DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application 17/436,496 filed on 09/03/2021 is a 371 national phase of PCT/IB2020/051894 filed on 03/04/2020, and claims the benefit of provisional U.S. Patent Application No. 62/899,432, filed on 09/12/2019, provisional U.S. Patent Application No. 62/899,142, filed on 09/11/2019, and provisional U.S. Patent Application No. 62/813,605, filed on 03/04/2019.
The priority date of claim 28 and its dependent claims is determined to be 03/04/2019, the filing date of provisional U.S. Patent Application No. 62/813,605.
Election/Restrictions
Applicant elected without traverse Group III, 28-29, 31, 34 and 38, in the reply filed on 12/03/2024 and persuasively argued that claims 2, 3, 7, 9, 15, 21, 23, 28, 31, 34, 38, 42-43 as amended read on the elected group (Group III). Thus, the elected invention of Group III was determined to include claims 2-3, 5, 7, 9, 14-15, 21, 23-24, 28-29, 31, 34, 38, 42-43, and 45-46. After cancellation of claim 5 in the amended claim set filed on 09/03/2021, the claims 2-3, 7, 9, 14-15, 21, 23-24, 28-29, 31, 34, 38, 42-43, and 45-46 were examined in the Non-Final Office Action mailed on 03/05/2025.
Status of Claims
Applicant’s amendments to claims filed 08/05/2025 in response to the Non-Final Rejection mailed 03/05/2025 are acknowledged.
Claims 2, 3, 7, 9, 14, 15, 21, 28, 31, 34, 38 and 43 are amended.
Claims 1-3, 7-9, 14, 15, 21, 23-24, 28-29, 31, 34, 38, 42-43, and 45-46 are pending.
Claims 2-3, 7, 9, 14-15, 21, 23-24, 28-29, 31, 34, 38, 42-43, and 45-46 are under examination.
Response to Remarks filed 08/05/2025
The amendments and arguments presented in the papers filed 08/05/2025
a) The objection to the drawings is withdrawn in view of the replacement sheets filed 08/05/2025.
b) Deficiencies in the sequence disclosures have been remedied and objections are withdrawn in view of addition of a Sequence Listing and the addition of SEQ ID NOs to the Tables of the specification.
c) The objections to the specification regarding the use of trade names or marks are withdrawn in view of the amendments to the specification.
d) The objections to claims 3,7,9, and 14 are withdrawn in view of the amended claims.
e) The 35 USC 112(b) indefiniteness rejections of claims 3, 15, 21,28, 34, and 38 have been withdrawn in view of the amendments to claims.
f) The rejection to claims 2-3, 7, 9, 15, 21 and 23 under 35 U.S.C. 112(d) for being of improper dependent form are withdrawn in view of amendments to the claims.
g) The rejection to claims 2, 3, and 7 under 35 U.S.C. 112(d) for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends are withdrawn in view of amendments to the claims.
h) Rejections of independent claim 28 and dependent claims 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46under 35 U.S.C. 102(a)(1) as being anticipated by Wang (US 20180002738) are withdrawn in view of the amendments to the claims.
New and modified grounds of rejection necessitated by amendment are detailed below and this action is made FINAL.
Claim Rejections - 35 USC § 112(b) – Indefiniteness - Updated
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 31, 43, 45, 46 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The following rejections have been maintained and modified as necessitated by amendment.
Regarding claim 31, the claim contains the trademark/trade name Nanopore® MinION®. Where a trademark or trade name is used in a claim as a limitation to identify or describe a particular material or product, the claim does not comply with the requirements of 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph. See Ex parte Simpson, 218 USPQ 1020 (Bd. App. 1982). The claim scope is uncertain since the trademark or trade name cannot be used properly to identify any particular material or product. A trademark or trade name is used to identify a source of goods, and not the goods themselves. Thus, a trademark or trade name does not identify or describe the goods associated with the trademark or trade name. In the present case, the trademark/trade name is used to identify a sequencing platform and, accordingly, the identification/description is indefinite.
Claim 43 recites the limitation a “reverse UMI primer” in line 5 of part (b). It is unclear if the reverse UMI primer of claim 43 are in addition to or the same as the first or second primers of claim 28.
Claims 45 and 46 are rejected due to their dependency on claim 43.
Response to the applicant’s arguments
Applicant argues that amendments to claims 31 and 43 are sufficient to overcome these rejections (p 15-16).
Applicant's arguments have been fully considered but they are not persuasive.
The amendment to claim 32 failed to remove the trademark and the amendment to claim 43 failed to remove the reference to UMI in the limitation “reverse UMI primer”.
Claim Interpretation - Updated
Claims 3, 23, 28, 29, 31, 38, 43, and 46 include the term “optionally” to describe structure limitations (claims 3, 29, and 31) or steps (claims 9, 23, 28, 38, 43, and 46). Claim scope is not limited by claim language that makes optional but does not require specific structural features. MPEP 2111.04.
Claim 7 recites a first primer of claim 28 comprising the sequence CATCTTACGATTACGCCAACCACTGNNNTGNNNCTCCCGAATCAACCCTGACCC (SEQ ID NO: 3). SEQ ID NO: 3 is encompassed by the first primer of claim 28, comprising: a 5' universal primer sequence CATCTTACGATTACGCCAACCAC (SEQ ID NO:1), a unique molecular identifier (UMI) sequence, and a first target nucleic acid binding sequence.
The primer of claim 7 is disclosed as an exemplary UMI primer in the instant specification (p.11, lines 15-17). The instant specification recites an embodiment of UMI primers with the orientation 5’ universal primer sequence, unique molecular identifier (UMI) sequence, and target nucleic acid binding sequence 3’ (p.10, lines 26-30).
The instant specification states that the universal primer sequence can be any suitable sequence (p. 10, lines 31). The specific sequence CATCTTACGATTACGCCAACCAC in SEQ ID NO:3 is disclosed in the instant specification and claim 28 as the exemplary universal primer sequence, SEQ ID NO:1 (p. 10, line 32 to p.11 line 1).
The specific sequence GNNNTGNNNC of SEQ ID NO: 3 is disclosed in the instant specification as the example UMI sequence, SEQ ID NO:2 (p.11, lines 9-10). Claim 3 claims the UMI sequence that comprises NNNRNYN or NNNNTGNNNN (SEQ ID NO:2), wherein each "N" is independently selected from the group consisting of A, T, G, and C, "R" is G or A, and "Y" is T or C, or the reverse sequence thereof, the complementary sequence thereto, or the reverse complementary sequence thereof.
For purposes of claim interpretation, SEQ ID NO:3 of claim 7 is interpreted to consist of the elements of: a universal primer sequence (SEQ ID NO :1), a UMI sequence (SEQ ID NO:2) and a target nucleic acid binding sequence (TCCCGAATCAACCCTGACCC).
Claim Rejections - 35 USC § 103 – New and modified
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Independent claim 28 and dependent claims 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46 are rejected under 35 U.S.C. 103 as being unpatentable over Wang et al. (US 20180002738, on the IDS dated 04/03/2023).
This is a new 103 rejection necessitated by the claim amendments filed on 08/05/2025.
Regarding claim 28, Wang teaches performing PCR (para 0038 and Figure 7, including illustration of at least one cycle (i.e. a first cycle) using barcode primers comprised of a universal primer sequence, a molecular tag sequence (i.e. a UMI), and a target-specific sequence (examples in para 0013 and Fig. 1) to form amplicons for sequencing (para 0038 and Fig. 7).
Regarding the 5' universal primer sequence, Wang teaches a 5’ universal primer sequence (para 0013 and Fig. 1). Wang further teaches that the universal primer sequence may be from 11 to 35 nucleotides in length and preferably does not have significant homology to the target nucleic acid or other nucleic acids in a nucleic acid sample (<50% over its full length) (para 56).
Wang does not teach a first primer that comprises the specific universal primer sequence CATCTTACGATTACGCCAACCAC (SEQ ID NO:1).
However, it would have been prima facie obvious to one of ordinary skill in the art to select the claimed universal primer sequence of SED ID NO:1 on the basis of structural similarity, similar properties or use, and predictability of success (See MPEP § 2144.08(4)(c-e)). Wang teaches a universal primer sequence that can be from 11 to 35 nucleotides in length and preferably does not have significant homology to the target nucleic acid or other nucleic acids in a nucleic acid sample (<50% over its full length) (para 56). ((See MPEP § 2144.08(4)(c)).
Wang further teaches that primers have to contain universal primer sequences to incorporate molecular barcodes (UMIs) (para 39). In the instant application, the universal primer sequence of SEQ ID NO:1 is paired with a UMI sequence in a primer for barcoding (See MPEP § 2144.08(4)(d)). Wang also teaches that PCR amplicon sequencing has been widely used (para 38) and describes the design of hundreds of primers (para 143, 150, 154) (See MPEP § 2144.08(4)(e)). One of ordinary skill in the art would have had a reasonable expectation of success because primer design was well known in the art before the effective filing date. One of ordinary skill in the art would also have recognized the universal primer sequence of SEQ ID NO:1 as equivalent to the generic universal primers sequence of Wang in the intended purpose of amplifying a pool of targets with a common primer (See MPEP § 2144.07).
Regarding a second cycle of PCR comprising a second primer, Wang teaches a plurality of barcoded primers (as encompassed by a second primer), each of which comprise a universal primer sequence, a molecular tag sequence (MT), and a target-specific sequence (paras 12-13). Wang further teaches the target-specific sequences are different (as encompassed by a second target nucleic acid binding sequence) (para 15).
Wang further teaches (1) primers(LA primers) that comprise a second target-specific sequence and a 5’ second universal sequence, but do not comprise a molecular tag (UMI) (para 17 and Fig. 2) and (2) primers (adapter primers) that comprise an index sequence (UMI) and a 3’ universal primer sequence, but no target-specific binding sequence (para 32 and Fig. 5).
Wang does not teach a primer comprising a universal priming site on the 3’ end of a barcoded primer that further comprises a second target nucleic acid binding sequence and a second UMI.
However, it would have been prima facie obvious to one of ordinary skill in the art to modify the primers of Wang to arrive at the instantly claimed second primers. The modification could have entailed (2) substituting a target-specific sequence as in the LA primer in place of the adapter sequence of the adapter primer of Fig. 5. One would have been motivated to do so for the purpose of additional multiplex barcoding of targets, a stated goal of Wang (Abstract and para 44). In the instant application, second and optionally one or more subsequent cycles of PCR comprising a second primer are carried out. Wang teaches multiple cycles of PCR using different primers (para 91 and Fig. 7) (See MPEP § 2144.08(4)(d)). Wang also teaches that PCR amplicon sequencing has been widely used (para 38) and describes the design of hundreds of primers (para 143, 150, 154) (See MPEP § 2144.08(4)(e)). One of ordinary skill in the art would have had a reasonable expectation of success with an adapter primer incorporating the target-specific sequence of the LA primer because primer design was well known in the art before the effective filing date. One of ordinary skill in the art would also have recognized the second primer of the instant claim as encompassed by Wang in the intended purpose of performing second or more cycles of PCR with primers distinct from the first cycle primer (See MPEP § 2144.07).
Regarding steps (ii and iii), Wang teaches forming amplicons for sequencing (para 0038 and Fig. 7) using target specific primers (para 40). Wang further teaches the use of barcode clustering to identify barcodes from the same molecular tag (para 0146).
Regarding step (iv), Wang teaches processing reads from the same amplicon with the same molecular barcodes into one consensus read (paras 0147 and 0151) and identifying genetic variants (the sequence of each target nucleic acid sequence) based on sequencing data (para 114).
Regarding claim 2, Wang teaches barcode primers arranged from 5’ to 3’ as: a universal primer sequence, a molecular tag sequence (i.e. a UMI), and a target-specific sequence (para 0013 and Fig. 1).
Regarding claim 3, Wang teaches that the molecular tag (UMI) may be completely random, using any of A, T, G and C at any position (para 0058) and may have a length from 3 to 20 nucleotides long (para 0057).
Regarding claim 9, Wang teaches a plurality of barcoded primers (i.e. second primers), each of which comprise from 5’ to 3’ a universal primer sequence, a molecular tag sequence (UMI), and a target-specific sequence (paras 12-13). Wang further teaches the target-specific sequences are different (i.e. second target nucleic acid binding sequences) (para 15), as encompassed by section (iii) of claim 9.
Regarding claim 14, Wang teaches PCR done in 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, or 16 cycles (para 0091).
Regarding claim 15, Wang teaches target nucleic acids can be mitochondrial DNA or genomic DNA (para 0052), as encompassed by part (a). Wang further teaches that nucleic acids can be isolated from a sample of interest (para 0048) including cells that may be present in samples that include, but are not limited to, samples from organs and cell cultures which can be understood to encompass any number of cells between 1 and a million (para 0047) including one single cell, as encompassed by parts (b) and (c).
Regarding claim 21, Wang teaches removal of unused adapter primers and primer dimers after the first and last cycles of PCR (para 0076 and Fig. 7), as encompassed by part (a). Wang also teaches using size selection to purify the nucleic acid sample (para 0078), as encompassed by part (d).
Regarding claim 23, Wang teaches using different barcode primers for different target nucleic acids (para 0070 and 0072).
Regarding claim 24, Wang teaches a plurality of barcode primers to assign different barcodes to different target nucleic acids (para 0064), as encompassed by claim (b).
Regarding claim 29, Wang teaches detecting single-nucleotide variants (SNVs) (para 0115 and Figs. 8A and 8B).
Regarding claim 31, Wang teaches sequencing reads up to length 150kb of DNA in a nucleic acid sample (para 0109).
Regarding claim 34, Wang teaches sequence alignment to the reference genome (para 0147).
Regarding claim 42, Wang teaches target nucleic acids known to be involved in or associated with diseases and disorders, including aging associated diseases such as cardiovascular disease (para 0049). Cardiovascular disease is an age-related disorder because risk and rates of disease generally increase with age.
Regarding claim 43, Wang teaches extension of a barcode primer with a universal primer sequence, a unique molecular identifier, and target-specific sequence (paras 0012-0013 and Fig. 7), as encompassed by part (a).
Regarding claim 45, Wang teaches amplifying target nucleic acids by PCR with a primer comprised of a universal primer in combination with a target nucleic acid specific sequence (paras 0013, and 0017)
Regarding claim 46, Wang further teaches performing PCR (abstract, para 0038) using barcode primers comprised of a universal primer sequence, a molecular tag sequence (i.e. a UMI), and a target-specific sequence (para 0013 and Fig. 1) to form amplicons for sequencing (para 0038 and Fig. 7). Wang further teaches the use of barcode clustering to identify barcodes from the same molecular tag (para 0146) and processing reads from the same amplicon with the same molecular barcodes into one consensus read (para 0151).
Claim 7 is rejected under 35 U.S.C. 103 as being unpatentable over Wang (US 20180002738, in the IDS dated 04/03/2023) as applied to independent claim 28 and dependent claims 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46 above, in view of Suissa, et al. (Ancient mtDNA Genetic Variants Modulate mtDNA Transcription and Replication.2009. PLoS Genet 5(5): e1000474.)
These are modified rejections necessitated by the claim amendments filed on 08/05/2025.
Regarding claim 7, SEQ ID NO:3 is broadly interpreted as described in the above claim interpretation section as consisting of the elements of SEQ ID NO:1 (a universal primer sequence), SEQ ID NO:2 (a UMI sequence) and a target nucleic acid binding sequence.
Wang teaches performing PCR (para 0038 and Figure 7, including illustration of at least one cycle) using barcode primers comprised of a universal primer sequence, a molecular tag sequence (i.e. a UMI), and a target-specific sequence (examples in para 0013 and Fig. 1) to form amplicons for sequencing (para 0038 and Fig. 7). Wang further teaches the use of barcode clustering to identify barcodes from the same molecular tag (para 0146) and processing reads from the same amplicon with the same molecular barcodes into one consensus read (paras 0147 and 0151).
Wang further teaches a random molecular tag (MT), i.e. UMI, with A, T, G, or C at any position (para 58), with a length 3 to 20 nucleotides long (para 57). Wang also teaches that the MT sequence can be semi-defined (para 60). Wang states that the use of a semi-defined molecular tag can mitigate barcode errors (para 60).
Wang also teaches barcoded primers with universal primer sequences that are the same across a plurality of barcode primers (para 15). Wang further teaches that the universal primer sequence may be from 11 to 35 nucleotides in length and preferably does not have significant homology to the target nucleic acid or other nucleic acids in a nucleic acid sample (<50% over its full length) (para 56).
Wang does not teach the specific universal primer sequence of the primer of SEQ ID NO:3.
It would have been obvious to one of ordinary skill in the art to select the claimed universal primer sequence of SED ID NO:3 on the basis of structural similarity, similar properties or use, and predictability of success (See MPEP § 2144.08(4)(c-e)). Wang teaches a universal primer sequence that can be from 11 to 35 nucleotides in length and preferably does not have significant homology to the target nucleic acid or other nucleic acids in a nucleic acid sample (<50% over its full length) (para 56). The universal primer sequence of the primer of SEQ ID NO:3 is 23 nucleotides in length and does not have significant homology to the target nucleic acid binding sequence of SEQ ID NO:3. ((See MPEP § 2144.08(4)(c)). Wang further teaches that primers have to contain universal primer sequences to incorporate molecular barcodes (UMIs) (para 39). In the instant application, the universal primer sequence of SEQ ID NO:3 is paired with a UMI sequence in a primer for barcoding (See MPEP § 2144.08(4)(d)). Wang also teaches that PCR amplicon sequencing has been widely used (para 38) and describes the design of hundreds of primers (para 143, 150, 154) (See MPEP § 2144.08(4)(e)). One of ordinary skill in the art would have had a reasonable expectation of success because primer design was well known in the art before the effective filing date. One of ordinary skill in the art would also have recognized the universal primer sequence of SEQ ID NO:3 as equivalent to the generic universal primers sequence of Wang in the intended purpose of amplifying a pool of targets with a common primer (See MPEP § 2144.07).
The target nucleic acid binding sequence of SEQ ID NO: 3 aligns to the mitochondrial nd6 gene at positions 116-135, see alignment below.
PNG
media_image1.png
801
543
media_image1.png
Greyscale
Wang teaches mitochondrial DNA as a target nucleic acid to amplify but does not disclose the target nucleic acid binding sequence of SEQ ID NO:3 (TCCCGAATCAACCCTGACCC).
Suissa teaches the primer (target nucleic acid binding sequence) “ND6 rev” (p. 9, Table 3) that aligns to the mitochondrial nd6 gene at positions 107-130, see the above alignment. Suissa teaches the use of the ND6 rev primer for PCR-based estimations of transcript levels and mtDNA copy numbers in the analysis of sequence variants.
Because the target nucleic acid binding sequence of Suissa binds to the same gene at overlapping positions, it would have been prima facie obvious that use of the Suissa primer would produce the same PCR product as the target nucleic acid binding sequence of SEQ ID NO:3.
It would have prima facie obvious to one skilled in the art before the effective filing date to combine the teachings of Wang with the teachings of Suissa to incorporate the target nucleic acid binding sequence of Suissa in the primer of Wang. Use of the primer of Suissa with the PCR amplification design of Wang would have resulted in a primer capable of amplifying a specific mitochondrial DNA for the purposes of sequencing. Suissa teaches using primers for PCR to amplify specific mtDNA sequences to determine expression levels of the targeted nucleic acids (p.9, column 1) in different haplogroups (p 6, Fig. 4). One skilled in the art would have had a reasonable expectation of success using the primer of Suissa in the method of Wang, because both Suissa and Wang are both directed to methods of PCR amplification of mitochondrial target nucleic acid using primers.
It would have been prima facie obvious to combine the teachings of Wang and Suissa to produce a primer that is functionally equivalent to that of SEQ ID NO:3, having the required structure of the primer of claim 28 (a primer with a universal primer sequence, a unique molecular identifier (UMI) sequence, and a first target nucleic acid binding sequence). Thus, the primer of claim 7 is an obvious variant of those suggested by prior art. One skilled in the art would have had a reasonable expectation of success, since all share the method of PCR amplification using primers.
Claim 38 is rejected under 35 U.S.C. 103 as being unpatentable over Wang (US 20180002738, in the IDS dated 04/03/2023) in view of Michikawa et al (US Patent 6,462,190), further in view of Zhou et al. (Plasmid. 2010. (64):196-199).
This rejection is maintained, with revisions for clarity.
Regarding claim 38, Wang teaches target nucleic acids can be mitochondrial DNA (para 0052). Wang teaches using barcode primers to label a target nucleic acid (i.e. mtDNA) with molecular tags (labeling a target nucleic acid with UMI labels) (para 0013) and sequencing the products (paras 0104-0105), which encompasses the embodiment “labeling of the remaining mtDNA with UMI labels “ in step (iii) and step (iv) of claim 38.
Wang does not teach restriction enzyme digest of only the nuclear DNA in a nucleic acid sample comprising nuclear and mitochondrial DNA as in step (i).
Michikawa teaches enriching mitochondrial nucleic acids by removing non- mitochondrial nucleic acid sequences (col 14, lines 36-38) using the process of selective nuclease digestion of the nucleic acids present in a sample (col 14, lines 38-40). Michikawa states that certain nucleases do not digest human mitochondrial DNA sequences and thus act specifically on nuclear DNA sequence and these nucleases are known in the art (col 14, lines 40-42). Michikawa teaches a method to completely destroy nuclear DNA and nucleocytosolic RNA in a sample by using restriction enzymes which do not cut human mtDNA with RNase A and Exonuclease III (col 22, lines 6-14 and Figure 1C).
It would have been advantageous and obvious to one skilled in the art before the effective filing date to combine the teachings of Wang with the teachings of Michikawa. The ordinary artisan would have been motivated to use the method of Michikawa to remove nuclear DNA from a sample containing nuclear and mitochondrial DNA (mtDNA) to enrich mitochondrial DNA for the labeling and sequencing steps of Wang. It would have been obvious to the ordinary artisan that the known techniques of Wang and Michikawa could have been combined with a reasonable expectation of success because the known techniques relate to handling of nucleic acids samples.
Regarding step (ii), neither Wang nor Michikawa teach the use of lambda exonuclease as the exonuclease used for digestion of nuclear DNA.
Zhou teaches the use of lambda exonuclease to remove linear DNA (abstract and p. 197, column 1). Zhou also states that lambda exonuclease is highly selective in digestion of linear DNA (i.e. not circular mtDNA) (p. 198, column 2).
It would have been advantageous and prima facie obvious to one skilled in the art before the effective filing date to combine the teachings of Wang and Michikawa with the teachings of Zhou. The ordinary artisan would have been motivated to use the method of Zhou to select an exonuclease for the method of Michikawa that is highly selective for digestion of nuclear DNA to improve the mitochondrial enrichment of Michikawa. It would have been obvious to the ordinary artisan that the known techniques of Wang and Michikawa could have been combined with Zhou with a reasonable expectation of success because Zhou provides a simple substitution of exonucleases and Michikawa states that other nucleases can be used.
Regarding (iii), Wang teaches labeling target nucleic acid with molecular tags (i.e. a UMI) (para 0013) as encompassed by the limitation “labeling of the remaining mtDNA with UMI labels.”
Response to Arguments against Claim Rejection
The response presents an extended analysis of “The Methods defined by the Claims” and assert that the claimed methods impart a significant advance over the cited art (p. 19-20).
However In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., a description of the methods and their purported advantages) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
Regarding the art, the response asserts broadly that, (i) Wang does not teach or suggest the universal primer sequence of CATCTTACGATTACGCCAACCAC (SEQ ID N0:1). Wang does not disclose the target nucleic acid binding sequence of TCCCGAATCAACCCTGACCC (SEQ ID N0:3). Wang does not teach the isolation of mitochondrial DNA from a nucleic acid sample comprising nuclear and mitochondrial DNA (mtDNA). Wang does not teach or suggest transposon-based labelling of mtDNA (p. 20); (ii) Suissa does not teach or suggest the universal primer sequence of CATCTTACGATTACGCCAACCAC (SEQ ID N0:1). Suissa does not disclose the target nucleic acid binding sequence of TCCCGAATCAACCCTGACCC (SEQ ID N0:3). Suissa does not teach or suggest transposon based labelling of mtDNA (p. 21); (iii) Michikawa does not teach or suggest the universal primer sequence of CATCTTACGATTACGCCAACCAC (SEQ ID N0:1); disclose the target nucleic acid binding sequence of TCCCGAATCAACCCTGACCC (SEQ ID N0:3); teach the isolation of mitochondrial DNA from a nucleic acid sample comprising nuclear and mitochondrial DNA (mtDNA); or teach or suggest transposon-based labelling of mtDNA (p. 21). The response further asserts (iv) Zhou does not teach or suggest the universal primer sequence of CATCTTACGATTACGCCAACCAC (SEQ ID N0:1); disclose the target nucleic acid binding sequence of TCCCGAATCAACCCTGACCC (SEQ ID N0:3); teach the isolation of mitochondrial DNA from a nucleic acid sample comprising nuclear and mitochondrial DNA (mtDNA); or teach or suggest transposon-based labelling of mtDNA (p. 22).
Applicant's arguments have been fully considered but are not persuasive.
In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
It is further noted that Suissa, Michikawa and/or Zhou are not used in the rejection of independent claim 28 and its dependents 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46.
Arguments against Suissa, Michikawa and/or Zhou are addressed where relevant below.
The response traverses the rejection of claims 28 and 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46 as being anticipated by Wang.
Applicant's arguments with respect to the rejection(s) of claim(s) 28 and 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46 under 35 U.S. C § 102 have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made over Wang as described above in the new rejections of the claims.
The response asserts that Wang does not teach or suggest the same universal primer sequence that is required for the method of claim 28 as amended or any method including a first primer having the same combination of a universal primer sequence CATCTTACGATTACGCCAACCAC (SEQ ID NO:1), a unique molecular identifier (UMI) sequence, and a first target nucleic acid binding sequence that is required by the amended claims (p. 18).
Applicant's arguments have been fully considered but are not persuasive.
Maintained grounds of rejection with modifications are provided above in this office action for claims 28 and 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46. It is the Examiner’s position that Wang does disclose said claim limitations as outlined in the rejection of claim 28 and its dependent claims provided above.
The response asserts the claimed methods are specific in the approach to end-labeling both ends of the target with primer binding sites and UMI sequences, as well as specifying first and second single cycles of PCR with the forward and reverse primers, respectively, to create the dual end-labeled target for further amplification. The specific method steps required by the claims reduce amplification based errors prior to labeling and maximize the sensitivity of labelling when using very small amounts of DNA (p. 22).
Applicant's arguments have been fully considered but are not persuasive.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., end-labeling both ends of the target with primer binding sites and UMI sequences, specifying first and second single cycles of PCR with the forward and reverse primer to create the dual end-labeled target for further amplification or the claim that the specific method steps reduce amplification based errors prior to labeling and maximize the sensitivity of labelling when using very small amounts of DNA) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The response asserts Wang does not teach or suggest the same methods for labeling a target nucleic acid from a subject using as few as one cell by attaching a unique molecular identifier (UMI) at each end of the target sequence that is defined by the amended claims. Wang does not teach or suggest labeling of both ends of a target nucleic acid by using a single round of PCR for each labeling steps. In contrast, the methods of Wang require additional cycles of PCR to label a target nucleic acid at both ends (p. 22-23).
Applicant's arguments have been fully considered but are not persuasive.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., attaching a unique molecular identifier (UMI) at each end of the target sequence or labeling of both ends of a target nucleic acid by using a single round of PCR for each labeling steps) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The response asserts Wang does not teach or suggest using a universal priming site configured to preclude undesired secondary structures, such as that of SEQ ID NO:1. Accordingly, these sequences combine to provide a structure that is highly stable and functions effectively, as demonstrated in the Examples of the application (p. 23).
Applicant's arguments have been fully considered but are not persuasive.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., a universal priming site configured to preclude undesired secondary structures) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
The response asserts Suissa, Michikawa and/or Zhou do not make up for the deficiencies of Wang because they do not alone or in combination, teach or suggest the same structural features of a universal primer sequence of CATCTTACGATTACGCCAACCAC (SEQ ID NO:1), or same target nucleic acid binding sequence of TCCCGAATCAACCCTGACCC (SEQ ID NO:3), nor do these references teach or suggest the benefits of using a single round of PCR to attach a label to each end of a target nucleic acid to reduce errors and maximize the sensitivity of labelling when using very small amounts of DNA. Absent the experimentation demonstrated in the Examples of the Application, one skilled in the art could not know if or how to label a specific target sequence from DNA obtained from as small a sample as a single cell based on the cited art alone (p. 23).
Applicant's arguments have been fully considered but are not persuasive.
In response to applicant's argument that the references fail to show certain features of the invention, it is noted that the features upon which applicant relies (i.e., the benefits of using a single round of PCR to attach a label to each end of a target nucleic acid to reduce errors and maximize the sensitivity of labelling when using very small amounts of DNA) are not recited in the rejected claim(s). Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993).
It is further noted that Suissa, Michikawa and/or Zhou are not used in the rejection of independent claim 28 and its dependents 2, 3, 9, 14-15, 21, 23-24, 29, 31, 34, 42-43, and 45-46.
The response traverses the rejection of claim 7 as being unpatentable over Wang in view of Suissa.
Regarding Suissa, the response asserts that Suissa does not teach or suggest the universal primer sequence of CATCTTACGATTACGCCAACCAC (SEQ ID N0:1); disclose the target nucleic acid binding sequence of TCCCGAATCAACCCTGACCC (SEQ ID N0:3); or teach or suggest transposon-based labelling of mtDNA (p. 21).
Applicant's arguments have been fully considered but are not persuasive.
In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
It is further noted that transposon-based labelling of mtDNA is not a required limitation of claim 7, the only claim for which Suissa is art.
The response traverses the rejection of claim 38 as being unpatentable over Wang in view of Michikawa, further in view of Zhou.
Regarding Wang, the response asserts does not teach or suggest using a transposon system for any purpose, least of all the EZ-Tn5 transposon system that is required by the claims (p 24). The response further asserts Suissa, Michikawa and/or Zhou do not make up for the deficiencies of Wang (p.21)
Applicant's arguments have been fully considered but are not persuasive.
The claims as written do not require using a transposon system for any purpose or the use of the EZ-Tn5 transposon system. As written, claim 38 part (iii) reads on multiple embodiments, (1) labeling of the remaining mtDNA with UMI labels, (2) labeling of the remaining mtDNA with priming sites, and/or (3) labeling of the remaining mtDNA with bar codes using EZ-Tn5 transposon. The rejection of claim 38 presented above in this office action reads on the embodiment “labeling of the remaining mtDNA with UMI labels”.
In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986).
It is also noted that Suissa is not used in the rejection of claim 38.
The response further asserts that trying to adapt the teachings of Wang by incorporating those of Suissa, Michikawa and/or Zhou, would likely change the principle of operation or another important aspect of the cited art method, and thus one of ordinary skill in the art would not be motivated to modify the method(s) in the claimed way.
Applicant's arguments have been fully considered but they are not persuasive.
The applicant fails to provide any evidence or argument for why adapting the teachings of Wang by incorporating the teachings of Suissa, Michikawa and/or Zhou, would likely change the principle of operation. A person of obvious skill in the art would recognize the obviousness rationales presented above in this office action.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
It is noted that double patenting rejections documented below are updated to reflect the fact that US patent number 12,258,615 was issued on 03/25/2025 for Application No. 17/409,731, which instant claims were previously rejected over as a copending Application.
(i) Independent claim 28 and dependent claims 2, 3, 9, 14, 15, 21, 23-24, 29, 31, 34, 42, 43, and 45-46 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 12,258,615 in view of Wang (US 20180002738).
Although the claims at issue are not identical, they are not patentably distinct from each other because copending claim 1 requires a method of labeling target nucleic acids that requires carrying out at least one cycle of polymerase chain reaction using a nucleic acid sample to which first target nucleic acid binding sequence of a primer can bind; a primer comprising a universal primer sequence, a unique molecular identifier (UMI) sequence, and a first target nucleic acid binding sequence; sequencing the labeled target nucleic acids and optionally grouping sequences with the same UMI to determine consensus sequences. Thus, the copending claim require elements of a method that satisfy the requirements of instant claim 28.
Regarding instant claim 28, the copending claims do not require a 5' universal primer sequence CATCTTACGATTACGCCAACCAC (SEQ ID NO:1) or carrying out a second and optionally one or more subsequent cycles of PCR comprising a second primer, wherein the second primer comprises a second target nucleic acid binding sequence, a second UMI and a 3' universal priming site, and wherein the target nucleic acid comprises a nucleic acid sequence to which the second target nucleic acid binding sequence of the second primer can bind.
The teachings of Wang as they relate to these claims are given previously in this office action and are fully incorporated here.
Regarding instant claims 2 ,3, and 9, the copending claims do not require the order or orientation of the first primer (claim 2); the UMI sequence (SEQ ID. NO:2) of instant claim 3; or the limitations of instant claim 9.
The teachings of Wang as they relate to these claims are given previously in this office action and are fully incorporated here.
Regarding instant claim 14, copending claim 1 step (b) further requires amplifying the labeled target nucleic acid by one or more rounds of polymerase chain reaction (claim 14) .
Regarding instant claim 15, copending claim 1 is drawn to a target nucleic acid that is mitochondrial DNA as encompassed by part (a) of claim 15. Copending claim 1 step (a) further requires that the source of the nucleic acid sample is any integer between 1and 100 cells inclusive, and copending claim 14 teaches that the nucleic acid sample is form a single cell, both of which encompass instant claim 15 part (b).
Regarding instant claim 21 the copending claims do not require removing contaminants, performing 1 to 100 cycles of PCR, and purifying by size selection (claim 21).
The teachings of Wang as they relate to these claims are given previously in this office action and are fully incorporated here.
Regarding instant claims 23 and 24, copending claims 1 (steps (a) and (b)) and 13 require the use of UMI primers to label and amplify (copending claim 1) different target nucleic acids (copending claim 13).
Regarding instant claim 29, copending claims 6 and 7 require identifying polymorphisms (copending claim 6) wherein the polymorphism is a SNP (copending claim 7)
Regarding instant claim 31, copending claims 1 (step (c)), 9 and 10 require using long-read sequencing technology (copending claim 1 (step (c)), wherein the long-read sequencing technology comprises preparing ultra-long reads (i.e. long-read sequencing) (copending claim 9) and preparing a 1D ligation library from the labeled amplicons (copending claim 10).
Regarding instant claim 34, copending claims 11 and 12 require using bioinformatics analysis (copending claim 11) wherein the bioinformatics analysis comprises base calling, sequence alignment(s), polymorphism identification or a combination thereof (copending claim 12).
Regarding instant claim 42, the copending claims do not require target nucleic acids that are known to be associated with age-related diseases or disorders (claim 42).
The teachings of Wang as they relate to these claims are given previously in this office action and are fully incorporated here.
Regarding instant claim 43, copending claim 1 step (a) requires extension of a barcode primer with a universal primer sequence, a unique molecular identifier (paras 0012-0013 and Fig. 7), as encompassed by instant claim 43, part (a).
Regarding instant claim 45, copending claim 1 step (b) requires amplification of UMI labeled target nucleic acid by PCR with a universal primer and a primer that binds a target DNA sequence.
Regarding instant claim 46, copending claim 1 requires a method of labeling target nucleic acids comprising carrying out at least one cycle of polymerase chain reaction using a nucleic acid sample to which first target nucleic acid binding sequence of a primer can bind; a primer comprising a universal primer sequence, a unique molecular identifier (UMI) sequence, and a first target nucleic acid binding sequence; sequencing the labeled target nucleic acids and optionally grouping sequences with the same UMI to determine consensus sequences. Thus the copending claim anticipates instant claim 46.
The additional limitations of the ‘615 claims are encompassed by the open claim language "comprising" found in the instant claims.
(ii). Claim 7 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 12,258,615 in view of Suissa, et al. (Ancient mtDNA Genetic Variants Modulate mtDNA Transcription and Replication.2009. PLoS Genet 5(5): e1000474.).
Regarding instant claim 7, the copending claims require a primer comprising a universal primer sequence, a unique molecular identifier (UMI) sequence, and a first target nucleic acid binding sequence.
The teachings of Wang in view of Suissa as they relate to this claim is given previously in this office action and are fully incorporated here.
(iii). Claim 38 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 12,258,615 in view of Michikawa et al (US Patent 6,462,190), further in view of Zhou et al. (Plasmid. 2010. (64):196-199).
Regarding instant claim 38, copending cla