DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status and Election
Applicant’s amendments filed October 6, 2025 amending claims 1 and 23-24, cancelling claims 2-3, and adding new claims 31-38 is acknowledged. Claims 1, 5-6, 9, 11-16, 23-24 and 31-38 are pending. Claim 9 remains withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim.
The new claims recite gRNAs with guide sequences having at least 17 contiguous nucleotides from SEQ ID NO 36491 and 37184, which are also included in amended claim 1 with the addition of SEQ ID NO 35795. The recited SEQ ID NOs are nearly identical – SEQ ID NOs 36491 and 37184 contain 1 and 2 additional nucleotides, respectively, compared to the 20-mer SEQ ID NO 35795 (See below). But as all claims only require 17 contiguous nucleotides from the recited SEQ ID NOs, the same gRNAs that comprise 17, 18, 19 or 20 nucleotides of SEQ ID NO 35795 in the spacer region are encompassed by both claim 1 and the new claims that do not include SEQ ID NO 35795. Therefore, even though the new claims do not recite the elected target sequence (See Remarks filed February 28, 2025), examining the new claims does not constitute a search burden since the same guide RNA targeting sequences are encompassed by the new claims
Claims 1, 5-6, 11-16, 23-24 and 31-38 are under examination.
Terminal Disclaimer
The terminal disclaimer filed on October 6, 2025 disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of any patent granted on US Applications 17428253 has been approved.
Withdrawn Rejections
The amendment to claim 1 requiring the guide sequence to have at least 17 contiguous nucleotides from SEQ ID NOs 35795, 36491 or 37184 overcomes the §103 rejections over Mizoguchi in view of Christie and others.
The terminal disclaimer noted above overcomes the nonstatutory double patenting rejection.
Any other rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Priority
As indicated in the previous office action (page 3), the disclosure of prior-filed Application No. 62/810879 fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) for one or more claims of this application. The application fails to provide support for the claims under examination, since there is no disclosure therein of SEQ ID NOs 35795, 36491, or 37184. The first evidence of support is PCT Application PCT/US2020/019633 (filed February 25, 2020). As such, the effective filing date for all claims is February 25, 2020.
Drawings
The drawings are objected to because the text in FIGs 1B and 3D of the replacement sheets filed October 6, 2025 is still either too small or of too low resolution to provide satisfactory reproduction characteristics. 37 CFR 1.84(l) states that “all drawings must be made by a process which will give them satisfactory reproduction characteristics. Every line, number, and letter must be durable, clean, black (except for color drawings), sufficiently dense and dark, and uniformly thick and well-defined.”
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Response to Arguments – Drawings
Applicant argues that the replacement drawings remedy the objections to the drawings (Remarks, page 10, ¶2-3). This argument is persuasive as it pertains to FIG. 1A. However, the text in FIG 1B below the vertical bars and the label regions of the guide RNA names is still too light and small for reproduction. The text in FIG 3D, between the chromosome schematic and the schematic with the vertical lines is very small, blurry and difficult to read. As such, it is also not sufficiently large or of high enough resolution for reproduction.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 6, 11, 13 and 33 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is new rejection necessitated by amendment.
The use of the “first” and “second” guide RNAs with the recited SEQ ID NOs for the first guide RNA and later features of the “first and second” guide RNAs render the dependent claims confusing and indefinite as follows:
Claims 1 and 31 require the “first RNA molecule” to have a guide sequence of SEQ ID NO 35795, 36791 or 37184. According the Specification, each of those SEQ ID NOs target a sequence in Intron 3 and are described as “non-discriminatory” (page 56). As such, they would target both mutant and wild-type STAT1 alleles. Claims 6 and 11 recite the first RNA molecule targets the CRISPR nuclease to a SNP position of the mutant allele and is a heterozygous SNP. From the GenBank record for STAT1 (signal transducer and activator of transcription 1 [Homo sapiens (human)], full report https://www.ncbi.nlm.nih.gov/gene/6772, [retrieved April 1, 2025], of record), it does not appear that the claimed SEQ ID NOs target a SNP that is associated with CMC. There are no recorded SNPs in the PAM sequence and all of the reported SNPs in the spacer/targeting sequence have no known clinical significance and have a frequency below 0.01% in the population. Thus, it is not clear how the guide RNAs of claim 6 are to target a SNP position of the CMC-associated mutant STAT1 allele. Furthermore, given the extremely low frequency of all the known SNPs in the targeted sequence, it is extremely unlikely that a subject would ever be heterozygous for them. As such it is confusing how the recited SEQ ID NOs could function as claimed.
Claims 12 and 32 recite a second RNA molecule that binds to Cas9 and creates a second double strand break in the STAT1 gene. Claims 13 and 33 then recite “wherein the second RNA molecule is a non-discriminatory gRNA that target both a functional STAT1 allele and the mutant STAT1 allele.” As indicated above, the recited SEQ ID NOs in claims 1 and 31 fit the characterization of claim 13 and 33.
Thus, taken as a whole, it appears that the claimed descriptions of the “first and second RNA molecules” were switched given the specific SEQ ID NOs recited as the “first RNA molecule” in claims 1 and 31, which renders the claims reciting the RNA molecule descriptions indefinite.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 6, 11-16, 23-24 and 31-38 are rejected under 35 U.S.C. 103 as being unpatentable over Davidson (US 20190055552 A1, priority to October 9, 2015, of record) in view of Mizoguchi (Mizoguchi et al., Journal of Leukocyte Biology (2014), 95: 667-676, of record), Cornu (Cornu et al., Nature Medicine (2017), 23: 415-423, of record), Liu (Liu et al., Nature Immunology (2018), 19: 41-52, of record), Genbank (NG_008294.1, https://www.ncbi.nlm.nih.gov/nuccore/194440702, available at least as of December 14, 2017, [retrieved March 31, 2025], of record) and dsSNP (rs41474144, https://www.ncbi.nlm.nih.gov/snp/rs41474144, [retrieved April 1, 2025], of record). Claim 13 is evidenced by NCBI (STAT1 signal transducer and activator of transcription 1 [Homo sapiens (human)], full report https://www.ncbi.nlm.nih.gov/gene/6772, [retrieved April 1, 2025]). This is a maintained rejection of claim 1 (equivalent to canceled claim 3) and new rejections of new claims 31-38.
Claims 6, 11, 13 and 33 are indefinite for the reasons described above in paragraphs 15-18. For the purpose of compact prosecution, the “first RNA molecule” with SEQ ID NOs 35795, 36491 or 37184 is interpreted as being the “non-discriminatory” RNA molecule described in claims 13 and 33; and the non-specified “second RNA molecule” as being the one that targets to a SNP position of a mutant allele described in claims 6 and 11.
Regarding claims 1, 6, 12, 23, 31-32 and 37, Davidson teaches Huntington's Disease (HD) is caused by a dominant trinucleotide repeat mutation in exon 1 of the HTT gene ([0003]). Davidson teaches HD phenotypes can be resolved if mutant HTT expression is eliminated ([0004]). Davidson teaches targeting a PAM-generating SNP in the promoter (Table 1) and another sequence in intron 1 ([0020]); Fig 3A, 3E). Davidson teaches using a pair of SNP-specific guide RNAs that bind upstream and downstream of exon 1 of a mutated HTT allele (Fig 3A). Davidson teaches that the SNPs targeted generate an NRG SpCas9 PAM motif critical for CRISPR selective editing of one allele vs. the other ([0048]; Fig 3A, 3E). Davidson teaches using a SNP-specific sgRNA in the promoter to delete the disease-causing trinucleotide expansion from the mutant allele (Fig 3A). Davidson teaches methods for detecting SNP-dependent PAM motifs with a prevalence of over 5% in non-coding regions upstream and downstream of HTT exon 1, which comprises the dominant HD-causing mutation ([0054]). Davidson teaches the PAM generating SNPs were obtained from the 1000 Genomes database by screening for SNPs in the HTT gene in the database against the SpCas9 PAM sequence ([0054]). Davidson teaches determining whether a SNP identified in the 1000 Genomes database screen was present in an individual's genome ([0057]). Davidson teaches the prevalence of each PAM-altering SNP in the population and indicate that each has a minor allele frequency (MAF) greater than 10% (Tables 1 and 3).
Although Davidson teaches pairs of sgRNAs that target PAM-generating SNPs upstream and downstream of a dominant, disease-associated allele, Davison does not teach the sgRNAs target a STAT1 mutant allele that is associated with CMC.
Cornu reviews advances made in the field of gene editing field for therapeutic purposes (Review). Cornu teaches that gain-of-function mutations in STAT1 are a potential target for gene editing in hematopoietic cells (Table 1).
Mizoguchi teaches Chronic Mucocutaneous Candidiasis (CMC) is an autosomal dominant disease caused by gain-of-function (GOF) mutations in the STAT1 gene (Abstract). Mizoguchi teaches identifying dominant GOF mutations in STAT1 that cause CMC, including an A>G mutation at position 604 of the STAT1 coding sequence that causes an M202V amino acid substitution (Fig 1A,C, Table 1, page 671, ¶2). Mizoguchi teach the M202V mutation causes CMC characterized by recurrent stomatitis as a result of C. albicans infection (Table 1). As such, the STAT1 M202V allele is a mutation associated with CMC.
Liu teaches introducing Cas9 and two guide RNAs targeted to introns to delete two exons in the STAT1 gene of mice to knockout a STAT1 allele (Supp Fig 5b; Methods, ¶2).
dbSNP teaches the rs41474144 SNP sequence is an A>G SNP on the antisense strand in a STAT1 intron (pages 1 and 8). dsSNP teaches the A>G SNP creates a TAA>TAG change in the sequence of intron 9 (i.e., creates an NRG SpCas9 PAM sequence). dsSNP teaches STAT1 intron sequence upstream and downstream of the rs41474144 SNP (page 8). dpSNP teaches that the rs41474144 SNP was reported as early as 2010 from the 1000GENOMES project (page 6). dbSNP teaches the G allele has an overall frequency of 0.12 and up to 0.22 in some populations (pages 1-2).
Genbank teaches the genomic sequence and intron-exon structure of the human STAT1 gene. Genbank teaches the sequence of intron 3, which is nucleotide positions 9376 – 10143 (page 2, mRNA coordinates). Genbank teaches that intron 3 comprises TACTGGTTGATTAAGTGACT (i.e., a first guide RNA, SEQ ID NO 35795, and comprising at least 17 contiguous nucleotides of SEQ ID NOs 36491 and 37184) (page 9, underlined). Genbank teaches that SEQ ID NO 35795 is the 20 nucleotides 5’ of 5’-TGG (i.e., a SpCas9 PAM sequence) (page 9). Genbank teaches the A>G SNP that causes the M202V mutation taught in Mizoguchi is at nucleotide position 21005, which is in exon 9. Genbank teaches the 20 nucleotides 5’ of the A>G rs41474144 SNP are CCCGGCACACAGTAGGCATT (i.e., a second guide RNA, SEQ ID NO 29664) (page 11, underlined).
Regarding claims 1, 6, 12, 23, 31-32 and 37, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used SpCas9 with two sgRNAs with targeting sequences of SEQ ID NOs 35795 and 29664, which flank the dominant M202V allele taught in Mizoguchi, and one of which targets a PAM-generating SNP, to modify the dominant gain-of-function STAT1 M202V allele in a cell. It would have amounted to applying Davidson’s method of targeting a PAM-generating SNP that flanks a dominant disease-associated allele to delete the dominant mutation, to delete the dominant STAT1 M202V mutation taught in Mizoguchi using the available GenBank and dbSNP databases. Liu and Davidson both teach using two sgRNAs simultaneously can effectively delete the intervening sequence. Additionally, Davidson teaches that PAM-generating SNPs linked to the mutant allele can be used to specifically target the mutant and not the wild type allele. Because Mizoguchi teaches the M202V mutation is dominant the skilled artisan would have been motivated to remove a DNA fragment containing the M202V mutation by using sgRNAs that remove exon 9, which comprises the M202V codon thereby rendering the remaining gene portion inoperable. Davidson provides the methods to design sgRNAs that target PAM-generating SNPs, namely search the 1000 Genomes database for prevalent SNPs in the gene of interest and then sequence cells from an affected individual to determine if the PAM-generating SNPs are linked to the mutant allele. dbSNP teaches that SNPs are common in the intronic region and many create SpCas9 PAM sequences, of which the rs41474144 SNP was known prior to the effective filing date. Additionally, dbSNP teaches the rs41474144 SNP is prevalent in the human population, which Davidson teaches is useful for the method. Thus, the skilled artisan would have predicted that SpCas9 and two sgRNAs, one of which targets a PAM-generating SNP could be used in a method to delete (i.e., modify) a portion of the CMC-associated M202V allele in a cell.
Regarding claim 11, dbSNP teaches the overall frequency of the G allele of the rs41474144 SNP is 11%. It would have been predictable that a subject carrying the PAM-generating G allele, would likely be heterozygous because there is a 90% chance that the cell’s other allele was the A (non-targeted) allele based on the frequency of the A allele in the human population.
Regarding claims 13 and 33, NCBI teaches that the PAM sequence of a guide RNA with SEQ ID NO 35795, and the first 20 contiguous nucleotides of SEQ ID NOs 36491 and 37184 (position 191,009,809 - 191,009,807) has no known SNPs in the human population that would destroy the 5’-TGG PAM. As such the gRNA with SEQ ID NO 35795 and the first 20 contiguous nucleotides of SEQ ID NOs 36491 and 37184 would target both a functional STAT1 allele and the M202V allele.
Regarding claims 14 and 34, Genbank teaches that gRNAs with SEQ ID NO 35795, the first 20 contiguous nucleotides of SEQ ID NOs 36491 and 37184, and 29664 target introns (pages 2, 9 and 11).
Regarding claims 15 and 35, the method rendered obvious above for claims 1 and 31 above would result in a deletion of all exons between the two sgRNA-targeted sequences, which target intron 3 and intron 9. Thus, the obvious method would result in deletion of exons 4, 7, 8 and 9.
Regarding claims 16 and 36, as indicated above for claims 1, 12, 31 and 32, the second guide RNA has the sequence of SEQ ID NO 29664.
Regarding claims 24 and 38, the teachings of Davidson, Mizoguchi, Liu, Genbank and dbSNP and the obviousness of using SpCas9 and guide RNAs with targeting sequences SEQ ID NO 35795 (i.e., also first 20 contiguous nucleotides of SEQ ID NOs 36491 and 37184) and 29664 to delete a large portion of the STAT1 M202V allele is recited above as for claims 1, 12 and 31-32. It would have also been obvious that delivering the composition with SpCas9 and guide RNAs with targeting sequences SEQ ID NO 35795 and 29664 would treat CMC caused by the dominant STAT1 M202V allele. Davidson teaches that removal of a dominant allele in a cell is effective for treating the disease that is caused by the dominant mutant allele. Thus, the skilled artisan would have predicted that that removal of six exons of the mutant M202V allele would inactivate the mutant STAT1 allele, thereby removing disease-causing gain-of-function protein from the cell. Because Mizoguchi teaches the gain-of-function M202V is correlated with disease phenotypes the skilled artisan would reasonably predict that removal of the gain-of-function protein from the cell by inactivation of the M202V allele would abate CMC symptoms.
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Davidson (US 20190055552 A1, priority to October 9, 2015), Mizoguchi (Mizoguchi et al., Journal of Leukocyte Biology (2014), 95: 667-676), Cornu (Cornu et al., Nature Medicine (2017), 23: 415-423), Liu (Liu et al., Nature Immunology (2018), 19: 41-52), Genbank (NG_008294.1, https://www.ncbi.nlm.nih.gov/nuccore/194440702, available at least as of December 14, 2017, [retrieved March 31, 2025]) and dsSNP (rs41474144, https://www.ncbi.nlm.nih.gov/snp/rs41474144, [retrieved April 1, 2025]) as applied to claims 1, 6, 11-16, 23-24 and 31-38 above, and further in view of Lamb (Lamb et al., Fly (2017), 11: 53-64). This is a new rejection, necessitated by amendment to claim 1.
The teachings of Davison, Mizoguchi, Cornu, Liu, Genbank and dsSNP are recited above an applied as for claims 1, 6, 11-16, 23-24 and 31-38. Cornu also teaches that double strand breaks can be repaired via HDR (page 416, ¶3). Cornu teaches that during HDR a donor DNA is provided that serves as a template for the cellular repair machinery to repair the DNA double strand break (Box 1). Cornu teaches that HDR can be used to correct the underlying disease-causing mutation (¶ spanning paces 415-416). Cornu teaches that HDR has been successful to repair disease-causing mutations (Box 1).
Davison, Mizoguchi, Cornu, Liu, Genbank and dsSNP do not teach also introducing a donor DNA molecule for HDR when a portion of the mutant dominant allele is deleted.
Lamb teaches methods for allele replacement using Cas9 and two guide RNAs (Figure 1). Lamb teaches the two guide RNAs great double strand breaks on either side of a specific SNP (Fig 1D). Lamb teaches then introducing a donor plasmid comprising the desired SNP/allele change and regions of homology outside the Cas9/gRNA cleaved mutant allele (Fig 1D). Lamb teaches using donor DNA plasmids allows modifications to be made at a greater distance from the cleavage site and allows larger sequences to be inserted at the site of repair (¶ spanning pages 53-54).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have also introduced a donor DNA molecule comprising the wildtype SNP to correct the dominant M202V mutation along with SpCas9 and the guide RNAs targeting sequences that are flanking the M202V-generating mutation. It would have amounted to using a known mechanism for correcting a disease-causing mutation by known means to yield predictable results. The skilled artisan would have predicted that a donor DNA can be included because Cornu teaches that HDR using donor DNA has been used to correct genes in patient cells, and Lamb teaches the design principles to create a donor DNA that could be used to correct the M202V mutation. The skilled artisan would have been motivated to do so because Cornu teaches that STAT1 is a potential therapeutic target.
Response to Arguments - §103
Applicant summarizes the obviousness rejection and notes that the rejection does not cite references that discloses SEQ DI NO 35795, but instead relies on the full genomic sequence of STAT1 (Remarks page 15, ¶2). Applicant argues that STAT1 gene contains multiple deleterious mutations associated with CMC that center in the coiled-coiled domain spanning multiple exons, but that the claimed guide SEQ ID NOs is directed to an intron, where there are no deleterious mutations present. Applicant concludes then that the identification of intron 3 is a result of hindsight (page 15, ¶3). These arguments have been fully considered but are not persuasive. First, Davidson provides a method for inactivating deleterious dominant alleles using guide RNAs that also do not directly target Cas9/gRNA to the deleterious mutation itself. As such it was known in the art that two Cas9/gRNA complexes – neither of which directly target the disease-causing mutation – could be used to inactivate a disease-causing dominant mutation. Because Cornu teaches that STAT1 dominant alleles are a potential target for Cas9/gRNA editing, it would have been obvious to apply Davison’s method of deleting the coding sequence of the M202V disease-causing allele. Second, in response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). In this case, each of the steps taken in the obviousness rejection to arrive at using guide RNAs with targeting sequences of SEQ ID NOs 35795 and 29664 were taught in Davidson and used publicly available databases, that were available before the effective filing date of the claimed invention.
Applicant argues that it was also hindsight to target intron 3 (i.e., nucleotide positions 9422-9441) for modifying the M202V allele, which is exon 8 at nucleotide position 21005 (page 15, ¶4). This argument has been fully considered but is not persuasive because each of the steps taken in the obviousness rejection to arrive at using guide RNAs with targeting sequences of SEQ ID NOs 35795 and 29664 were taught in Davidson. Davidson’s HTT targeting used guide RNAs that were 958 bp, 1182 bp, 1672 bp, 2398 bp, 3978 bp, and 5684 bp apart to remove the disease-causing allele (Fig 4A). Based on Davidson’s data, the distance between the gRNAs and the disease-causing allele did not appear to be a major factor of whether the Cas9/gRNA complexes could remove the disease-causing allele from the genome, as gRNAs 1-4 all had editing efficiencies above 50% despite being between 900 and 5000 bp away from the mutation (Fig 4G, 4K). As such, the skilled artisan would have not been deterred from choosing two guide RNAs that could potentially remove many of the of CMC-associated dominant STAT1 mutations in the coiled-coil domain.
Applicant argues that the skilled artisan would not have chosen specifically to target M202V since there are more than 100 mutations associated with CMC (page 16, ¶1). This argument has been fully considered but is not persuasive because Mizoguchi specifically teaches the M202V mutation is causative of CMC.
Applicant argues that it was only with hindsight that the skilled artisan would choose SEQ ID NOs 35795 and 29664 out of the thousands of possible options for targeting using CRISPR editing (page 16, ¶2). This argument has been fully considered but is not persuasive. First, even though there are “thousands” of possible targets, the thousands of options are still a finite number of identified predictable solutions. The design principles of Cas9 guide RNAs are well know in the art as evidenced by Davidson. The guide sequence must be present upstream of a 5’-NRG PAM sequence for SpCas9. There is a 1/20 chance that any 20-mer will be upstream of an NRG sequence, thus limiting the thousands of possibilities. Additionally, Davidson teaches that the method requires at least one guide sequence to specifically target a SNP that alters a non-PAM sequence into a PAM-generating sequence, and for the SNP to be present in at least 5% of the population, limiting the possible targeting sequences even more. PAM-generating SpCas9 mutations are formed from an A/C/T>G mutation that is 3’ of an A or G nucleotide or a C/T>A mutation that is 5’ of an A nucleotide. From a cursory review of the known SNPs in the 750 bp Intron 3, Examiner found ~60 SNPs that would generate an SpCas9 PAM sequence. However, in a random pick of 5 PAM-generating SNPs in STAT1 intron 3 (rs2470569649, rs1694975751, rs1694972307, rs1393906031 and rs2470566466), none of the PAM-generating alleles had an MAF of above even 1%, let alone 5% as required in Davidson’s method. Thus, there are actually much fewer than “thousands” of guide sequences within introns that generate a Cas9 PAM sequence and have an MAF above 5% as instructed by Davidson, from which to choose from to delete the CMC-associated M202V allele. As for the guide RNA that targets both alleles, it is necessary to find an SpCas9 PAM sequence that does not have any discovered SNPs that could potentially destroy the PAM sequence. Another cursory review of the 750-bp Intron3 found about half the SpCas9 PAM sequences would be destroyed by a SNP previously known in the art. Thus, it is evident from the available STAT1 genetic resources that upon using the known guide RNA design principles to filter possible targeting sequences, the number of possible guide RNA sequences is finite, and each of the possible guide RNA sequences would be identified as a possible solution when applying Davidson’s method for inactivating a dominant, CMC-associated STAT1 allele.
Applicant argues that one of ordinary skill in the art would not have a reasonable expectation of success of using the claimed guide RNA sequence because whether a particular guide RNA will actually edit a target location in combination with a CRISPR nuclease is highly unpredictable, depending on multiple factors, many of which are not understood (page 16, ¶3). This argument has been fully considered but is not persuasive. First it is merely argument of counsel without evidence. MPEP 716.01(c) makes clear that arguments of counsel cannot take the place of evidence in the record. Second, by February 2020, there were multiple, free, readily available, online gRNA design and analysis tools. Examiner used one such tool from Integrated DNA Technologies (IDT) to choose guide sequences within STAT1, Intron 3 (Custom Alt-R CIRPSRP-Cas9 guide RNA, Integrated DNA Technologies, https://www.idtdna.com/site/order/designtool/index/CRISPR_CUSTOM, [retrieved 10/17/2025]). A target sequence for SEQ ID NO 35795 was one result from the design tool and it had an on-target score of 84/100, which was the second highest on-target score. Thus, based on the readily available on-line tools, the skilled artisan would have a reasonable prediction that SEQ ID NO 35795 would be able to target and cleave Intron 3 of the STAT1 gene and be used when applying Davidson’s method of dominant-allele removal to the CMC-associated dominant alleles in STAT1.
Conclusion
No claims are allowable.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Examiner, Art Unit 1635