DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s remarks, and amendments to the claims and specification filed August 19, 2025 are acknowledged. Claims 1, 19, 21, 58, and 60 were amended, and claim 3 was cancelled. Claims 1, 4-5, 12-13, 19, 21, 37, 40-44, 51-52, 58, 60, 65-66 are pending.
Election/Restriction
Claims 37, 40-44, 51-52, 58, 60, 65-66 remain withdrawn from further consideration as being drawn to a nonelected invention. Claims 1, 4-5, 12-13, 19, and 21 are under examination hereinafter.
Withdrawn Rejections
The remarks and amendments to the claims have been thoroughly reviewed. The remarks are sufficient to overcome the § 112(b) rejections raised in the prior action. The remarks sufficiently clarify the meaning of the term “combinations thereof.” Based on the remarks and specification, the term allows for the nucleic acid molecule to comprise a PRR agonist or microRNA antagonist, wherein the PRR or microRNA is selected from one or more recited PRRs or microRNAs, and thereby, the PRR agonist or microRNA antagonist targets one or more of the recited PRRs or microRNAs. The amendments to claim 1 to limit the PRR are sufficient to overcome the § 102 rejections over Kortylewski raised in the prior action. The aforementioned rejections are withdrawn.
Applicant’s remarks and amendments to the claims have been thoroughly considered, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Any rejection or objection not reiterated herein has been overcome by amendment.
Priority
Claims 1, 4-5, 12-13, 19, and 21 find support in provisional Application No. 62/806,946, filed February 18, 2019. The effective filing date of all claims currently under examination is February 18, 2019.
Notice to Joint Inventors
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim Rejections - 35 USC § 103 – Kortlyewski in view of Lee and Hou
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 4-5, 13, and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Kortylewski (Kortylewski et al., 1 November 2018, US 2018/0312837 A1; of record), in view of Lee (Lee et al., June 2017, Molecular Therapy, Vol. 25, No. 6, pg. 1295-1305 and Supplemental Information; of record) and Hou (Hou et al., 1 August 2009, The Journal of Immunology, 183(3): pg. 2150-2158; of record). These rejections are new, or maintained and modified from the prior action, as necessitated by Applicant’s amendments to the claims.
In the interest of compact prosecution, claim 21 is examined as requiring the nucleic acid molecule comprise “the sequence set forth in SEQ ID NO: 4.”
The teachings of Kortylewski are described in paragraphs 12-17 of the prior action and applied hereinafter. Kortylewski demonstrates that nucleic acid molecules which comprise a PRR agonist (i.e., CpG-ODN) and a microRNA antagonist (e.g., miR-146a antagonist) have the functions of the independent elements, i.e., cellular uptake and microRNA inhibition ([0280]-[0291] and Figures cited therein). As described therein, Kortylewski is concerned with TLR signaling (at least [0243]). Kortylewski teaches that IRAK1 is a target of miR-146a ([0031]), and demonstrates that a nucleic acid molecule comprising a TLR agonist and miR-146a antagonist increases IRAK1 expression (Fig. 21).
Kortylewski does not teach that the nucleic acid molecule comprises a RIG-I agonist and miR-146a antagonist (claims 3-4, and 13), or that the nucleic acid molecule comprises the sequence set forth in SEQ ID NO: 4 (claim 21).
Lee teaches that the PRR RIG-I induces programmed cell death and cytokine expression in virus- infected cells, and non-infected malignant cells (pg. 1295-296). However, Lee teaches that the therapeutic use of PRR agonists is hindered by the production of pro-inflammatory cytokines that “can cause damage to normal tissue and organ failure,” and “contribute to the deregulation of anti-tumor immunity, which negatively impacts the therapeutic effects” of PRR agonists (pg. 1295-1296). Lee teaches that accordingly, it is desirable to design PRR agonists which “can differentially induce… cell death with or without the concomitant expression of IFN-β and proinflammatory cytokines” (pg. 1296, left col.).
Lee demonstrates that PRR agonists with multiple stem-loop structures are cytotoxic to human cancer cells, but do not illicit IFN-β production (Fig. 1; pg. 1296, right col.). Lee demonstrates that at least one of the multiple stem-loop-containing PRR agonists is “RIG-I dependent” (Fig. 1; Supplemental Table S1; Fig. 5; pg. 1299, right col.). Lee demonstrates this RIG-I agonist, “ICR4,” is cytotoxic to multiple human cancer cell types, but does not promote as much cytokine production as a single stem-loop structured PRR agonist, “ICR2,” or the “gold-standard PRR-stimulating RNA agonist poly(I:C)” (Figs. S2, and 2-3). Lee teaches that ICR4 inhibits tumor growth in vivo “as effectively as poly(I:C)” and extends subject survival (Fig. 7; pg. 1295, right col.). Lee also teaches the “well-known” structures of nucleic acid molecules that stimulate RIG-I, “e.g., 5’ triphosphate (5’ppp), 5’disphosphate (5’pp), and double-stranded RNA (dsRNA,” “a short RNA duplex composed of interstranded or intrastranded base pairs (10-20bp) (pg. 1295, left col.; pg. 1296, left col.; pg. 1302, right col.). Lee concludes that ICR4 is a “novel PRR-stimulating ssRNA” that promotes strong immunogenic cell death of cancer cells, but reduces production of proinflammatory cytokines (pg. 1301; pg. 1296, left col.).
Lee does not teach or suggest a nucleic acid molecule which combines a RIG-I agonist and a microRNA antagonist.
However, Hou teaches that in addition to being a “negative feedback regulator in TLR signaling” by targeting at least IRAK1, miR-146a is also a negative regulator of RIG-I signaling, by targeting IRAK1 (“miR-146a feedback… impairing RIG-I pathway through targeting TRAF6, IRAK1…,” pg. 2151, left col.). Hou also demonstrates that a miR-146a antagonist impacts IFN-β production (Fig. 2; pg. 2156-2157).
Regarding claims 1, 4-5 and 13, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined a RIG-I agonist taught by Lee, with a miR-146a antagonist in view of Hou and Kortylewski. It would have amounted to a combination of known sequences by known means to yield predictable results. The sequence and structural elements of effective RIG-I agonists and miR-146a antagonists were known in the art as evidenced by Lee, Hou and Kortylewski. Kortylewski demonstrates that PRR agonists and microRNA antagonists can be combined into the same nucleic acid molecule, and preserve the functions of the two elements. It was also well-within the capabilities of the skilled artisan to design nucleic acid molecules with specific, predicted secondary structures as evidenced by Lee. Accordingly, the skilled artisan would have had a reasonable expectation of success in combining a RIG-I agonist and miR-146a antagonist into a single nucleic acid molecule such that the elements perform the same functions when combined as they perform separately. Kortylewski teaches nucleic acid molecules that comprise a TLR agonist (i.e., CpG-ODN), and a microRNA antagonist targeting miR-146a. As evidenced by Hou, miR-146a is a negative regulator of TLR signaling. Because Hou teaches that miR-146a also negatively regulates RIG-I signaling (i.e., the target of the nucleic acid molecules of Lee), the skilled artisan would have been motivated to arrive at the nucleic acid molecules of instant claims 1, 4-5, and 13.
Regarding claim 21, Lee teaches the sequence of the RIG-I agonist ICR4 (Supplementary Fig. 1). Kortylewski teaches the sequence of a miR-146a antagonist ([0288]). As shown in Fig. A below, these sequences comprise 100% identity to regions of instant SEQ ID NO: 4. Furthermore, as described above, Lee teaches the structural elements of RIG-I agonists, as well as the double stem-loop structure of ICR4, which is effective in promoting cancer cell death, while limiting production of proinflammatory cytokines. It is noted that the single stem-loop structure of ICR2 consists of the 5’-most stem-loop of ICR4 (Supplementary Fig. 1), and is also 100% identical to the 5’-most nucleotides of instant SEQ ID NO: 4. Taken together, the skilled artisan would predict that while a second stem-loop need be present for the differential cytotoxic/inflammatory effects of ICR4 vs. ICR2, the sequence of the second stem-loop itself need only be designed with “well-known” RIG-I agonizing structures so as to preserve the overall function of the combined nucleic acid molecule.
FIGURE A
GGAUGCGGUACCUGACAGCAUCCUCCCCCGCAUUCCAUGGUCAACCCAUGGAAUUCAGUUCUCA SEQ ID NO: 4
GGAUGCGGUACCUGACAGCAUCCUAAACUCAUGUCCAUGUUUGUCCAUGGACCA ICR4
CCCAUGGAAUUCAGUUCUCA anti-miR-146a
GGAUGCGGUACCUGACAGCAUCC ICR2
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the specific sequences of Lee and Kortylewski, and preserved the double stem-loop structure of Lee’s ICR4, in order to arrive at a nucleic acid molecule comprising SEQ ID NO: 4. It would have amounted to combining known sequences in a known structure effective for stimulating RIG-I, by known means to yield predictable results. As described above, the sequence and structural elements of effective RIG-I agonists, including ICR4, and miR-146a antagonists were known in the art as evidenced by Lee, Hou, and Kortylewski. Kortylewski demonstrates that PRR agonists and microRNA antagonists can be combined into the same nucleic acid molecule, and preserve the functions of the two elements. It was also well-within the capabilities of the skilled artisan to design nucleic acid molecules with specific, predicted secondary structures as evidenced by Lee. Accordingly, the skilled artisan would have had a reasonable expectation of success in combining the ICR4 sequence and double stem-loop structure of Lee with the miR-146a antagonist of Kortylewski such that the elements perform the same functions when combined as they perform separately. Kortylewski teaches nucleic acid molecules that comprise a TLR agonist (i.e., CpG-ODN), and a microRNA antagonist targeting miR-146a. As evidenced by Hou, miR-146a is a negative regulator of TLR signaling. Because Hou teaches that miR-146a also negatively regulates RIG-I signaling (i.e., the target of the nucleic acid molecules of Lee), the skilled artisan would have been motivated to arrive at a nucleic acid molecule comprising SEQ ID NO: 4.
Claim Rejections - 35 USC § 103 – Kortlyewski in view of Lee and Chen
Claims 12 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Kortylewski (Kortylewski et al., 1 November 2018, US 2018/0312837 A1; of record), in view of Lee (Lee et al., June 2017, Molecular Therapy, Vol. 25, No. 6, pg. 1295-1305 and Supplemental Information; of record) and Chen (Chen et al., 25 April 2013, PLOS Pathogens, Vol. 9, Issue 4, e1003248, pg. 1-20 and Supplemental Table S1; of record). This rejection is maintained from the prior action with modification necessitated by Applicant’s amendments to the claims.
In the interest of compact prosecution, claim 19 is examined as requiring the nucleic acid molecule comprise “the sequence set forth in SEQ ID NO: 2.”
The teachings of Kortylewski are described in paragraphs 12-17 of the prior action and paragraph 9 above, and applied hereinafter.
Kortylewski does not teach that the nucleic acid molecule comprises a RIG-I agonist and miR-21 antagonist (claim 12), or that the nucleic acid molecule comprises the sequence set forth in SEQ ID NO: 2 (claim 19).
The teachings of Lee are described above in paragraphs 11 and 14 and applied hereinafter. While Lee teaches a nucleic acid molecule comprising a RIG-I agonist, Lee does not teach or suggest a nucleic acid molecule which combines a RIG-I agonist and a microRNA antagonist.
However, Chen teaches that miR-21 is a negative regulator of TLR and RIG-I signaling, by targeting IRAK1 (“miR-21 targets two important factors in the TLR signaling pathway… IRAK1,” Abstract; “HCV is first identified by TLRs and retinoic-acid-inducible gene-1 (RIG-1), which in turn initiate type I IFN production,” pg. 14-15; Figs. 8, 12). Chen also demonstrates that a miR-21 antagonist impacts IFN-α production (Figs. 8, 10), which Lee teaches is a cytokine that can cause damage to normal tissues and organ failure (pg. 1295, right col. to 1296, left col.).
Regarding claim 12, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined a RIG-I agonist taught by Lee, with a miR-21 antagonist in view of Chen and Kortylewski. It would have amounted to a combination of known sequences by known means to yield predictable results. The sequence and structural elements of effective RIG-I agonists and miR-21 antagonists were known in the art as evidenced by Lee, Chen, and Kortylewski. Kortylewski demonstrates that PRR agonists and microRNA antagonists can be combined into the same nucleic acid molecule, and preserve the functions of the two elements. It was also well-within the capabilities of the skilled artisan to design nucleic acid molecules with specific, predicted secondary structures as evidenced by Lee. Accordingly, the skilled artisan would have had a reasonable expectation of success in combining a RIG-I agonist and miR-21 antagonist into a single nucleic acid molecule such that the elements perform the same functions when combined as they perform separately. Kortylewski teaches nucleic acid molecules that comprise a TLR agonist (i.e., CpG-ODN), and a microRNA antagonist targeting miR-21. As evidenced by Chen, miR-21 is a negative regulator of TLR signaling. Because Chen teaches that miR-21 also negatively regulates RIG-I signaling (i.e., the target of the nucleic acid molecules of Lee), the skilled artisan would have been motivated to arrive at the nucleic acid molecule of instant claim 12.
Regarding claim 19, Lee teaches the sequence of the RIG-I agonist ICR4 (Supplementary Fig. 1). Chen teaches the sequence of a miR-21 antagonist (“miR-21 inhibitor,” Supplemental Table S1). As shown in Fig. B below, these sequences comprise 100% identity to regions of instant SEQ ID NO: 2. Furthermore, as described above, Lee teaches the structural elements of RIG-I agonists, as well as the double stem-loop structure of ICR4, which is effective in promoting cancer cell death, while limiting production of proinflammatory cytokines. It is noted that the single stem-loop structure of ICR2 consists of the 5’-most stem-loop of ICR4 (Supplementary Fig. 1), and is also 100% identical to the 5’-most nucleotides of instant SEQ ID NO: 4. Taken together, the skilled artisan would predict that while a second stem-loop need be present for the differential cytotoxic/inflammatory effects of ICR4 vs. ICR2, the sequence of the second stem-loop itself need only be designed with “well-known” RIG-I agonizing structures so as to preserve the overall function of the combined nucleic acid molecule.
FIGURE B
GGAUGCGGUACCUGACAGCAUCUUGAAAUAAGGACUGAUGCUCAACAUCAGUCUGAUAAGCUA SEQ ID NO: 2
GGAUGCGGUACCUGACAGCAUCCUAAACUCAUGUCCAUGUUUGUCCAUGGACCA ICR4
UCAACAUCAGUCUGAUAAGCUA anti-miR-21
GGAUGCGGUACCUGACAGCAUCC ICR2
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the specific sequences of Lee and Chen, and preserved the double stem-loop structure of Lee’s ICR4, in order to arrive at a nucleic acid molecule comprising SEQ ID NO: 2. It would have amounted to combining known sequences in a known structure effective for stimulating RIG-I, by known means to yield predictable results. As described above, the sequence and structural elements of effective RIG-I agonists, including ICR4, and miR-21 antagonists were known in the art as evidenced by Lee, Chen and Kortylewski. Kortylewski demonstrates that PRR agonists and microRNA antagonists can be combined into the same nucleic acid molecule, and preserve the functions of the two elements. It was also well-within the capabilities of the skilled artisan to design nucleic acid molecules with specific, predicted secondary structures as evidenced by Lee. Accordingly, the skilled artisan would have had a reasonable expectation of success in combining the ICR4 sequence and double stem-loop structure of Lee with the miR-21 antagonist of Chen such that the elements perform the same functions when combined as they perform separately. Kortylewski teaches nucleic acid molecules that comprise a TLR agonist (i.e., CpG-ODN), and a microRNA antagonist targeting miR-21. As evidenced by Chen, miR-21 is a negative regulator of TLR signaling. Because Chen teaches that miR-21 also negatively regulates RIG-I signaling (i.e., the target of the nucleic acid molecules of Lee), the skilled artisan would have been motivated to arrive at a nucleic acid molecule comprising SEQ ID NO: 2.
Response to Remarks - § 103
Applicant’s remarks regarding the § 103 rejections raised in the prior action have been reviewed. The remarks are not found persuasive to overcome the rejections for the reasons that follow.
Applicant submits that because “Examiner engages in a piecemeal analysis of the claim without addressing the entirety of the claim,” a prima facie finding of obviousness has not been established. Applicant alleges that the cited art disparately discloses elements of the claimed invention, and that there is no indication based on the art which elements to select and combine to arrive at the claimed invention. Applicant states that because “the prior art does not offer a teaching or suggestion of how to select particular, useful species from out of a generic disclosure, the selection of those particular, useful species constitutes a patentable, non-obvious invention.”
Examiner acknowledges that the obviousness rejections address elements of the claimed invention in “pieces.” This is because the claimed nucleic acid molecule is, in fact, a combination of elements (i.e., a PRR agonist and a microRNA antagonist). Due to the nature of the invention, and the absence of the exact structure in the prior art, Examiner must, necessarily, render obvious the combination of “pieces” of the claimed nucleic acid molecule. In rendering obvious the combination of elements in the nucleic acid molecule, Examiner has, indeed, addressed “the entirety of the claim.”
Applicant alleges that the elements of the claimed invention are disparately disclosed in the cited prior art, and that there is no teaching or suggestion in the prior art to select and combine the elements. Examiner respectfully disagrees. First, the test for obviousness is not whether the features of a secondary reference may be bodily incorporated into the structure of the primary reference; nor is it that the claimed invention must be expressly suggested in any one or all of the references. Rather, the test is what the combined teachings of the references would have suggested to those of ordinary skill in the art. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981).
As stated in the prior action and above, Kortylewski teaches a nucleic acid molecule comprising a specific PRR agonist, i.e., a TLR agonist, and a miR-146a antagonist. The prior art teaches that miR-146a negatively regulates TLR signaling by targeting IRAK1 (see Hou et al., described in paragraph 23, Kortylewski, at least [0290], Fig. 21). Thus, the skilled artisan would understand that Kortylewski is concerned with nucleic acid molecules that agonize a PRR, and inhibit a microRNA, which would otherwise antagonize the signaling downstream of the PRR via IRAK1. Lee teaches a nucleic acid molecule comprising a different PRR agonist, i.e., a RIG-I agonist, which Lee teaches has advantages relative to other PRR agonists (i.e., reduced production of pro-inflammatory cytokines). The prior art teaches that miR-146a, and similarly, miR-21, negatively regulate RIG-I signaling by targeting IRAK1 (see Hou et al., described in paragraph 23; Chen et al., described in paragraph 32). The skilled artisan would have recognized that Kortylewski’s combination of a PRR agonist and microRNA antagonist, applies to the PRR targeted by the nucleic acid molecule of Lee (i.e., RIG-I), and thereby, would have been motivated to combine Lee’s RIG-I agonist with either a miR-146a or miR-21 antagonist. The skilled artisan would have had a reasonable expectation of success in preparing and using the combination because Kortylewski demonstrates that PRR agonists and microRNA antagonists can be combined into the same nucleic acid molecule, and preserve the function of each element. It is not apparent based on a review of the obviousness rejections raised in the prior action and above, that the rejections are deficient with respect to the limitations of the claims, a reasonable expectation of success, or motivation to combine. Furthermore, the rejections rely on the teachings of the prior art, and what the teachings would have suggested to those of ordinary skill. The rejections do not rely upon knowledge gleaned only from Applicant’s disclosure.
Finally, Applicant alleges that “[t]he combination of PRR agonist and microRNA antagonist yields a nucleic acid molecule having unexpectedly superior anti-tumor properties.” In support of the alleged superior anti-tumor properties, Applicant cites Fig. 3E, which illustrates that administration of “RigantmiR-21” results in improved survival in tumor-injected mice, relative to mice administered ICR4 (i.e., RIG-I agonist) or miR-21 antagonist alone. Applicant also cites Figs. 4A-C, which illustrates that administration of RigantmiR-21 to cell lines results in increased expression of IFN-β relative to ICR4 (i.e., RIG-I agonist) or miR-21 antagonist alone. MPEP 716.02(d) states that the "objective evidence of nonobviousness must be commensurate in scope with the claims which the evidence is offered to support." In the instant case, the claims are directed to a nucleic acid molecule comprising a generic microRNA antagonist and a PRR agonist, wherein the PRR is selected from any one or more recited PRRs (i.e., RIG-I, STING, MDA5, etc.). The proffered evidence relates to a specific use of a specific embodiment of the claimed genus (i.e., RigantimiR-21, corresponding to SEQ ID NO: 2 based on Table 2). The proffered evidence is not commensurate in scope with the claims, and there is insufficient evidence that one of ordinary skill would be able to “determine a trend in the exemplified data which would allow the artisan to reasonably extend the probative value thereof.”
Taken together, Applicant’s remarks and evidence of alleged unexpected results are not sufficient to overcome the obviousness rejections raised above.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Soren Harward/Primary Examiner, TC 1600