DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant elected SEQ ID NO: 9 (shmiR13) and SEQ ID NO: 13 (shmiR17) in claim 12; SEQ ID NOs: 30-31 (shmiR13) and SEQ ID NOs: 38-39 (shmiR17) in claims 19, 22, 24, 25, and 34.
The non-elected sequences in claim 12 (e.g., SEQ ID NOs: 1-8 and 10-12) and claims 13, 19 and 22 (e.g., SEQ ID NOs: 14-29 and 32-37) remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 1/28/25.
Drawings
The drawings were received on 8/18/25. These drawings are acceptable.
Information Disclosure Statement
The IDS filed on 8/15/25 lists documents that were already cited by the Office on a PTO-892 and are considered duplicates.
Specification
The disclosure remains objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
The amendment to the specification filed on 8/18/25 addresses one hyperlink in section 9.6, but does not adder the hyperlink in the same section 9.6 (the hyperlink for Vector biolabs).
Claim Objections
Claim 1 is objected to because of the following informalities: the phrase ‘comprising any four or more’ is incomplete because there is no nexus between the phrase and the amino acids at certain positions of the VP1 sequence. Appropriate correction is required. Claims 6, 8, 10, 12-15, 18-19, 22, 25, and 27-36 are also objected to because they depend on claim 1.
A response was filed on 8/18/25 and a supplemental response was filed on 10/23/25. The response filed on 10/23/25 provided a response to the 35 CFR 1.105 request that was missing from the response filed on 8/18/25.
The response filed on 8/18/25 has an amendment to the claims and the applicant’s arguments to the rejections in the non-final rejection mailed on 5/16/25.
Response to 35 CFR 1.105 request
The response to the 37 CFR 1.105 filed on 10/23/25 is discussed below:
BB-301: A Single "Silence and Replace" AAV-Based Vector for the Treatment of Oculopharyngeal Muscular Dystrophy (OPMD) The 21st Annual Meeting of the American Society of Gene and Cell Therapy (ASGCT), Chicago, June 2018, retrieved on-line 4/17/25, benitec.com/our-programs/presentations-and- publications, 19 pages (ASGCT2018).
With respect to ASGCT, 2018, page 3 of the response discloses that multiple versions of the modified AAV9 having slightly different combinations of phospholipase (PLA2) domain of the VP1 were produced (including mutations embrace by the instant claims). Applicant’s representative states that it was unclear which version of BB-301 is being discussed in the presentation. In addition, the response indicates that the PABPN construct comprises instant SEQ ID NO: 73. In addition, the PABPN shRNAs read on instant SEQ ID NOs: 38 (shRNA1; shmiR17) and 39 (shmiR17) and stem loop comprising SEQ ID NO: 40. The sequence for shRNA2 reads on instant SEQ ID NO: 30 and 31.
Towards Development of a 'Silence and Replace' Based Approach for the Treatment of Oculopharyngeal Muscular Dystrophy. Joint 10th AGCST and ASSCR Scientific Meeting, Sydney May 25, 2017, retrieved online 4/17/25, 25 pages,benitec.com/our-programs/presentations-and-publications (AGCST2017).
With respect to ASGCT 2017, page 4 of the response indicates that on page 16, applicant has packaged components of “silence and replace” construct into separate wild type AAV8 and AAV9 vectors for the purpose of introduction in A17 mice. NOTE: the reference does not appear to discloses that the BB-301 is an AAV having a modified viral capsid from AAV9 set forth in the instant claims.
NOTE: applicant comments that the information the Examiner requested was neither "described" in the presentation slides or known to be otherwise available to the public is moot because the statements for each prior art reference indicate that the shmiRs or a PABPN1 disclosed in the slides would inherently have a sequence recited in the instant claims. The sequence itself is an inherent property of the prior art AAVs, and “there is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the relevant time, but only that the subject matter is in fact inherent in the prior art reference.” See MPEP 2112(II).
Response to Arguments
Applicant's arguments filed 8/18/25, pages 15-16, with respect to the 103 rejection have been fully considered and are found partially persuasive.
Applicant argues that both WO ‘228 and WO ‘630 are applications filed by the applicants of the instant invention and both inventors are listed on both WO documents and are not prior art under 102(a)(2) at least due to same inventive entity and common ownership.
The instant application lists four inventors: 1) Strings-Ufombahl; Vanessa; 2) Suhy, David; 3) Kao, Shih-Chu; and 4) Roelvink, Petrus W.
‘630 listed 1) Strings-Ufombah, Vanessa; 3) Koa, Shih-Chu; and 4) Roelvink, Petrus.
‘228 listed 1) Strings-Ufombah, Vanessa; and 2) Suhy David.
Following the guidelines in the MPEP 2155 for determining if a reference qualifies for a 102(a)(1) or (2) reference, ‘228 and ‘630 do not qualify as prior art because the inventive entity/authors of the reference only include a subset of the inventive entity of the application. The 102(b)(1)(A) or 102(b)(2)(A) exception applies for ‘228.
Upon further consideration, a new ground(s) of rejection is made in view of the amendment to claim 1 and 33 and the response to the 37 CFR 1.1105.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1-6, 8, 10, 12-15, 18-19, 22, 25, and 27-36 are rejected under 35 U.S.C. 103 as being unpatentable over BB-301: A Single "Silence and Replace" AAV-Based Vector for the Treatment of Oculopharyngeal Muscular Dystrophy (OPMD) The 21st Annual Meeting of the American Society of Gene and Cell Therapy (ASGCT), Chicago, June 2018, retrieved on-line 4/17/25, benitec.com/our-programs/presentations-and- publications, 19 pages (ASGCT2018).
NOTE: pages 3-4 of applicant’s response filed on 10/23/25 provides statements for the request made under 37 CFR 1.105 for the teaching in the ASGCT 2018 publication that is hereby incorporated herein.
Page 7 of ASGCT2018 discloses a modified AAV9 vector (BB-301) comprising a construct comprising a codon-optimized cDNA sequence encoding wildtype PABPN1 protein and DNA sequence encoding two shRNAs for targeting the mRNA transcript of PABPN1, wherein the shRNAs are expressed within a miRNA backbone, wherein the vector is used for treating OPMD. The construct comprises a Spc512 muscle-specific promoter.
As stated in the response to the 1.105 filed on 10/23/25:
The nucleotide sequence for the coding optimized wildtype PABPN1 is set forth in instant SEQ ID NO: 73.
The nucleotide sequences for the PAPBN1 shRNAs designated shRNA1 and shRNA2 on slides 7, 11 and 13 of the ASGCT, 2018 presentation are as follows: shRNA1 (5' - 3'): AGGUAGAGAAGCAGAUGAAUACUGUGAAGCAGAUGGGUAUUCAUCUGCUU CUCUACCUC
shRNA2 (5' - 3'): CGACAUCAUGGUAUUCCCCUACUGUGAAGCAGAUGGGUAGGGGAAUACCA UGAUGUCGC.
The shRNA reads on instant claims comprising shmiR17 (SEQ ID NOs: 38 and 39, SEQ ID NO: 13), stem loop SEQ ID NO: 40 and shmiR13 (SEQ ID NOs: 30 and 31, SEQ ID NO: 9).
Pages 8-9 disclose AAV transduction of muscle of a murine model of OPMD by local injection.
Page 16 disclose using a modified AAV capsid for the generation of highly active BB-301 particles.
As indicated in the applicant’s response to the 37 CFR 1.105: The modified AAV9 capsid protein is made by introduction of site-specific amino acid substitutions within the phospholipase (PLA2) domain of the VP1. In the course of developing BB-301, Applicant has produced multiple versions of modified AAV9 having slightly different combinations of PLA2 mutations. One version of BB-301 includes an AAV9 with a capsid protein modified to comprise a serine at position 1, a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, and a serine at position 44 relative to the corresponding wildtype AAV9 subsequence set forth in SEQ ID NO: 87 of the present application. Another version of BB-301 includes an AAV9 with a capsid protein modified to comprise a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, and a serine at position 44 relative to the corresponding wildtype AAV9 subsequence set forth in SEQ ID NO: 87 of the present application.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to make and use the claimed AAV vector to deliver a composition comprising a polynucleotide comprising a ddRNAi construct comprising a nucleic acid comprising a shmiR and a promoter operably linked to a PABPN1 nucleic acid having a sequence that is not targeted by the shmiR and a pharmaceutical acceptable carrier, namely to arrive at the claimed invention. ASGCT2018 teaching making and using an AAV9 with a modified VP1 sequence to deliver the composition to a subject in need thereof. ASGCT2018 teaches that AAV vectors have ITRs and can flank a nucleotide sequence. One of ordinary skill in the art would have been motivated to alter the order to comprise the PABPN1 construct and the ddRNAi construct in a 5' to 3' direction for the benefit of determining whether the placement order within the construct makes it more or less effective.
With respect to the limitation directed to an AAV comprising a viral capsid protein comprising a modified VP1 sequence comprising four or more substitutions at positions, 1, 26, 40, 43, 44 and/or 64 in the instant claims, as indicated in the applicant’s response to the 37 CFR 1.105: The modified AAV9 capsid protein is made by introduction of site-specific amino acid substitutions within the phospholipase (PLA2) domain of the VP1. In the course of developing BB-301, Applicant has produced multiple versions of modified AAV9 having slightly different combinations of PLA2 mutations. One version of BB-301 includes an AAV9 with a capsid protein modified to comprise a serine at position 1, a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, and a serine at position 44 relative to the corresponding wildtype AAV9 subsequence set forth in SEQ ID NO: 87 of the present application. Another version of BB-301 includes an AAV9 with a capsid protein modified to comprise a glutamic acid at position 26, an arginine at position 40, an aspartic acid at position 43, and a serine at position 44 relative to the corresponding wildtype AAV9 subsequence set forth in SEQ ID NO: 87 of the present application. Thus, it appears that the sequence of the claimed AAV is inherent in the BB301 disclosed in ASGCT2018. The sequence itself is an inherent property of the prior art AAVs, and “there is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the relevant time, but only that the subject matter is in fact inherent in the prior art reference.” See MPEP 2112(II).
In addition, in view of the statements in the response to the 1.105 request, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of their claimed product. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
ASGCT2018 makes obvious the composition comprising the ddRNAi and PABPN1 construct. The shmiR comprising SEQ ID NOs: 30-31 and 38-39 or an effector sequence is substantially complementary to a region of corresponding length in an RNA transcript set forth in SEQ ID NO: 9 or 13 are inherent in the AAV taught by ASGCT2018. The sequence itself is an inherent property of the constructs of the prior art AAVs, and “there is no requirement that a person of ordinary skill in the art would have recognized the inherent disclosure at the relevant time, but only that the subject matter is in fact inherent in the prior art reference.” See MPEP 2112(II).
Pages 8-9 of ASGCT2018 disclose AAV transduction of muscle of a murine model of OPMD by local injection. Since OPMD is associated with a pharyngeal muscle of a subject (swallowing), it would have been obvious to one of ordinary skill in the art to try directly administering a composition comprising the AAV to a pharyngeal muscle to assure delivery of the AAV to the targeted area. In addition, one of ordinary skill in the art would possess the knowledge that the pharyngeal muscle comprises the muscle recited in claim 30. See MPEP 2141(II)(C) “Prior art is not limited to the references being applied, but includes the understanding of one of ordinary skill in the art.” In addition, instant claim 30 is directed to a ‘wherein’ clause that does not add any additional material and/or methods steps required to made obvious by the prior art.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
The relevant prior art is discussed below:
Towards Development of a 'Silence and Replace' Based Approach for the Treatment of Oculopharyngeal Muscular Dystrophy. Joint 10th AGCST and ASSCR Scientific Meeting, Sydney May 25, 2017, retrieved online 4/17/25, 25 pages,benitec.com/our-programs/presentations-and-publications (AGCST2017, 5/25/17).
AGCST2017 discloses using intramuscular administration of AAV (BB-301) to treat OPMD (page 3). The technology is labeled DNA-directed RNAi (ddRNAi), which combines RNA interference with gene therapy delivery. The technology results in silence/replace strategies of mutant proteins. See pages 4-5.
PNG
media_image1.png
127
872
media_image1.png
Greyscale
The REP/CAP are removed from a wildtype AAV and replaced with an expression cassette (page 13). The cassette comprises a muscle specific promoter operably linked to a codon optimized wildtype PABPN1 and two PABPN1 shRNAs.
An AAV(s) was administered to a murine model of OPMD. AAV8-PABPN1-shRNA(3x) and/or AAV9 comprising an optimized wild type PABPN1 sequence was administered to the model.
NOTE: pages 2-3 of applicant’s response filed on 10/23/25 provides statements for the request made under 37 CFR 1.105 for the teaching in the publication that is hereby incorporated herein.
The nucleotide sequence for the codon-optimized cDNA sequence encoding wildtype PABPN1 is set forth in SEQ ID NO: 73.
The nucleotide sequences for the PAPBN1 shRNAs designated shRNA1, shRNA2 and shRNA3 in the AGCST/ASSCR, 2017 presentation are as follows:
shRNA1:GAGGAGAAGAUGGAGGCUGAUCAAGAGAAUCAGCCUCCAUCUUCUCCUC
shRNA2: GGAAGAAGCUGAGAAGCUAACAAGAGAUUAGCUUCUCAGCUUCUUCC shRNA3:GAGGUAGAGAAGCAGAUGAAUAUGAGUUCAAGAGACUCAUAUUCAUCUGGUUCUCUACCUC; instant SEQ ID NO: 16/17 (shmiR3, SEQ ID NO: 2) and SEQ ID NO: 38/39 (shmiR17, SEQ ID NO: 13).
Page 24 disclose that only a combined approach efficiently restores function. A single vector approach simplified the Chemistry, Manufacturing, and Controls (CMC) approach for clinical materials.
AGCST2017 does not specifically teach making and using the shRNA3x and optPABPN1 in the claimed AAV having a modified VP1 protein.
Malerba et al. (Nature Communications 8, 184848, pages 1-13, 2017, cited on an IDS, and Supplemental Information, pages 1-11).
Malerba show treatment of a mouse model of OPMD with an AAV combining complete knockdown of endogenous PABPN1 and its replacement by a wild-type PABPN1 (pages 1-13). ddRNAi were known in the prior art and were used in the treatment method (pages 2 and 7). AAV vectors comprising ddRNAi (shRNA) or codon-optimized PABPN1 sequence under control of the muscle-specific promoter SPc5-12 promoter was used in the method (page 2). Malerba contemplates a single bicistronic construct could be made and tested since it would reduce the cost and efforts associated with large scale production of two AAV vectors (page 11).
Supplementary Note 1 of Malerba shows the nucleotide sequence for shRNA3X.
PNG
media_image2.png
562
667
media_image2.png
Greyscale
The shRNA in the construct appear to read on sequences set forth in the instant claims (shRNA1: SEQ ID NOs: 34/35 (shmiR15); shRNA2: SEQ ID NOs: 36/37 (shmiR16) and shRNA3: SEQ ID NOs: 16/17 (shmiR3).
In addition, a codon optimized human PABPN1 sequence is taught by Malerba (which appears to read on instant SEQ ID NO: 73).
While Malerba teaches AAV-shRNA3x alone or in combination with AAV-optPABPN1 significantly inhibited the endogenous PABPN1 and that the effect was consistent in all treated muscles.
Malerba does not specifically making and using the shRNA3x and optPABPN1 in the claimed AAV having a modified VP1 protein.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636