC DISEASE IN AN INDIVIDUAL
2y 5m to grant Granted Jan 27, 2026
Patent 12522830
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Jan 13, 2026
Patent 12522826
THERAPEUTICS FOR THE TREATMENT OF NEURODEGENERATIVE DISORDERS
2y 5m to grant Granted Jan 13, 2026
Patent 12496347
NUCLEIC ACID, COMPOSITION AND CONJUGATE CONTAINING NUCLEIC ACID, PREPARATION METHOD THEREFOR AND USE THEREOF
2y 5m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
62%
Grant Probability
98%
With Interview (+35.7%)
3y 6m
Median Time to Grant
High
PTA Risk
Based on 61 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month