Prosecution Insights
Last updated: April 19, 2026
Application No. 17/426,511

OLIGONUCLEOTIDE COMPOSITIONS AND METHODS THEREOF

Non-Final OA §103§112
Filed
Jul 28, 2021
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Wave Life Sciences Ltd.
OA Round
2 (Non-Final)
43%
Grant Probability
Moderate
2-3
OA Rounds
4y 2m
To Grant
98%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
19 granted / 44 resolved
-16.8% vs TC avg
Strong +54% interview lift
Without
With
+54.4%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
55 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
6.5%
-33.5% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.3%
-4.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's amendments and remarks filed on December 23, 2025 are acknowledged. Claims 1-7, 12-19, and 22 have been canceled. Claims 11, 24, 26, 28-30, 32, 34, and 37 were amended. Claims 8-11, 20, 21, and 23-40 are pending. Claims 20, 21, 39, and 40 are withdrawn. Claims 8-11 and 23-38 are examined on the merits herein. This action is NON-FINAL due to new grounds of rejection not necessitated by amendment. Withdrawn Objections In view of Applicant’s amendments and response, the objection to the specification is withdrawn. Withdrawn Rejections In view of Applicant’s amendments and response, the 35 U.S.C 112(b) and 35 U.S.C 103 rejections are withdrawn. Priority This application claims priority to PCT/US20/15971 filed on January 30, 2020 which claims priority to U.S. provisional application 62/911,335, filed on October 6, 2019 and U.S. provisional application 62/800,409, filed on February 1, 2019. Information Disclosure Statement The information disclosure statement (IDS) submitted on December 23, 2025 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Specification The substitute specification filed on December 23, 2025 has been entered. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 11, 23, 24, 25, 26, and 27 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 11 recites the oligonucleotide of claim 8 wherein the oligonucleotide is at least 20% diastereomerically pure. Claims 23 through 27 are reproduced below: PNG media_image1.png 464 636 media_image1.png Greyscale Claims 9 and 10 depend on claim 8 and claim 8 recites the following: PNG media_image2.png 306 638 media_image2.png Greyscale Therefore, claims 11, 23, 24, 25, 26, and 27 do not further limit the claim which it depends on because claims 11, 23, 24, 25, 26, and 27 do not incorporate all the stereochemistry requirements of claim 8. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 8-11 and 23-38 are rejected under 35 U.S.C. 103 as being unpatentable over Aronin et al. (US 8,987,222) in view of Østergaard et al. (Nucleic Acids Research 2013; reference cited by Applicant), Butler et al. (WO 2017/062862; reference cited by Applicant), and Stetsenko et al. (US 2017/0362270). Regarding claims 8-11 and 23-38, Aronin et al. teaches RNAi against SNPs associated with Huntington’s disease optimally combined with select additional SNP targeting silencing agents [abstract]. Aronin et al. teaches SEQ ID NO: 223 (designated as Db) which is 21 nucleotides in length and has a match to instant SEQ ID NO: 1255 (designated as Qy) as shown in the alignment below. SEQ ID NO: 223 is a siRNA guide strand [Table 6]. Aronin et al. also teaches modifications such as a 2’ modification (e.g., provision of a 2’ OMe moiety on a U in a sense or antisense strand) and modification of the backbone (e.g., provision of a phosphorothioate modification) [column 35, last paragraph]. Further, the RNA silencing agents can be incorporated into pharmaceutical compositions comprising the nucleic acid molecule and a pharmaceutically acceptable carrier [column 41, third full paragraph]. Qy 1 GUUGATCTGTAGCAGCAGCT 20 |||||:|:|:|||||||||: Db 1 GUUGAUCUGUAGCAGCAGCU 20 However, Aronin et al. does not teach the gapmer structure of instant SEQ ID NO: 1255, the 2’-MOE modification, the 5-methyl 2’-O-methoxyethyl C modification, the Rp and Sp configurations of the phosphorothioate linkages, and the “n001R” modification. Aronin et al. also does not teach the diastereomeric purity of the oligonucleotide. Aronin et al. also does not teach a pharmaceutically acceptable salt or a sodium salt. Østergaard et al. teaches the rational design of antisense oligonucleotides targeting single nucleotide polymorphisms for potent and allele selective suppression of mutant Huntingtin in the CNS [title]. Østergaard et al. teaches that gapmer ASOs targeting SNPs associated with expanded CAG repeats resulted in ~5-fold selectivity for reducing muHTT compared with wtHTT in HD patient-derived fibroblasts, cultured primary neurons and in murine BACHD brain. One of the ASOs targeted SNP rs7685686_A located within intron 42 of the HTT gene and was a fully phosphorothioate modified 15mer oligonucleotide with a 9-base deoxynucleotide gap flanked on each end with 2’-O-methoxyethyl (MOE) and 2’,4’-constrained-[S]-2’-O-ethyl (S-cEt) modified nucleotides. The ASO is perfectly matched to muHTT while it has a single G:T mismatch to wtHTT positioned at the center of the oligonucleotide. Therefore, the 5-fold selectivity observed was surprising considering that the GT wobble base pair is only slightly less stabilizing as compared with the AT cognate base pair [page 9638, left column, last paragraph bridging to right column]. Butler et al. teaches that properties such as activity, toxicity, distribution, and pharmacokinetics of an oligonucleotide can be adjusted by optimizing its pattern of backbone chiral centers in combination with adjustment/optimization of chemical modifications, patterns of modifications such as linkage pattern and nucleoside modification pattern. Further, Butler et al. demonstrated that modifications of sugars, bases, and/or internucleotidic linkages are combined with stereochemistry patterns to provide oligonucleotides and compositions with enhanced properties such as low toxicity and better protein binding [0013]. Butler et al. teaches that purity of a chirally controlled oligonucleotide composition can be controlled by stereoselectivity of each coupling step in its preparation process and teaches a new internucleotidic linkage formed may have stereoselectivity of at least 90% up to virtually 100% [00463], and the provided chirally controlled (and/or stereochemically pure) preparations are of a stereochemical purity of greater than 90% and up to greater than 99% [00475]. Butler et al. also teaches that the chirally controlled oligonucleotides and chirally controlled oligonucleotide compositions are of high crude purity and of high diastereomeric purity [00619]. Further, oligonucleotides in the chirally controlled oligonucleotide composition comprise modified bases such as 5-mC and modified sugars such as 2’-MOE or 2’-OR1 wherein R1 is a substituted C1-6 aliphatic [001201] which further enhance activity, stability, and/or selectivity of the composition. Butler et al. also teaches that the term “pharmaceutically acceptable salt” refers to salts of compounds that are appropriate for use in pharmaceutical contexts. Further, representative alkali or alkaline earth metal salts include sodium [00182]. Stetsenko et al. teaches PNG media_image3.png 184 174 media_image3.png Greyscale which is the instant modification designated as “n001R” [0062]. Stetsenko et al. also teaches that substituting charge neutral or positively charged groups for natural anionic phosphate can improve cellular uptake [0021-0022]. Stetsenko et al. also teaches that phosphates and modified phosphates may be chiral and recognizes that stereochemistry encompasses both Rp and Sp configurations [0120]. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the siRNA of Aronin et al. to a gapmer with 2’-MOE modifications, 5-methyl 2’-O-methoxyethyl C modification, imidazolidine-2-imine internucleotide modification, and Rp and Sp configurations of the phosphorothioate linkages with a reasonable expectation of success. One of ordinary skill in the art would have been motivated to modify the siRNA to a gapmer because Østergaard et al. taught that gapmer ASOs targeting SNPs associated with expanded CAG repeats resulted in 5-fold selectivity for reducing muHTT compared with wtHTT. One of ordinary skill in the art would arrive at the specific patterns of modifications recited in the instant claims because it would have amounted to applying a known chemical modification design strategy to a gapmer by known means to yield predictable results. Butler et al. taught that a chirally controlled oligonucleotide comprising modified bases enhances activity, stability, and selectivity, and properties such as activity, toxicity, distribution, and pharmacokinetics of an oligonucleotide can be adjusted by optimizing its pattern of backbone chiral centers in combination with adjustment/optimization of chemical modifications, patterns of modifications such as linkage pattern and nucleoside modification pattern. In addition, Stetsenko et al. taught that a imidazolidine-2-imine internucleotide modification can improve cellular uptake. Based on the teachings of Butler et al. and Stetsenko et al., it was well-within the purview of the skilled artisan to design modified oligonucleotides comprising the recited modifications to enhance the activity, stability, and/or selectivity of the oligonucleotide and improve cellular uptake. Accordingly, the skilled artisan would have had a reasonable expectation of success in applying the design strategies of Butler et al. and Stetsenko et al. to the gapmer of Aronin et al. and Østergaard et al. It would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to modify the gapmer of Aronin et al. and Østergaard et al. to have a diastereomeric purity of at least 50% or with each phosphorothioate internucleotidic linkage independently having a diastereomeric purity of at least 95% with a reasonable expectation of success because it would have amounted to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do so because Butler et al. taught that structural elements including stereochemistry can have significant impact on oligonucleotide properties, e.g., activities, toxicities, and teaches controlled backbone stereochemistry patterns, provide unexpected properties, including but not limited to certain activities, toxicities, etc. [0003], that the purity of a chirally controlled oligonucleotide composition can be controlled by the stereoselectivity of each coupling step in its preparation process. Response to Arguments Applicant's arguments filed December 23, 2025 have been fully considered but they are not persuasive. Applicant asserts that Aronin et al. SEQ ID NO: 223 is a siRNA guide strand and as such utilizes RNA nucleosides and derivatives thereof. Applicant further asserts that the oligonucleotide recited in the present claim comprises a stretch of 10 consecutive DNA sugars and 50% of total sugars including multiple deoxythymidine. This argument is found persuasive. Therefore, a new grounds of rejection has been made and presented in this Office action. Applicant asserts the following: PNG media_image4.png 454 808 media_image4.png Greyscale PNG media_image5.png 450 794 media_image5.png Greyscale These arguments are not found persuasive. The Aronin et al. reference does not teach the gapmer structure of instant SEQ ID NO: 1255, the 2’-MOE modification, the 5-methyl 2’-O-methoxyethyl C modification, the Rp and Sp configurations of the phosphorothioate linkages, and the “n001R” modification. Aronin et al. also does not teach the diastereomeric purity of the oligonucleotide or a pharmaceutically acceptable salt or a sodium salt. Therefore, Østergaard et al. (reference newly presented in this Office action to render obvious the gapmer structure of instant SEQ ID NO: 1255), Butler et al., and Stetsenko et al. are used in combination with Aronin et al. to render obvious the limitations of claim 8. Contrary to Applicant’s assertions that Stetsenko et al. did not teach n001R, Stetsenko et al. teaches the following structure in paragraph [0062] PNG media_image3.png 184 174 media_image3.png Greyscale which reads on the instantly claimed modification designated as “n001R”. Stetsenko et al. also teaches that substituting charge neutral or positively charged groups for natural anionic phosphate can improve cellular uptake [0021-0022]. Furthermore, Stetsenko et al. teaches that phosphates and modified phosphates may be chiral and recognizes that stereochemistry encompasses both Rp and Sp configurations [0120]. Contrary to Applicant’s assertions that no motivation was provided to select the specific types of sugars, nucleobases, internucleotidic linkages, and linkage phosphorous stereochemistry, Butler et al. taught that oligonucleotides in the chirally controlled oligonucleotide composition comprising modified bases such as 5-mC and modified sugars such as 2’-MOE enhances the activity, stability, and/or selectivity of the composition. Butler et al. also taught that properties such as activity, toxicity, distribution, and pharmacokinetics of an oligonucleotide can be adjusted by optimizing its pattern of backbone chiral centers in combination with adjustment/optimization of chemical modifications, patterns of modifications such as linkage pattern and nucleoside modification pattern. Further, Butler et al. demonstrated that modifications of sugars, bases, and/or internucleotidic linkages are combined with stereochemistry patterns to provide oligonucleotides and compositions with enhanced properties such as low toxicity and better protein binding. Therefore, based on the teachings of Butler et al. and Stetsenko et al., it was well-within the purview of the skilled artisan to design modified oligonucleotides comprising the recited modifications to enhance the activity, stability, and/or selectivity of the oligonucleotide and improve cellular uptake. Accordingly, the skilled artisan would have had a reasonable expectation of success in applying the design strategies of Butler et al. and Stetsenko et al. to the gapmer of Aronin et al. and Østergaard et al. Applicant asserts the following: PNG media_image6.png 340 796 media_image6.png Greyscale PNG media_image7.png 472 804 media_image7.png Greyscale These arguments are not found persuasive. As evidenced by Østergaard et al., it is expected that gapmer ASOs targeting SNPs result in ~5-fold selectivity for reducing muHTT compared with wtHTT in Huntington’s disease (HD) and therefore it is not surprising that there is high efficiency and selectivity for reducing expression of mutant HTT as Applicant asserts. In addition, it is unclear from Applicant’s press release on June 25, 2024 that the “WVE-003” antisense oligonucleotide referred to in the press release is the oligonucleotide recited in the present claims. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Jul 28, 2021
Application Filed
Aug 24, 2025
Non-Final Rejection — §103, §112
Dec 23, 2025
Response Filed
Mar 06, 2026
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

2-3
Expected OA Rounds
43%
Grant Probability
98%
With Interview (+54.4%)
4y 2m
Median Time to Grant
Moderate
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month