Prosecution Insights
Last updated: April 19, 2026
Application No. 17/428,322

COMPOSITIONS FOR SUPPRESSING TRIM28 AND USES THEREOF

Non-Final OA §103§112
Filed
Aug 04, 2021
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Memorial Sloan Kettering Cancer Center
OA Round
2 (Non-Final)
52%
Grant Probability
Moderate
2-3
OA Rounds
2y 12m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
25 granted / 48 resolved
-7.9% vs TC avg
Strong +73% interview lift
Without
With
+73.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 12m
Avg Prosecution
47 currently pending
Career history
95
Total Applications
across all art units

Statute-Specific Performance

§101
8.0%
-32.0% vs TC avg
§103
27.9%
-12.1% vs TC avg
§102
14.9%
-25.1% vs TC avg
§112
30.0%
-10.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 48 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status Applicant’s remarks, and amendments to the claims, drawings, and specification filed August 25, 2025 are acknowledged. Claims 1-2, 5, 7, and 12 were amended. Claims 1-20 are pending. Restriction/Election Claims 15-20 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Claims 1-14 are under examination hereinafter. Withdrawn Rejections Applicant’s remarks and amendments to the claims have been thoroughly reviewed. The amendments are sufficient to overcome the § 112(b) rejections raised in the prior action. The amendments also overcome the § 112(a) Written Description and Enablement rejections raised in the prior action. Examiner agrees with Applicant that the instantly claimed genus of Trim28-specific inhibitory nucleic acids is sufficiently described based on the guidance in the specification and art. Examiner also agrees with Applicant that the instant claims, which are limited to “treating” AML and limit the structure of the Trim28-specific inhibitory nucleic acid to an shRNA or sgRNA, are enabled based on the guidance in the specification and prior art. The aforementioned rejections have been withdrawn. Applicant’s remarks and amendments have been thoroughly considered, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment. Drawings The drawings are objected to because of the following informalities: The view numbers for the partial views of Figs. 4, 6, and 8 are followed by "(cont.)" instead of a capital letter such as FIG. 1A, FIG. 1B, etc. 37 CFR 1.84 (u)(1) states “Partial views intended to form one complete view, on one or several sheets, must be identified by the same number followed by a capital letter.” Appropriate correction is required. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Priority Applicant's claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows: The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994). The disclosure of the prior-filed provisional application, Application No. 62/802,520, filed February 7, 2019, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for claims 6-8, and 12-14 of this application. The first disclosure of the subject matter of claims 6-8, and 12-14 is in Application No. PCT/US20/17049. Thus, the effective filing date of claims 6-8, and 12-14 is February 6, 2020. The remaining claims under examination (i.e., claims 1-5, and 9-11) find support in Application No. 62/802,520, and therefore, have an effective filing date of February 7, 2019. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The rejections that follow are new and necessitated by Applicant’s amendments to the claims. Claim 1 recites “wherein the at least one Trim28-specific inhibitory nucleic acid is a shRNA or sgRNA… wherein the at least one Trim28-specific inhibitory nucleic acid is about 20-22 nucleotides in length” (emphasis added). The term “shRNA” is interpreted as a “short hairpin RNA,” which the skilled artisan would understand is a nucleic acid sequence comprising a double-stranded region (typically between 19-25 base pairs in length) comprising a sequence complementary to a target sequence, wherein the complementary sequences of the double-stranded region are linked by a loop (typically between 3-9 nucleotides in length)([0070]). The skilled artisan would understand that while an shRNA comprises a target complementary sequence which would fall within the recited range, the overall length of a typical shRNA is between 41-59 nucleotides. It is not clear how the Trim28-specific inhibitory nucleic acid “is an shRNA” that “is about 20-22 nucleotides in length,” given the understanding of the term in the art, or whether the range is intended to refer only to the target complementary sequence or double-stranded region of the shRNA. The term “sgRNA” is interpreted as a “synthetic guide RNA,” which the specification provides consists of two parts – a crRNA segment complementary to the target sequence and tracrRNA segment – wherein the two parts may be on two separate RNAs, or a single RNA ([0071]). The skilled artisan would know that CRISPR/Cas systems are diverse, requiring different crRNAs and tracrRNAs of various sequences and lengths. Generally, however, crRNAs are between 17-24 nucleotides in length, and tracrRNAs are between 50-150 nucleotides in length. The skilled artisan would understand that a single RNA form would comprise a crRNA segment which would fall within the recited range, but the overall length of a typical single RNA form (crRNA segment + tracrRNA segment) would be far greater than the recited range. Thus, it is not clear whether the claim is attempting to exclude single RNA forms using the recited range, or whether the recited range is intended to refer to the crRNA segment of a single RNA form sgRNA. In the case of two separate RNAs, it is also not clear whether the recited range is only referring to the crRNA segment, such that the tracrRNA would not be considered the “at least one Trim28-specific inhibitory nucleic acid,” and is not limited by the recited range. Taken together, the scope of Trim28-specific inhibitory nucleic acids encompassed by the claim is unclear because of structural incompatibilities and/or various structural interpretations imposed by the range “is about 20-22 nucleotides in length,” on the terms “shRNA” and “sgRNA” as they would be interpreted by one of ordinary skill. Claims 2-14 are rejected for depending from claim 1 and failing to remedy the indefiniteness. In the interest of compact prosecution, the range will be interpreted as limiting the target complementary sequence, rather than the overall length, of the shRNA or sgRNA. Claim 1 recites “wherein the at least one Trim28-specific inhibitory nucleic acid is about 20-22 nucleotides in length.” The term “about” is a relative term. The specification provides that “the term “about” in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction… of the number unless otherwise stated or otherwise evident from the context” ([0033]). This description does not sufficiently clarify the metes and bounds of the range “about 20-22 nucleotides in length.” For example, given the context (i.e., an inhibitory nucleic acid which is an shRNA or sgRNA), the skilled artisan would envision target complementary sequences between 16-25 nucleotides in length. However, this range would not be encompassed by ± 1%, 5%, or 10% relative to the numbers in the range, and would only be encompassed by that which is “otherwise evident from the context.” It is not clear based on the specification or claim whether the skilled artisan should interpret the range as ± 1%, 5%, or 10% relative to the numbers in the range, or alternatively, some other percentage which is “otherwise evident from the context.” Accordingly, the lengths encompassed by the claim are unclear. Claims 2-14 are rejected for depending from claim 1 and failing to remedy the indefiniteness. In the interest of compact prosecution, the range will be interpreted as 20-22 nucleotides in length. Response to Remarks - 35 USC § 112(b) Applicant’s remarks regarding the § 112(b) rejections raised in the prior action have been reviewed. The remarks are moot, because the previous rejections have been withdrawn and the substance of the remarks does not pertain to the new rejections described above, which are necessitated by Applicant’s amendments to the claims. Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – Kharas, Becker, Tzelepis, and Ivanov The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1-2, and 4-14 are rejected under 35 U.S.C. 103 as being unpatentable over Kharas (Kharas et al., WO 2018/165482 A1, published 13 September 2018; of record) in view of Becker (Becker, 2018, "Epigenetic and Gene Expression Changes Mediated by Histone H3 Methylation in Acute Myeloid Leukemia"; of record), Tzelepis (Tzelepis et al., 18 October 2016, Cell Reports, Vol. 17, No. 4, pg. 1193-1205 and Supplemental Table S4; of record), and Ivanov (Ivanov and Addison, published 14 July 2016, US 2016/0200829 A1; of record) as evidenced by GenBank NM_005762.3 (Homo sapiens tripartite motif containing 28 (TRIM28), mRNA NCBI Reference Sequence: NM_005762.3, available 22 November 2018; of record). The rejection of claims 1-2, and 5-14 are maintained and modified as necessitated by Applicant’s amendments to the claims. The rejection of claim 4 is new, and necessitated by inadvertent omission from the prior rejection (see paragraph 42 of the prior action, which inadvertently indicates the subject matter of claim 5 as corresponding to claim 4). Regarding claim 1, Kharas teaches a method of treating acute myeloid leukemia (AML) in a subject in need thereof, comprising administering to the subject a therapeutically effective amount of at least one SYNCRIP-specific inhibitory nucleic acid that inhibits SYNCRIP activity in the subject (claim 1, pg. 65). Kharas teaches that SYNCRIP is required for survival of leukemia cells, and that deletion or depletion of SYNCRIP impairs growth and promotes apoptosis of leukemia cells ([00311]; Examples 3-5). Kharas does not teach or suggest treating AML by administering a Trim28-specific inhibitory nucleic acid that inhibits Trim28 activity in the subject, wherein the inhibitory nucleic acid is a shRNA or sgRNA, wherein the target complementary sequence is 20-22 nucleotides in length, and wherein the inhibitory nucleic acid has 100% complementarity to a coding region of a Trim28 nucleic acid sequence. Becker teaches that AML is a highly malignant blood cancer, associated with recurrent fusions and driver mutations that are “directly related to epigenetic regulation and chromatin higher order structure, suggesting broad genetic and epigenetic disruption in the pathogenesis of AML” (pg. 3). Becker identifies genomic domains in acute myeloid leukemia (AML) samples with differential H3K9me2 (pg. 2; pg. 18-22). Compared to CD34+ cells or granulocytes, Becker reports that genomic domains depleted of H3K9me2 in AML samples were associated with "clusters of repeated genes, including many ZNF (zinc finger or KRAB-ZNF ... ) genes, a large family of repressive transcriptional regulators" (pg. 20-21). Becker identified Trim28 (KAP1) as the primary co-repressor for the KRAB-ZNF genes therein (pg. 21, Fig. 5). In a separate set of experiments, Becker identified Trim28 as the top upstream transcriptional regulator of differentially epigenetically regulated genes in cells treated with an inhibitor of the histone methyltransferase, G9a (pg. 23, pg. 51, Fig. 6B). Becker strongly suggests that these "G9a-independent" H3K9me2 domains may instead be regulated by Trim28 interactions with the histone methyltransferase SETDB1 (pg. 51), which has been implicated in AML (pg. 52). Finally, Becker teaches that verification and evaluation of the G9a-independent H3K9me2 domains is "essential to understanding their role in leukemogenesis" (pg. 52). Tzelepis identified Trim28 as a “druggable” “AML-specific” target in a CRISPR screen designed to identify “AML-cell-line-specific essential genes” (Fig. 3; Table S4; pg. 1197, right col.). Tzelepis validated genes identified in the screen using CRISPR/Cas9 knockout and pharmacological inhibitors (Fig. 4; Fig. S5), and demonstrates that there is “concordance between the results of [the] screening and validation experiments (pg. 1197, left col.). Thus, the skilled artisan would reasonably predict concordance between the results of the screen for Trim28 and its use as a druggable target in AML cells. Tzelepis teaches that AML is an aggressive cancer with poor prognosis, for which new therapies are urgently needed (Tzelepis, pg. 1193 and Abstract). Based on Becker and Tzelepis, the skilled artisan would have a reasonable expectation of success that targeting Trim28 with a Trim28-specific inhibitory nucleic acid would result in treating AML in a subject as claimed. However, neither Becker or Tzelepis teach a Trim28-specific inhibitory nucleic acid, wherein the inhibitory nucleic acid is a shRNA or sgRNA, wherein the target complementary sequence is 20-22 nucleotides in length, and wherein the inhibitory nucleic acid has 100% complementarity to a coding region of a Trim28 nucleic acid sequence. Ivanov teaches Trim28-specific inhibitory nucleic acids, which are shRNAs comprising a target complementary sequence 20-22 nucleotides in length (see Supplementary MateriaIs, [0116], which provides the sequences of three shRNAs targeting "TRIM28/KAP1"). Ivanov demonstrates that the shRNAs decrease the expression of Trim28 (“KAP1”) in vitro ([0093]; Fig. 4, 7G-H, S10) and produce therapeutic effects in an orthotopic xenograft mouse model in vivo ([0100]; Fig. 7A; S13). As evidenced by an alignment between GenBank NM_005762.3 and the shRNA sequences disclosed by Ivanov, Ivanov’s shRNAs have 100% complementarity to a coding region of a Trim28 nucleic acid sequence. See attached alignment in Appendix II and GenBank entry (of record), which illustrate that each shRNA aligns with 100% complementarity to nucleotides corresponding to a Trim28 exon. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the inhibitory nucleic acid in the method of treating AML taught by Kharas, for a Trim28-specific inhibitory nucleic acid taught by Ivanov in light of Becker and Tzelepis. It would have amounted to a simple substitution of one inhibitory nucleic acid targeting a gene essential for AML cells, for another inhibitory nucleic acid targeting a different gene identified as being essential for AML cells. The skilled artisan would have had a reasonable expectation of success that substituting the nucleic acid of Kharas, for the inhibitory nucleic acid of Ivanov would inhibit, relieve, or slow progression of one or more symptoms of AML because I) Ivanov teaches that the nucleic acid successfully inhibits Trim28 activity in vitro and in vivo, II) Becker identifies Trim28 as a top regulator of genes within genomic domains associated with differential epigenetic regulation in AML samples, and teaches that Trim28 works with a protein previously implicated in AML to regulate histone methylation, and III) Tzelepis identified Trim28 as a “druggable” “AML-specific” target in a CRISPR screen which demonstrates high concordance for identified genes and their practical use in AML cells. The skilled artisan would have been motivated to substitute the inhibitory nucleic acids because I) Tzelepis teaches that AML is an aggressive cancer with poor prognosis, for which new therapies are urgently needed, and II) Becker teaches it is essential to understand the role of Trim28-associated H3K9me2 domains in leukemogenesis. Thus, providing a subject with an validated, inhibitory nucleic acid specific to Trim28 would allow the skilled artisan to pursue new therapies for AML, and determine the role of Trim28 in leukemogenesis. Regarding claim 2, based on an alignment with GenBank NM_005762.3, Ivanov’s shKAP1-2 (“TTCAAGCAATTCAACAAGTTA”) aligns with nucleotides 2999-3019 of the human Trim28 mRNA (see Appendix I, of record). The amino acid sequences of the Trim28 regions recited in the claim are provided in [0060] of the specification. The amino acid sequence corresponding to the region targeted by the shRNA of Ivanov is FKQFNKL (see the ORF Finder results in Appendix I, of record), which corresponds to the bromodomain. Thus, as evidenced by GenBank, Ivanov’s Trim28-specific inhibitory nucleic acid is inherently complementary to a sequence encoding one of the recited Trim28 protein domains. Regarding claim 4, the phrase “wherein the subject displays elevated expression levels of Trim28 protein in leukemic cells prior to treatment” is interpreted as encompassing methods which decrease Trim28 protein levels in a subject’s leukemic cells relative to the levels prior to treatment. Ivanov demonstrates that the shRNAs decrease the expression of Trim28 (“KAP1”) in vitro ([0093]; Fig. 4, 7G-H, S10) and produce therapeutic effects in an orthotopic xenograft mouse model in vivo ([0100]; Fig. 7A; S13). Based on Ivanov’s success in decreasing Trim28 protein levels following administration of shRNA, the method rendered obvious above is understood to achieve the recited outcome during its normal operation. See MPEP 2112.02(I). Regarding claims 5-6, Kharas teaches the subject has been diagnosed as having AML (claim 6, pg. 65). Kharas teaches diagnosed subjects having one or more signs or symptoms of AML, including enlarged lymph nodes and anemia ([00204]). Regarding claim 7, Kharas teaches the subject harbors one or more point mutations in NRAS (claim 8, pg. 65). Regarding claim 8, Kharas teaches the subject harbors a CBFB-MYH11 gene fusion (claim 9, pg. 66). Regarding claim 9, Kharas teaches the subject is human (claim 10, pg. 66). Regarding claim 10, Kharas teaches the inhibitory nucleic acid is administered orally (claim 11, pg. 66). Regarding claim 11, Kharas teaches the method further comprises administering one or more additional agents to the subject separately, sequentially, or simultaneously (claim 12, pg. 66). Regarding claim 12, Kharas teaches the additional therapeutic agent is 5-fluorouracil or 5-FU (claim 13, pg. 66). Regarding claims 13 and 14, Kharas teaches the inhibitory nucleic acid is administered daily for 6 weeks or 12 weeks or more (claims 15-16, pg. 67). Claim Rejections - 35 USC § 103 – Kharas, Becker, Tzelepis, and Ivanov in view of GenBank NM_005762.3 and Moore Claim 3 is rejected under 35 U.S.C. 103 as being unpatentable over Kharas (Kharas et al., WO 2018/165482 A1, published 13 September 2018; of record), Becker (Becker, 2018, "Epigenetic and Gene Expression Changes Mediated by Histone H3 Methylation in Acute Myeloid Leukemia"; of record), Tzelepis (Tzelepis et al., 18 October 2016, Cell Reports, Vol. 17, No. 4, pg. 1193-1205 and Supplemental Table S4; of record), and Ivanov (Ivanov and Addison, published 14 July 2016, US 2016/0200829 A1; of record) as applied to claims 1-2, and 4-14 above, in further view of GenBank NM_005762.3 (Homo sapiens tripartite motif containing 28 (TRIM28), mRNA NCBI Reference Sequence: NM_005762.3, available 22 November 2018; of record) and Moore (Moore et al., 2010, Methods Mol Biol, 629: 141-158). The rejection that follows is maintained and modified as necessitated by Applicant’s amendments to the claims. The teachings of Kharas, Becker, Tzelepis, Ivanov are described above in paragraphs 14-30 and applied here. As shown in the alignments of record between the shRNAs of Ivanov and SEQ ID NOs: 1-10, the shRNAs disclosed by Ivanov have between 90-95% identity to SEQ ID NOs: 4-5. None of Kharas, Becker, Tzelepis, or Ivanov teach an shRNA comprising the sequence of SEQ ID NOs: 4 or 5 (i.e., 100% identity thereto). GenBank NM_005762.3 teaches the nucleotide sequence of human Trim28 mRNA. The sequence is 3,364 bp in length. As shown in the alignments of record, SEQ ID NOs: 4 and 5 are 100% complementary to the human Trim28 mRNA disclosed in GenBank NM_005762.3. Moore teaches design parameters for shRNAs (sections 3.1-3.6), and teaches that “the proper selection of a target sequence for a given gene of interest remains one of the most critical components of successful gene knockdown” (pg. 2). Moore teaches that “there is no guarantee of effective gene silencing… until experimentally proven.” It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have applied the shRNA design parameters taught by Moore, to the known sequence of Trim28 mRNA taught by GenBank NM_005762.3, to arrive at an shRNA comprising one of SEQ ID NOs: 4 or 5. It would have amounted to choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success. Moore teaches that experimental validation is essential to obtain effective shRNAs. Moore teaches the means to design shRNAs, and test them for gene silencing efficacy. GenBank NM_005762.3 teaches the nucleotide sequence of human Trim28 mRNA, which is 3,364 bp in length. Thus, there are 3,342 shRNAs comprising a 22-nt sequence 100% complementary to the human Trim28 mRNA sequence. Among the 3,342 shRNAs are those having a sequence 100% identical to one of SEQ ID NOs: 4 or 5. A skilled artisan could have pursued the finite, identified solutions with a reasonable expectation of success in producing effective shRNAs because I) Ivanov teaches effective shRNAs comprising substantial identity to SEQ ID NOs: 4-5, which knockdown Trim28 expression and provide a therapeutic effect in vivo, and II) it was well within the capabilities of one of ordinary skill to design shRNAs which are 100% complementary to a known mRNA sequence, and determine their effectivity as evidenced by Moore. Tzelepis teaches that AML is an aggressive cancer with poor prognosis, for which new therapies are urgently needed. Thus, in an effort to produce additional, and potentially more effective, shRNAs targeting Trim28, the skilled artisan would have been motivated to apply the shRNA design parameters taught by Moore to the known sequence of Trim28 mRNA because Moore teaches that experimental validation is essential to obtain effective shRNAs. Response to Remarks - 35 USC § 103 Applicant’s remarks regarding the § 103 rejections raised in the prior action have been reviewed. The remarks are not found persuasive for the reasons that follow. First, Applicant’s remarks address the prior art references primarily in an individual manner. However, the rejections above are made over a combination of references. One cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Applicant’s remarks directed to individual references will be addressed below as they apply to the combination of references applied in the rejections. Kharas is cited for teaching a method of treating AML by administering a therapeutically effective amount of at least one target-specific inhibitory nucleic acid that inhibits the target (i.e., SYNCRIP) in the subject. Kharas teaches that deletion or depletion of the target impairs growth and promotes apoptosis of leukemia cells. As Applicant indicates, Examiner has acknowledged that Kharas does not teach or suggest a Trim28-specific inhibitory nucleic acid for the treatment of AML. Indeed, Becker, Tzelepis, and Ivanov are relied upon to provide teachings and motivations to adapt Kharas’ method to target Trim28, which like SYNCRIP, is also an essential gene for AML cells. Applicant asserts that Becker, Tzelepis, and Ivanov do not remedy the deficiencies of Kharas. Applicant remarks regarding Becker, Tzelepis, and Ivanov center around the following alleged deficiencies: i) the references fail to teach or suggest that inhibiting Trim28 would be sufficient to treat AML because the references allegedly indicate that Trim28 is one of many potential targets, and/or lack empirical evidence showing the effects of inhibiting Trim28, ii) the references fail to teach or suggest that Trim28 selectively kills AML cells, and therefore, the skilled artisan would not have been inclined to pursue Trim28 due to alleged adverse impacts for normal cells, and iii) the results of using a Trim28-specific inhibitory nucleic acid in one context cannot be extrapolated to a different context (i.e., AML). Examiner agrees with Applicant that Becker points to other therapeutic targets (i.e., G9a), and does not provide empirical evidence regarding the function of Trim28 inhibition in AML cells. However, Becker also points the skilled artisan to investigate “G9a-independent” domains’ role in AML, which Becker teaches are regulated by Trim28 interactions with a protein having an established role in AML, i.e., SETDB1. Together with the teachings of Tzelepis described hereinafter, the skilled artisan would have been motivated to pursue Trim28 as a viable target for treating AML. Tzelepis identifies Trim28 among a limited number of “druggable” “AML-specific vulnerabilities” in a CRISPR dropout screen (“To identify AML-specific vulnerabilities, we focused on genes depleted in one or more AML, but not in either of the non-AML cell lines (Table S4). This analysis identified… 492 genes in total,” pg. 1196, right col.; “we searched the “druggability” of the 492 genes specifically depleted in our AML cell lines… and found that 227 (46%) of the genes are in druggable categories (Figure 4D; Table S4),” pg. 1197, left col.). See Table S4, of record, and reproduced below. The skilled artisan would understand based on the nature of Tzelepis’ CRISPR dropout screen (i.e., its identification of AML cell-essential genes), and the concordance between Tzelepis’ screening and validation experiments, that depleting Trim28, using a sgRNA or shRNA, would impair survival of AML cells in a method of treating AML as claimed. PNG media_image1.png 949 890 media_image1.png Greyscale Examiner agrees with Applicant that Tzelepis’ later examples pursue KAT2A and SRPK1 “which are separate and distinct from Trim28.” However, Examiner respectfully disagrees with Applicant’s assertions which appear to suggest that Tzelepis teaches away from targeting Trim28 (“Tzelepis subsequently performed a “differential essentiality filer” to screen for AML-specific therapeutic targets, which led to the results shown in Figure 5 which clearly does NOT list Trim28 as a therapeutic target,” emphasis partially preserved). Applicant’s assertion appears to rely on an improper interpretation of Tzelepis’ experiments related to the “differential essentiality filter.” These experiments illustrate that differentially essential genes identified in the dropout screen (e.g., essential to MOLM-13 but not MV4-11) have different effects on AML cell lines by virtue of their AML genotype (see Fig. 5, pgs. 1197-1200). Fig. 5A shows all genes analyzed based on a FDR < 0.2 (dots), and the names of genes selected for further analysis that are the focus of the remaining views of Fig. 5, i.e., “two druggable genes” (KAT2A and SRPK1) and control genes (HDAC3, AURKB, HDAC6, and CHEK1). Beyond their “druggability,” Tzelepis does not appear to provide any specific reason for selecting KAT2A and SRPK1 among other differentially essential genes. Tzelepis also does not appear to discourage the pursuit of other differentially essential genes, or other “druggable” targets, e.g., Trim28 based on Table S4. The complete set of genes represented in Fig. 5A and analyzed by Tzelepis is available in Table S3 (attached in Appendix III). Table S3 shows that Trim28 is essential for MV4-11 cells but not MOLM-13 cells at FDR < 0.2, such that like KAT2A, it is a differentially essential gene (see pg. 157, “TRIM28”). Table S3 also shows that Trim28 is essential for three different AML cell lines. This is, in fact, Tzelepis’ basis for pursuing KAT2A in the experiments which gave rise to Figs. 6-7 (“We chose to investigate KAT2A further because this gene is essential to three of the five AML cell lines studied… and as such may be relevant to a wider group of AML patients,” pg. 1200, left col.). Taken together, a thorough review of the teachings of Tzelepis proffered by Applicant, and Tzelepis as a whole, failed to uncover any teachings which discourage targeting Trim28, or any other gene identified among their “druggable” “AML-specific vulnerabilities.” Furthermore, Examiner also emphasizes that the motivation to pursue Trim28 in the previous rejections and above was not based on Tzelepis’ teachings alone, but also the teachings of Becker. Applicant also asserts that the lack of teaching or suggestion in the cited prior art that Trim28 inhibition would be specific to AML cells, and therefore, not adversely impact normal blood cells, would discourage the skilled artisan from pursuing Trim28 as a therapeutic target. First, Examiner notes that this feature is not recited in the instant claims. No specific means of delivery or target cells are required of the methods under examination. While Tzelepis acknowledges that selecting targets which avoid adverse impacts to normal blood cells is an “important hurdle,” Tzelepis teaches that “at least a dozen targets that have been in clinical use already were essential to cell types other than AML, suggesting that valuable targets can be found even among genes within this category and may potentially have a broad spectrum of antitumor activity” (pg. 1202). Even should the claims recite limitations related to the Applicant’s argument, it is not apparent that the skilled artisan would be steered away from targeting Trim28 based on these teachings of Tzelepis. Finally, Applicant appears to submit that the use of an shRNA in one context, does not allow the skilled artisan to predict its use in a different context (“the treatment effects shown in Fig. 7 for adenocarcinoma cells via a localized injection of shRNA, cannot be extrapolated to a systemic blood cancer like AML”). The rejection above relies on the success of Ivanov’s shRNA at inhibiting Trim28 in vitro and in vivo, such that together with the teachings of Kharas, Becker, and Tzelepis, the skilled artisan would predict that Ivanov’s shRNAs would be capable of inhibiting Trim28 when administered in a method of treating AML in a subject. The rejection above does not rely on the specific treatment effects of Ivanov in the context of adenocarcinoma cells, and no specific delivery method is claimed. Indeed, the delivery methods encompassed by the instant claims also include various forms of “localized injection” (see claim 10). Applicant has not provided any evidence that the skilled artisan would not predict that one of Ivanov’s shRNAs would inhibit Trim28 in the context of AML. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Aug 04, 2021
Application Filed
Feb 20, 2025
Non-Final Rejection — §103, §112
Aug 25, 2025
Response Filed
Nov 24, 2025
Non-Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595484
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Apr 07, 2026
Patent 12570705
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12570975
COMPOSITION FOR DIAGNOSIS OR TREATMENT OF A CONDITION ASSOCIATED WITH INCREASED ACTIVITY OF EIF4E COMPRISING AN EIF4E INHIBITOR
2y 5m to grant Granted Mar 10, 2026
Patent 12570706
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12551573
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Feb 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

2-3
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+73.4%)
2y 12m
Median Time to Grant
Moderate
PTA Risk
Based on 48 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month