DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received 08/25/2025. Claims 1-3, 6-20, 22 and 24 are currently pending. Claims 8-17, 20, 22 and 24 are withdrawn from prosecution as being drawn to non-elected subject matter. Accordingly, claims 1-3, 6-7, and 18-19 are examined herein. The restriction requirement mailed 03/03/2025 is still deemed proper. Applicant elected the invention of Group I, a nucleic acid composition comprising a modified microRNA nucleotide sequence that comprises at least one cytosine nucleic acid, wherein one or more of said cytosine nucleic acids is replaced by a gemcitabine molecule, without traverse in the reply filed 05/02/2025.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
Determining the scope and contents of the prior art.
Ascertaining the differences between the prior art and the claims at issue.
Resolving the level of ordinary skill in the pertinent art.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-3 and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Sierant et al. (of record) in view of Patent Publication CN 106906213A to Wu (of record; herein “Wu”) and Lam et al. (“siRNA Versus miRNA as Therapeutics for Gene Silencing”. Molecular Therapy—Nucleic Acids (2015) 4, e252.).
Regarding claim 1, Sierant et al. teach a nucleic acid composition comprising a modified siRNA nucleotide sequence that comprises at least one cytosine nucleic acid, wherein one or more of said at least one cytosine nucleic acids is replaced by a gemcitabine molecule:
we present the synthesis of oligoribonucleotides with the single replacement of a cytidine unit for 2′,2′-difluoro-2′-deoxycytidine (gemcitabine, dFdC) and the use of them in a series of siRNAs for gene silencing experiments. (abstract)
Sierant et al. further teach that gemcitabine is an anticancer drug:
Gemcitabine, an analog of deoxycytidine (dC), is an anticancer drug that is widely used in the treatment of prevalent human cancers.
Regarding claim 1, Sierant et al. do not teach that the nucleic acid composition comprises a modified microRNA nucleotide sequence.
Regarding claims 2 and 3, Sierant et al. do not teach the nucleic acid composition where at least two (claim 2) or at least three (claim 3) of the cytosine nucleic acids in the nucleotide sequence are each replaced by a gemcitabine molecule.
Wu teaches a siRNA in which 1 to 3 nucleotides have been replaced by gemcitabine (relevant to claims 2 and 3):
[0009] The object of the present invention is to provide a modified siRNA, which is obtained by modifying siRNA with a nucleoside analogue having biological
activity or cytotoxicity. The nucleoside analogue having biological activity or
cytotoxicity is preferably gemcitabine or a gemcitabine structural analogue.
[0021] Preferably, 1 to 3 nucleotides in the sequence of the initial siRNA are
replaced by biologically active or cytotoxic nucleoside analog monomers.
[0022] Preferably, the biologically active or cytotoxic nucleoside analog is
gemcitabine or a gemcitabine structural analog.
[0043] The modification strategy is as follows… inserting or/and replacing 1 to 3 gemcitabine monomers in the sequence of the initial RRM1 siRNA (such as numbered 9 to 11 Gem-RRM1 siRNA)
Wu further provides a teaching, suggestion or motivation to replace 2 or 3 nucleotides with gemcitabine as a cancer therapeutic because the constructs comprising 1 to 3 gemcitabine molecules (10 and 11) had a more significant inhibitory effect on drug resistant cancer cells than conventional modified siRNA:
[0052] The results are shown in Table 2. Compared with the gemcitabine-modified mismatch siRNA control (No. 13), the Gem-RRM1 siRNA Nos. 1 to 11 had a very significant inhibitory effect on the drug-resistant pancreatic cancer cells PANC1/Gem, indicating that RRM1 siRNA can reverse the drug resistance of gemcitabine.
Compared with the siRNA control modified with conventional siRNA-modified monomers (No. 12), the Gem-RRM1 siRNAs No. 1 to 7, 10 to 11 had a more
significant inhibitory effect on drug-resistant tumor cells PANC1/Gem,
indicating that gemcitabine modification of siRNA can not only effectively
inhibit the proliferation of pancreatic cancer cells, but also enhance the effect
of RRM1 siRNA in reversing drug resistance, thereby achieving a synergistic tumor inhibition effect.
In addition, please see the table at para [0046] of Wu in the untranslated document, which shows that the 2- and 3-gemcitabine siRNA constructs had higher potency than the 1-gemcitabine construct, as indicated by their lower IC50 values.
Wu does not teach that the composition comprises a miRNA nucleotide sequence.
Lam teaches that siRNAs and miRNAs have similar physicochemical properties and face a similar set of barriers for clinical use, and the same strategies can be employed to overcome those barriers:
siRNAs and miRNAs share many similarities, both are short duplex RNA molecules that exert gene silencing effects at the post-transcriptional level by targeting messenger RNA (mRNA) (abstract)
for clinical development, the two types of small RNA molecules face a similar set of barriers: poor stability in vivo, delivery challenges and off-target effects15; and so, the same strategies can be employed to improve their in vivo efficacy. (p. 1)
Lam further teaches that, “the technologies of chemical modification and delivery of nucleic acids developed previously can be applied to both siRNAs and miRNAs” (pp. 15-16 §Conclusions and future prospects).
Lam further teaches multiple clinical siRNA and miRNA therapeutics using various delivery systems (i.e., pharmaceutical compositions) (see e.g., Table 5).
Finally, Lam provides a teaching, suggestion or motivation to use miRNAs instead of siRNAs as therapeutics to treat cancer and other multigenic diseases due to their ability to inhibit the expression of multiple genes (p. 13 §siRNA AND miRNA therapeutics in clinical studies):
miRNAs have an advantage over siRNAs as the therapeutics for complex multigenic diseases such as cancers and neurodegenerative disorders, which require modulation of multiple pathways for effective treatment. With the ability to inhibit the expression of a number of target genes, which often work together as a network within the same cellular pathway, a whole disease phenotype can potentially be changed by a single miRNA sequence.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the siRNA comprising a gemcitabine molecule, as taught by Sierant, to comprise 1 to 3 gemcitabine molecules, as taught by Wu. One having ordinary skill would have been motivated to do so and would have had a reasonable expectation of success based on Wu’s teachings that the siRNAs comprising more than one gemcitabine molecule showed more potent inhibition of expression and of proliferation of cancer cells than siRNAs modified with only one gemcitabine molecule or with standard modifications. Furthermore, the ordinary artisan would have been motivated by Lam’s teachings that miRNAs are more effective as cancer therapeutics than siRNAs to modify the siRNA as taught by Sierant and Wu into a miRNA, or to substitute an miRNA for that siRNA. Lam’s teachings that miRNAs are generally more effective cancer therapeutics than siRNAs and that the same modifications can be applied to both siRNAs and miRNAs would have given the ordinary artisan a reasonable expectation of success.
Claims 6-7 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Sierant, Wu and Lam as applied to claims 1-3 and 18, further in view of Wang et al. (“MiR-194, commonly repressed in colorectal cancer, suppresses tumor growth by regulating the MAP4K4/c-Jun/MDM2 signaling pathway”. (2015) Cell Cycle, 14(7), 1046–1058.) and Genbank accession No. AJ560736.1 (of record) and Patent Publication CN108671235A to Zhang (published 2018-10-19, hereinafter “Zhang”; machine-translated version provided).
Sierant, Wu and Lam render obvious the miRNA composition of claims 1 and 18, from which instantly rejected claim 6 depends, as described above.
Sierant, Wu and Lam do not teach wherein the modified microRNA nucleotide sequence comprises or consists of a microRNA nucleotide sequence of miR-194, or the gemcitabine-substituted miRNA sequence of SEQ ID NO: 2.
Genbank accession No. AJ560736.1 teaches the Mus musculus miR-194 sequence, which comprises a base sequence with 100% identity to the base sequence SEQ ID NO: 2, with n being cytosines and when accounting for thymines instead of uracils in the reference coding sequence versus the claimed RNA sequence, as shown in the alignment below:
RESULT 1
AJ560736_1
Query Match 100.0%; Score 17; DB 1; Length 22;
Best Local Similarity 54.5%;
Matches 12; Conservative 5; Mismatches 5; Indels 0; Gaps 0;
Qy 1 UGUAANAGNAANUNNAUGUGGA 22
:|:|| || || : |:|:|||
Db 1 TGTAACAGCAACTCCATGTGGA 22
Wang provides a teaching, suggestion or motivation to use miR-194 mimics as anti-cancer therapeutics by teaching that miR-194 suppresses cancer growth in colorectal cancer (CRC) cell lines and xenograft tumors:
overexpression of miR-194 significantly suppressed cell proliferation, colony formation, promoted G0/G1 arrest, and induced cell apoptosis. Furthermore, our in vivo study revealed that the growth of xenograft tumors in nude mice was significantly repressed after transfected with LV-miR-194. These results strongly implied that miR-194 might act as an inhibitor in the progress of CRC. (p. 1052 )
Sierant, Wu and Lam also do not teach the substitution of all cystosines with gemcitabine.
Zhang teaches functional nucleic acids, including miRNA, wherein multiple nucleosides have been replaced with nucleoside analog drugs such as gemcitabine to achieve combined delivery of gene therapy and chemotherapy (claims 1, 5, 6 and below):
[0026] Preferably, the functional nucleic acid of the backbone-integrated nucleoside analog drug, wherein the nucleoside analog drug is selected from one of the following drugs:…[0029] A cytidine analog, which may be cytarabine, ancitabine, gemcitabine, enocitabine, 5-azacytidine or decitabine
Compared with the prior art, the present invention has the following beneficial effects:
[0056] First, the functional nucleic acid and its derivatives of the backbone-integrated nucleoside analog drugs of the present invention can achieve a precise and adjustable ratio of gene to drug, which can be achieved by adjusting the number of natural nucleotides replaced by the drug;
[0057] Second, the functional nucleic acid and its derivatives of the backbone-integrated nucleoside analog drugs of the present invention can realize the programmed sequential effects of genes and drugs, and can maximize the effect of synergistic treatment;
[0058] Third, the present invention successfully designs a carrier that can simultaneously and efficiently encapsulate both gene drugs and chemotherapeutic drugs.
Zhang further teaches wherein all cytosines have been replaced with a gemcitabine (see note below):
[0148] During the solid phase DNA synthesis, in this example, all nucleotide T in the antisense nucleotide was replaced with the anti-tumor drug gemcitabine
Please note that although Zhang states that, “all nucleotide T in the antisense nucleotide was replaced”, the following fact pattern indicates that this is a typographical error:
- Inspection of the sequence in paragraph [0149] shows that no cytosines are present but that thymines are, and are clearly unsubstituted.
Sierant, Wu and Zhang’s clearly disclose that gemcitabine is a cytosine analog, not a thymine analog.
Therefore, Zhang is interpreted as disclosing an oligonucleotide in which all cytosines have been replaced with gemcitabine. Furthermore, Zhang discloses various methods of synthesizing both siRNA (paras [0143-0146]) and DNA (para [0147-0149]) in which natural nucleotides are replaced with nucleoside analogs.
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have substituted the base guide sequence of the gemcitabine-modified miRNA, as taught by Sierant, Wu and Lam, with the known base guide sequence of miR-194, as taught by Genbank accession No. AJ560736.1 and Wang, to achieve the predictable outcome of a miRNA mimic suitable for CRC-directed therapy. Wang provides a teaching, suggestion or motivation to use the miR-194 sequence in particular by showing that overexpression of miR-194 in CRC cancer cells effectively inhibited tumor growth in vitro and in vivo. It would further have been obvious to optimize the gemcitabine-substituted miR-194 by replacing all cytosines with gemcitabine, as taught by Zhang. Zhang explicitly teaches optimization of the substituted oligonucleotide, stating that, “a precise and adjustable ratio of gene to drug…can be achieved by adjusting the number of natural nucleotides replaced by the drug”. Finally, it is relevant to note that there are only 5 cytosines in the miRNA sequence taught by Wang. This gives a limited number of substitutable positions and, by extension, limits the amount of experimentation required to optimize the ratio of gene to drug, as taught by Zhang. Thus in regard to the limitations of the claims, where the prior art teaches a miRNA sequence, a motivation to use it in gene therapy, and methods of replacing varying numbers of cytosines with gemcitabine molecules to yield an efficient combined gene- and chemotherapy drug, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp for optimization of the number of cytosines to replace with gemcitabine. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense to provide routine optimization.
Response to Arguments
Applicant's arguments filed 08/25/2025 have been fully considered but they are not persuasive for the following reasons.
Applicant notes that, “the present disclosure reveals that the replacement of cytosine nucleotides within a microRNA oligonucleotide sequence with a gemcitabine molecule increases the ability of the microRNA to inhibit cancer development, progression and tumorigenesis.” (page 9) and argues that, “It is unexpected for those skilled in the art that this will be feasible due to the concern of toxic side effects. Surprisingly and unexpectedly, the gemcitabine modified miRNAs as currently claimed are highly effective to eliminate cancer cells without toxic side effect.” (Id.). Respectfully, this argument is not persuasive because, as discussed above, the prior art shows that this result would have been expected. As Wu states in para [0052], discussed above but reproduced below for convenience:
Compared with the siRNA control modified with conventional siRNA-modified monomers (No. 12), the Gem-RRM1 siRNAs No. 1 to 7, 10 to 11 had a more significant inhibitory effect on drug-resistant tumor cells PANC1/Gem, indicating that gemcitabine modification of siRNA can not only effectively inhibit the proliferation of pancreatic cancer cells, but also enhance the effect of RRM1 siRNA in reversing drug resistance, thereby achieving a synergistic tumor inhibition effect.
Further, as Sierant notes, “Virtually no toxic effect for any sample was observed” (p. 921 1st para). Therefore, the prior art shows that the anti-cancer efficacy and low toxicity of gemcitabine-modified siRNA or miRNA, compared to unmodified controls, was known in the art and would not have been an unexpected finding.
Applicant further argues that, “None of the cited references discloses, teaches or suggests the specific modified miRNA comprising the microRNA sequence of miR-194 having at least one gemcitabine molecule substituted for at least one cytosine nucleic acid as currently claimed.” (page 10). Applicant goes on to note that Sierant and Wu only disclose modified siRNA. Respectfully, this argument is not persuasive at least because it argues against Sierant and Wu individually, not the combination of Sierant, Wu and Lam. In response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). The same reasoning applies, mutatis mutandis, to Applicant’s argument that neither Wang nor Zhang discloses, teaches or suggests modification of the specific microRNA nucleotide sequence of miR-194 having at least one gemcitabine molecule.
Additionally, Applicant argues the relevance of Lam’s teachings by stating that the mechanisms of action, clinical applications, and specificity (i.e., siRNAs are highly specific whereas miRNAs have multiple targets) differ between miRNA and siRNA. Respectfully, this is not persuasive because the argument is not germane to the main thrust of Lam’s teachings and its relevance to the limitations of the claims. Specifically, the claimed invention is a gemcitabine-modified miRNA, and Lam teaches that, “the technologies of chemical modification and delivery of nucleic acids developed previously can be applied to both siRNAs and miRNAs”, irrespective of their downstream mechanisms.
Conclusion
No claim is allowed at this time.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.M.Z./Examiner, Art Unit 1636
/BRIAN WHITEMAN/Primary Examiner, Art Unit 1636