DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on July 29, 2025 has been entered.
Status of Claims / Response to Amendment
This office action is in response to an amendment filed on July 29, 2025.
Claims 1-17 were previously pending. Applicant amended claims 1, 3 and 11.
Claims 1-17 are currently pending, with claims 13-17 withdrawn.
Claims 1-12 are under examination.
Applicant's claim amendments overcame the following objection and rejections:
Objection to claim 1;
Rejections of claims 1-12 under 35 U.S.C. 101;
Rejections of claims 1-12 under 35 U.S.C. 103 as being unpatentable over Moon, as evidenced by Yoshida, in view of Kerkhof.
Applicant' s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
This office action contains new grounds for rejection necessitated by amendment.
Priority
The priority date of the instant claims 1-12 is March 04, 2019, filling date of the UNITED KINGDOM Patent Application Number 1902887.7, to which the present application claims priority.
Response to Arguments
Applicant's arguments filed on July 29, 2025 have been fully considered.
Declaration under 37 CFR § 1.132: Applicant submits a Declaration under 37 CFR § 1.132 from Professor Tariq Sadiq ("Sadiq Declaration"), which have been fully considered.
The Sadiq Declaration begins by summarizing Professor Tariq1's professional experience as both professor and physician in the Institute for Infection and Immunity at City St George's, University of London. (para. 1) It then describes the existing methods for microorganism identification and profiling at the time of filling (March 04, 2019), including short-read sequencing and probe-based methods (para.3), and specifically highlighting disadvantages associated with probe-based methods (para. 4-10).
The Sadiq Declaration further discusses the advantages of long-read sequencing, such as increased sensitivity and reduced false positive or false negative results (para. 11-14).
The Sadiq Declaration concludes by attributing these advantages to the inherent features of long-read sequencing:
"All of the advantages I have described are common to all long read sequencing
techniques, as they result from features which are inherent to all long read sequencing: the fact that sequencing does not require the use of a probe to characterise the sequence, and the ability of long read sequencing to characterise extended nucleic acid sequences, in contrast to the short sequences which could be characterised by probes." (para. 14) [emphasis added]
However, this Sadiq Declaration under 37 CFR 1.132 is insufficient to overcome any rejections of instant claims in this application because:
First, the Sadiq Declaration focuses solely on the potential improvement that long-read sequencing may offer to existing probe-based methods. The principal issue is that the arguments seem to address a specific aspect of the invention (long-form sequencing) rather than focusing specifically on the individual claims in the current application. As such the declarations is not commensurate in scope with the claims. See MPEP § 716.
Even more, long-read sequencing had expected advantages and results; Applicants fail to demonstrate unexpected results.
Moreover, it is important to note that declarations submitted under 37 CFR 1.132 are for presenting new evidence or data, such as experimental data as supporting evidence of unexpected results, see MPEP §716.01(c), rather than providing inventor's opinion.
Here, the Sadiq Declaration lacks objective evidence to support the declarant's statements. It provides no supporting data or references to substantiate the state of the art regarding the availability of established methods at the time of filling, the stated disadvantages of probe-based methods, or the proposed advantages of long-read sequencing, such as improved sensitivity and reduced false positives and false negatives.
Further, MPEP states in 716.02 (e):
An affidavit or declaration under 37 CFR 1.132 must compare the claimed subject matter with the closest prior art to be effective to rebut a prima facie case of obviousness. In re Burckel, 592 F.2d 1175, 201 USPQ 67 (CCPA 1979). “A comparison of the claimed invention with the disclosure of each cited reference to determine the number of claim limitations in common with each reference, bearing in mind the relative importance of particular limitations, will usually yield the closest single prior art reference.” In re Merchant, 575 F.2d 865, 868, 197 USPQ 785, 787 (CCPA 1978) (emphasis in original). Where the comparison is not identical with the reference disclosure, deviations therefrom should be explained, In re Finley, 174 F.2d 130, 81 USPQ 383 (CCPA 1949), and if not explained should be noted and evaluated, and if significant, explanation should be required. In re Armstrong, 280 F.2d 132, 126 USPQ 281 (CCPA 1960) (deviations from example were inconsequential). [emphasis added]
In conclusion, while the applicant's arguments and declaration have been thoroughly considered, they are not persuasive. The applicant is encouraged to provide focused arguments on the claimed features and limitations, regarding specific claims, in response to this Office Action.
The 103 rejections of claims 1-12 over Moon, in view of Kerkhof , evidenced by Yoshia has been withdrawn in view of the recent claim amendment filed on July 29, 2025, which changed the scope of the claims in ways that are not addressed in the previous rejections.
Regarding the prior art references cited in the previous office action, Applicant's arguments have been fully considered but are not found persuasive, because those arguments regarding the 103 obviousness rejection consider each reference individually rather than addressing the combination of references as presented in the previous office action.
In the Remarks, Applicant argues that claim 1 is not obvious because Moon does not teach "using a single gene to detect an antimicrobial resistant microorganism."
Despite Moon's explicit teaching of single PCR reactions, Applicant insists that "this does not mean that only a single gene is amplified," as any number of single PCR reactions can be carried out in parallel multiple genes. (Remarks, page 7)
This argument is not persuasive. Moon teaches and suggests the limitation "conducting targeted amplification of a single gene from the microorganism in the absence of amplification of any additional gene from the microorganism," in multiple sections in the reference, as discussed in detail in the § 103 rejection section below.
Further, Applicant's argument appears to attempt to distinguish between methods performing individual, separate amplification reactions of single-gene targets (in which parallel amplification is encompassed) and methods that amplify only a single gene as a whole (in which parallel amplification is excluded). This distinction raises concerns regarding the scope of the claimed invention, as the application's own disclosure only shows performing single gene PCR reactions in parallel (entire document, see Figs 3 and 4 for examples). Example 8 (specification, page 8) also describes "single gene" amplifications performed in parallel, with multiple targets, followed by sequencing.
Example 7 (specification, page 17-18) describes sequencing results from PCR amplification of two microorganism genes (gyrA and parC), yet states, "[t]his clearly demonstrated that using a targeted PCR on a single gene responsible for antibiotic resistance can allow for the pathogen to be identified and its antibiotic resistance profile determined simultaneously." This creates additional ambiguity.
Such inconsistency raises indefiniteness issues regarding the metes and bounds of the claimed invention, as discussed in detail in the §112(b) section below.
Applicant is reminded that one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. In reKeller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In reMerck & Co., Inc., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). Where a rejection of a claim is based on two or more references, a reply that is limited to what a subset of the applied references teaches or fails to teach, or that fails to address the combined teaching of the applied references may be considered to be an argument that attacks the reference(s) individually. Where an applicant’s reply establishes that each of the applied references fails to teach a limitation and addresses the combined teachings and/or suggestions of the applied prior art, the reply as a whole does not attack the references individually as the phrase is used in Keller and reliance on Keller would not be appropriate. This is because “[T]he test for obviousness is what the combined teachings of the references would have suggested to [a PHOSITA].” In re Mouttet, 686 F.3d 1322, 1333, 103 USPQ2d 1219, 1226 (Fed. Cir. 2012).
In this instant case, Applicant's arguments fail to address the combined teachings of Moon and Kerkhof, presented in the Final Office Action. Therefore, this argument approach is not sufficient in responding to the grounds of rejection based on combined teachings of the art.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purposes of applying prior art, claim 1 recites "wherein the single gene is responsible for antimicrobial resistance and can identify the microorganism." Applicant's disclosure does not define a gene that "can identify the microorganism." Page 9 of the specification provides the following description:
“The gene is also capable of identifying the microorganism. In other words, the sequence of the gene is specific to a particular microorganism. Sequencing of the gene thus allows for the microorganism to be identified, provided that a sufficient length of the gene, preferably equal to or larger than 500 bp, is sequenced to distinguish over related sequences from other microorganisms."
Thus, in light of the specification and under BRI, a gene that "can identify the microorganism" is interpreted to mean a gene possessing a level of nucleotide sequence specificity toward a certain microorganism.
Claim Rejections - 35 USC § 112(b) -- New
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-12 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites "conducting targeted amplification of a single gene from the microorganism in the absence of amplification of any additional gene from the microorganism." this limitation is indefinite.
The specification does not clearly define or specifically describe what is meant by conducting targeted amplification of a gene from a specific microorganism "in the absence of amplification of any additional gene from the microorganism."
None of the provided examples in the disclosure clearly meet this description. It is unclear whether this encompasses method steps performing individual, separate amplification reactions of single-gene targets (described as "singlex" PCR in the application's disclosure, see page 21 for example), in which parallel amplification in separate amplification reactions is encompassed, as shown in Fig. 4 of the application's disclosure. Or, whether it is intended to claim a narrower scope in which only a single gene is amplified in the entire method (parallel amplification excluded).
It is further unclear whether this limitation encompasses a method that amplifies a single gene from the microorganism while also amplifying a second gene from a different organism, as shown in Fig. 3, lane 7 (amplifying Omp1 gene from Chlamydia trachomatis and 23 S gene from Mycoplasma genitalium 2), as such amplification appear to meet the description "in the absence of amplification of any additional gene from the microorganism," because the two genes are from two different microorganisms.
Accordingly, the metes and bounds of the claimed invention is unclear, and the scope of the claim is indefinite.
For the purpose of compact prosecution and applying prior art under 35 USC§ 102 and 103, this limitation "conducting targeted amplification of a single gene from the microorganism in the absence of amplification of any additional gene from the microorganism" is interpreted to encompass individual, separate amplification reaction of single-gene targets, in which a single gene amplification reaction in parallel amplification is encompassed. Also encompassed is amplification of additional genes from different organisms within the same amplification reaction.
Claims 2-12 are rejected for depending from claim1 and not remedying the indefiniteness.
Applicant is invited to unambiguously identify any specialized definitions in the subsequent response to the instant action. Applicant is advised that a specialized definition should be properly supported and specifically identified (see, e.g., MPEP § 2111.01(IV), describing how Applicant may act as their own lexicographer).
Claim Rejections - 35 USC § 112(a) -- New
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
Claims 1-12 are rejected under 35 U.S.C. 112(a) as failing to comply with the written description requirement. The claims contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claim 1 recites "an antimicrobial resistant microorganism" comprising a gene "responsible for antimicrobial resistance and can identify the microorganism," but the applicant's disclosure lacks sufficient detail to demonstrate possession of the invention, as required under 35 U.S.C. 112(a).
First, the claim broadly claims a genus of antimicrobial resistant microorganism comprising a gene "responsible for antimicrobial resistance and can identify the microorganism," using functional language only. “The specification must demonstrate that the applicant has made a generic invention that achieves the claimed result and do so by showing that the applicant has invented species sufficient to support a claim to the functionally-defined genus.” Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d. at 1349. A “sufficient description of a genus instead requires the disclosure of either a representative number of species falling within the scope of the genus or structural features common to the members of the genus so that one of skill in the art can ‘visualize or recognize’ the members of the genus.” Ariad Pharms., 598 F.3d at 1350.
In this instant case, the disclosure identifies four microorganisms as species encompassed by the genus of antimicrobial-resist microorganism (see background of the invention at page 1). However, it does not provide any description regarding common structural features shared by all species in the claimed genus. Instead the disclosed species possess different antimicrobial resistance genes (see Example 2 at page 13-14). As such, a person skilled in the art would not be able to ‘visualize or recognize’ the members of the genus.
Second, by attempting to claim all antimicrobial resistant microorganisms, without identifying any specific, shared structural characteristics among all species in this genus, the claim extends beyond the disclosed invention, constituting a "reach-through claim." Such language improperly seeks to claim all antimicrobial resistant microorganism known and unknown at the time of the invention, thus failing to meet the written description requirement of 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph.
Accordingly to MPEP 2163 (written description requirement), the specification must clearly demonstrate that the inventor was in possession of the claimed invention at the time of filling. A claim that encompass all antimicrobial resistant microorganisms, including those resistant to antimicrobials not yet developed at the time of filling, fails to meet this requirement.
Therefore, the application's disclosure does not meet the written description requirement under 35 U.S.C. 112(a), for there is insufficient disclosure that convey to a person skilled in the art that the inventor was in possession of the full breadth of the claim at the time of filling.
Claims 2-12 are rejected because they depend from claim 1 and inherit the deficiencies of the base claim.
Claim Rejections - 35 USC § 101 -- New
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-12 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more.
Independent claim 1 has been amended to recite:
A method for detecting an antimicrobial resistant microorganism, comprising:
(a) preparing DNA from a sample comprising the microorganism;
(b) conducting targeted amplification of a single gene from the microorganism in the absence of amplification of any additional gene from the microorganism,
wherein the single gene is responsible for antimicrobial resistance and can identify the microorganism, resulting in the production of amplified products;
(c) sequencing the amplified products obtained in step (b) using long-read sequencing, resulting in sequences of the amplified products; and
(d) identifying the antimicrobial resistant microorganism based on the sequences of the amplified products.
MPEP §2106.II on Patent Subject Matter Eligibility states : "It is essential that the broadest reasonable interpretation (BRI) of the claim be established prior to examining a claim for eligibility."
Under BRI, claim 1 is drawn to a method comprising steps of obtaining sequence information of a gene in a microorganism, and identifying the microorganism based on the gene sequence.
Following the analysis below the claims are not patent eligible under 35 U.S.C. 101.
Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to a method, therefore to one of the of statutory categories.
Step 2A
According to MPEP § 2106, Step 2A is a two-prong inquiry, in which examiners determine in Prong One whether a claim recites a judicial exception, and if so, then determine in Prong Two if the recited judicial exception is integrated into a practical application of that exception. Together, these prongs represent the first part of the Alice/Mayo test, which determines whether a claim is directed to a judicial exception.
Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes. The claims relies on the natural correlation of a gene and a microorganism having this gene, which is a naturally occurring relationship. As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature. An organism naturally possesses a gene, and the gene itself is classified as naturally occurring principles/relations.
Claim 1 is broadly written without specifying any genes or microorganism, thus it effectively seeks to monopolize the natural correlation between certain genes and any microorganism, which is a judicial exception excluded from patentability because “monopolization of those tools through the grant of a patent might tend to impede innovation more than it would tend to promote it.” Alice Corp., 573 U.S. at 216, 110 USPQ2d at 1980 (quoting Myriad, 569 U.S. at 589, 106 USPQ2d at 1978 and Mayo Collaborative Servs. v. Prometheus Labs. Inc., 566 U.S. 66, 71, 101 USPQ2d 1961, 1965 (2012)).
In conclusion, the claims recite laws of nature and natural phenomena.
Step 2A Prong 2 - Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim as a whole do not integrate the exception into a practical application of that exception.
For a claim reciting a judicial exception to be eligible, the additional elements (if any) in the claim must “transform the nature of the claim” into a patent-eligible application of the judicial exception, Alice Corp., 573 U.S. at 217, 110 USPQ2d at 1981.
The additional elements in the claim do not transform the claimed natural correlation to something that are markedly different than their naturally occurring counterparts in their natural state, nor does it integrate the recited judicial exception into a practical application of the exception. Antibiotic resistance is a naturally occurring property, therefore it cannot transform the judicial exception into a practical application. Mere combination of natural elements does not affect a change to any of the natural elements from their natural functions. See Funk Bros. Seed v. Kalo Inoculant Co., 333 U.S. 127 (1948).
Per MPEP §2106.04(d):
“Limitations the courts have found indicative that an additional element (or combination of elements) may have integrated the exception into a practical application include:
• • An improvement in the functioning of a computer, or an improvement to other technology or technical field, as discussed in MPEP §§ 2106.04(d)(1) and 2106.05(a);
• • Applying or using a judicial exception to effect a particular treatment or prophylaxis for a disease or medical condition, as discussed in MPEP § 2106.04(d)(2);
• • Implementing a judicial exception with, or using a judicial exception in conjunction with, a particular machine or manufacture that is integral to the claim, as discussed in MPEP § 2106.05(b);
• • Effecting a transformation or reduction of a particular article to a different state or thing, as discussed in MPEP § 2106.05(c); and
• • Applying or using the judicial exception in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological environment, such that the claim as a whole is more than a drafting effort designed to monopolize the exception, as discussed in MPEP § 2106.05(e).
The courts have also identified limitations that did not integrate a judicial exception into a practical application:
• • Merely reciting the words "apply it" (or an equivalent) with the judicial exception, or merely including instructions to implement an abstract idea on a computer, or merely using a computer as a tool to perform an abstract idea, as discussed in MPEP § 2106.05(f);
• • Adding insignificant extra-solution activity to the judicial exception, as discussed in MPEP § 2106.05(g); and
• • Generally linking the use of a judicial exception to a particular technological environment or field of use, as discussed in MPEP § 2106.05(h).”
The steps recited in the claim merely applies the judicial exception in the field of molecular microbiology for purpose of identifying microorganism, therefore these language merely indicate a field of use or technological environment in which to apply a judicial exception. See MPEP 2106.05(h) and 2106.04(d).
The claims recite steps of preparing DNA from a sample (which is an insignificant extra-solution activity); conducting DNA amplification of antimicrobial resistance gene of a microorganism; sequencing; identifying and the microorganism based on its gene sequence. However, these claimed steps stop at identifying the microorganism based on its genetic marker. The claims do not recite any further step that applies or uses the identified information in some other meaningful way beyond generally linking the use of the judicial exception to a particular technological environment, such as a treatment step directed to the correlative relationship between the identified microorganism and its antimicrobial resistance gene.
Additionally, it is notable that mere physicality or tangibility of an additional element or elements, such as steps of DNA amplification, sequencing and analysis, are not relevant considerations in Step 2A Prong Two. As the Supreme Court explained in Alice Corp., mere physical or tangible implementation of an exception does not guarantee eligibility. Alice Corp. Pty. Ltd. v. CLS Bank Int’l, 573 U.S. 208, 224, 110 USPQ2d 1976, 1983-84 (2014) ("The fact that a computer ‘necessarily exist[s] in the physical, rather than purely conceptual, realm,’ is beside the point"). See also Genetic Technologies Ltd. v. Merial LLC, 818 F.3d 1369, 1377, 118 USPQ2d 1541, 1547 (Fed. Cir. 2016) (steps of DNA amplification and analysis are not "sufficient" to render claim 1 patent eligible merely because they are physical steps).
Step 2B - Whether a Claim Amounts to Significantly More: No.
According to MPEP§ 2106.05, The second part of the Alice/Mayo test is often referred to as a search for an inventive concept. Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 217, 110 USPQ2d 1976, 1981 (2014) (citing Mayo Collaborative Servs. v. Prometheus Labs., Inc., 566 U.S. 66, 71-72, 101 USPQ2d 1961, 1966 (2012)). An “inventive concept” is furnished by an element or combination of elements that is recited in the claim in addition to (beyond) the judicial exception, and is sufficient to ensure that the claim as a whole amounts to significantly more than the judicial exception itself. Alice Corp., 573 U.S. at 27-18, 110 USPQ2d at 1981 (citing Mayo, 566 U.S. at 72-73, 101 USPQ2d at 1966).
In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception. The claims do not appear to add markedly different characteristics that significantly modify or use the naturally occurring correlation in a manner that is not naturally occurring.
Claim 1 recites, in high level of generality, method steps comprising: preparing DNA; conducting targeted amplification of a gene of microorganism; sequencing amplification products using long-read sequencing; identifying the microorganism based on gene sequence. But these steps were well-known, routine, and conventional in the field of molecular microbiology (see Apte et al. US9663831B2- Method and system for microbiome analysis, teaches "nanopore sequencing" and "single-molecule real-time (SMRT) techniques" which are long form sequencing methods as sequencing methods known in the art; Published 2017-05-30;
Hayden, US9416409B2- Capture primers and capture sequence linked solid supports for molecular diagnostic tests; published 2016-08-16).
Long read-sequencing technologies, such as those developed by PacBio and Oxford Nanopore, had wide applications across various areas of research as early as 2015 (See Rhoads et al. PacBio Sequencing and Its Applications. Genomics Proteomics Bioinformatics. 2015 Oct;13(5):278-89. doi: 10.1016/j.gpb.2015.08.002. Epub 2015 Nov 2. PMID: 26542840; PMCID: PMC4678779). By that time, long-read sequencing technology was already a well-known and conventional sequencing method, as evidenced by the extensive review of the technology in 2015 (id. entire document, see Tables 1-2 for example) ꟷ years before the effective filling date in 2019.
The dependent claims do not recite additional elements that amount to significantly more than the judicial exception, as they represent mere general linkage of the judicial exception to the additional elements in the claims (MPEP § 2106.05(h)).
In conclusion, the claims are not patent eligible under 35 U.S.C. 101.
Claim Rejections - 35 USC § 103 -- New
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-12 are rejected under 35 U.S.C. 103 as being unpatentable over Moon (US20120004113A1 - Dna chip, kit for detecting or genotyping bacteria causing sexually transmitted diseases, genotyping antibacterial drug resistance and detecting or genotyping method using the same; Published on 2012-01-05),
in view of Kerkhof (Kerkhof et al. , Profiling bacterial communities by MinION sequencing of ribosomal operons. Microbiome 5, 116 (2017). doi.org/10.1186/s40168-017-0336-9).
A) Moon teaches methods for detecting microbes that cause sexually transmitted diseases, analyzing genotype and antibiotic resistance of microorganisms from a sample (entire document; Abstract).
Regarding claim 1, Moon teaches a method comprising:
(a) preparing DNA from a sample comprising the microorganism ([0063], lines8-9; [0140-0144]);
(b) conducting targeted amplification of a single gene from the microorganism in the absence of amplification of any additional gene from the microorganism ([0145]” PCR for Establishing Conditions of Single PCR,” lines 6-7 “single PCR on target genes for each microorganism was preformed”; [0148] “Single PCR on Clinical Sample”; [0054]; [0056]),
wherein the single gene is responsible for antimicrobial resistance and can identify the microorganism ([0156]; [00118]; [0119]lines1-9; [0117]; [0034] lines10-13), resulting in the production of amplified products;
(c) sequencing the amplified products obtained in step (b) ([0149]; [0063]line11); and
(d) identifying the antimicrobial resistant microorganism based on the sequences of the amplified products ([0156] lines1-3; [0158]).
Claim 1 has been amended with the new limitation “in the absence of amplification of any additional gene from the microorganism,” in a step conducting targeted amplification of a single gene from the microorganism. As noted above, this limitation is taught by Moon ([0145]; [0148]; [0054]; [0056])). Further elaboration is provided below for clarity of record.
Moon explicitly teaches amplifying a single gene, without any additional genes from the microorganism in [00145]:
“[0145] Artificial samples were made by adding plasmid clones of target genes, which were obtained in Example 2 for testing on each microorganism in multiple copies of 10, 100, 1,000 and 10,000, to sterilized triply distilled water, a sample storage solution of Example 3 and fresh urine (VB1) of a normal male without symptoms of infection. Then, single PCR on target genes for each microorganism was preformed repeatedly, thereby establishing conditions for the single PCR. When performing PCR, PCR of human beta-globin gene, which was an internal reference gene, was performed together. Moreover, in consideration of multiplex PCR afterwards, it was designed such that the size of each PCR product was distinctively different from each other, but that the annealing temperature had no big difference.”
Moon in para. [0148] additionally teaches performing Single PCR on Clinical Sample, followed by sequencing the PCR products (Example 7: Sequencing of PCR Products of Clinical Sample in [0149-0156]). Moon discloses performing single PCR as alternative to multiplex PCR ([0054]; [0056]), thus Moon suggests that in methods that utilize multiplex PCR, single PCR can also be applied to achieve the same objective and outcome.
Therefore, as evidenced by above, Moon teaches and suggests amplifying a single gene, without any additional genes from the microorganism.
Moon teaches most of the claim limitations. However, while Moon teaches sequencing, it does not specifically teach long-read sequencing.
B) Kerkhof teaches a method for bacteria profiling using long-read sequencing in the analysis of 16S rRNA and 23S rRNA genes (entire document).
Regarding claim 1, Kerkhof teaches sequencing amplified products using long-read sequencing (Abstract).
Kerkhof further suggests its long-read sequencing method has several benefits:
"This sequencing method represents a cost-effective way to profile microbial communities. Because the MinION is small, portable, and runs on a laptop, the possibility of microbiota characterization in the field or on robotic platforms becomes realistic.“ (Abstract)
C) It would have been prima facie obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to combine the method for detecting and analyzing microbes for antibiotic resistance of Moon with the teachings of using long-read sequencing from Kerkhof, because both references are in the same field of molecular microbiology, specifically focusing on sequencing methods for bacterial identification and profiling. A skilled artisan in the field of molecular microbiology would likely encounter both references in the search for improved methods for microbial detection and profiling.
The person of ordinary skill would have had a reasonable expectation of success in combining these teachings because Moon teaches amplifying target genes, such as 16S and 23S rRNA genes ([0079]; [0100] for examples) for sequencing, while Kerkhof also teach amplifying 16S and 23S rRNA genes (Abstract for example), while providing an improvement by using long-read sequencing. The significant overlap in genes of interest (i.e. both reference analyze 16S and 23S gene) and method approaches (i.e. both reference perform gene-specific amplification followed by sequencing) demonstrate technical compatibility.
Doing so would have yielded the predictable result of improved and highly flexible microbial detection and antibiotic resistance profiling, utilizing a portable, long-read sequencing device.
The skilled artisan would have been motivated to combine these teachings to enhance the overall efficiency and flexibility of microbial profiling methods, particularly given the advantages highlighted by Kerkhof, such as cost-effectiveness, portability, and the capability of performing detailed microbial analysis in diverse settings, including the field or on robotic platforms.
D) Regarding claim 2, Moon teaches swab sample ([0143]).
Regarding claim 3, Moon teaches the gene is amplified using PCR ([0145]; [0148]).
Regarding claim 4, Kerkhof teaches PCR with barcoded primers (page 9, left-hand col, lines17-23).
Regarding claim 5, Kerkhof teaches PCR amplicons are pooled and used to construct a sequencing library (page 9, left-hand col, lines43-48).
Regarding claim 6, Kerkhof teaches amplified products of step (b) are purified prior to sequencing (page 9, left-hand col, lines34-38).
Regarding claim 7, Kerkhof teaches nanopore sequencing (entire document; page 9, left-hand col, lines43-48).
Regarding claim 8, Moon teaches pathogenic bacteria ([0022] Mycoplasma genitalium; [0039]).
Regarding claim 9, Moon teaches microorganism that cause sexually transmitted infection ([0039]; [0148]line5).
Regarding claim 10, Moon teaches Mycoplasma genitalium ([0022];[0158]lines11-12; Table 2).
Regarding claim 11, Moon teaches Mycoplasma genitalium ([0022];[0158]lines11-12; Table 2), Kerkhof teaches analyzing 23S rRNA gene for long-read sequencing (Abstract).
Regarding claim 12, Moon teaches sample is obtained from a subject suspected of having an infection with a microorganism ([0119]lines15-16; [0148]).
Subject Matter Not Taught/Suggested in Prior Art
Claims 1-12 are currently rejected in this office action under 35 U.S.C. 103. While the claims as presently written are not patentable over prior art, they appear to relate to more detailed descriptions in the specification that disclose subject matter not taught by the prior art. For the purpose of compact prosecution, the examiner is highlighting this subject matter not taught by the prior art for applicant's consideration.
See Table 2, comprising amplification primers for 23S rRNA gene of Mycoplasma genitalium 3:
Mg 23S_BC_l992F:
5'TTTCTGTTGGTGCTGATATTGCCCATCTCTTGACTGTCTCGG(SEQ ID NO:11)
Mg 23 S BC_ 2679R:
5'ACTTGCCTGTCGCTCTATCTTCTCCTCTCGTACTAGAAGCAAAG(SEQ ID NO: 12)
No prior art teach performing targeted amplification of the 23S rRNA gene in Mycoplasma genitalium using a primer pair, wherein a forward primer of the primer pair comprises SEQ ID NO: 11 and a reverse primer of the primer pair comprises SEQ ID NO: 12.
Although the examiner is not suggesting specific claim amendments, incorporating the subject matter not taught by prior art, as noted above, could potentially distinguish the claims from the prior art teachings.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
1 Professor Tariq is listed as a co-inventor in the present application.
2 "Figure 3. Targeted PCR amplicons from bacterial genomic DNA on 1% agarose gel.
Lane M: DNA size marker; lane 1: negative control; lane 2: N. gonorrhoeae; lane 3:
C. trachomatis; lane 4: M genitalium; lane 5: N. gonorrhoeae and C. trachomatis;
lane 6: N. gonorrhoeae andM genitalium; lane 7: C. trachomatis and M genitalium;
lane 8; N. gonorrhoeae, C. trachomatis and A1. genitalium. " (page 5)
" Neisseria gonorrhoeae gene gyrA was used for simultaneously identifying N gonorrhoeae and profiling its antibiotic susceptibility to ciprofloxacin (a fluoroquinolone). " (page 13)
"Chlamydia trachomatis major outer membrane protein 1 (Omp1) gene was used for identifying the presence of Chlamydia trachomatis." (page 14)
"Mycoplasma genitalium 23 S ribosomal RNA gene was used for simultaneously
identifying Mycoplasma genitalium and profiling its antibiotic susceptibility to macrolide. " (page 14)
3 Applicant has elected Species of microorganism species: J) Mycoplasma genitalium, in the reply filed on September 09, 2024; claim 11 recites "the microorganism is Mycoplasma genitalium and the single gene is 23S rRNA."