Prosecution Insights
Last updated: April 18, 2026
Application No. 17/440,647

A METHOD TO IMPROVE THE AGRONOMIC CHARACTERISTICS OF PLANTS

Final Rejection §102§103§112
Filed
Sep 17, 2021
Examiner
DELEO, VICTORIA LYNN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
CONSEJO NACIONAL DE INVESTIGACIONES CIENTÍFICAS Y TÉCNICAS
OA Round
4 (Final)
38%
Grant Probability
At Risk
5-6
OA Rounds
2y 6m
To Grant
-2%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allow Rate
8 granted / 21 resolved
-21.9% vs TC avg
Minimal -40% lift
Without
With
+-40.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 6m
Avg Prosecution
40 currently pending
Career history
61
Total Applications
across all art units

Statute-Specific Performance

§101
9.8%
-30.2% vs TC avg
§103
27.0%
-13.0% vs TC avg
§102
18.2%
-21.8% vs TC avg
§112
35.6%
-4.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 21 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of Claims Claims 32, 47, 48 & 50 are under examination on the merits. Claims 39-44 are withdrawn. The objections to claims 34-37 & 45-50 are withdrawn in light of Applicant’s amendments. The rejection of claims 33-38 & 45-47 under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, is withdrawn in light of Applicant’s amendments. The rejection of claims 48-49 under 35 U.S.C. 102(a)(1) as being anticipated by Landoni et al(2007) Sex. Plant Reprod. 20: 191-198, taken with the evidence of GenBank accession AY957396 is withdrawn in light of Applicant’s amendments. The rejection of claim 48 under 35 U.S.C. 102(a)(1) as being anticipated by Reuber et al (US 7,858,848 B2) is withdrawn in light of Applicant’s amendments. The rejection of claims 48-50 under 35 U.S.C. 103 as being obvious over Reuber et al (US 7,858,848 B2) taken with the evidence of GenBank accession AY957396 is withdrawn in light of Applicant’s amendments. The rejection of claims 32-38 & 45-50 under 35 U.S.C. 103 as being obvious over Kovalic et al US 2017/0314037 A1 in view of Alexandrov et al US 2013/0139278 A1 and GenBank accession BD493263.1 is withdrawn in light of Applicant’s amendments. Claim Objections Claims 47 & 50 are objected to because of the following informalities: Claim 47 (line 4): “seeds,” should read --seeds;”. Claim 50 (line 3): there is no subject to “has increased”. Adding --the transgenic plant-- or wording similar before “has increased” is recommended. Appropriate correction is required. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 47 & 50 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Due to Applicant' s amendment of the claims, the rejection is modified from the rejection set forth in the Office action mailed 11/3/2025, as applied to claims 32-38, 45-47 & 50. Applicant’s arguments filed 1/29/2026 have been considered but are found unpersuasive. Claims 47 (line 3) requires increasing biomass. “Increasing” is a relative term, but claim 47 does not specify what standard the biomass is increased relative to. It is suggested that wording such as “compared to a wildtype rice plant” (similar to wording found in claim 45 of the claimset filed 10/6/2025) be added to claim 47 after “production of seeds” to overcome the relative language. Furthermore, claim 47 requires “at least 30% the production of seeds”. The plain language interpretation of this limitation is that only at least 30% production of seeds is required. However, this characteristic is part of a Markush group of “improved agronomic characteristics”, and 30% of the production of seeds would not generally be considered an improvement. The limitation could be interpreted to mean an improvement of increased biomass with at least 30% production of seeds maintained. Alternatively, this limitation could be interpreted to mean increasing the production of seeds by at least 30%. Because there are two distinct interpretations of this limitation, claim 47 (line 4) is indefinite. Claim 50 recites the limitation "the native grass-monocotyledonous, non-grass monocotyledonous or dicotyledonous plant" in lines 2-3. There is insufficient antecedent basis for this limitation in the claim, because claim 48 recites only a transgenic plant not a native plant. Claim 50 requires a “native” grass-monocotyledonous, non-grass monocotyledonous or dicotyledonous plant" in lines 2-3. One of ordinary skill in the art would understand “native” plant to mean a plant that has originated in a geographic location. However, Applicant is using the “native” plant as a reference of comparison to a transgenic plant. It is unclear if the transgenic plant of claim 50 is required to be grown in a specific geographic area or if Applicant is acting as his or her own lexicographer to redefine “native”. Where applicant acts as his or her own lexicographer to specifically define a term of a claim contrary to its ordinary meaning, the written description must clearly redefine the claim term and set forth the uncommon definition so as to put one reasonably skilled in the art on notice that the applicant intended to so redefine that claim term. Process Control Corp. v. HydReclaim Corp., 190 F.3d 1350, 1357, 52 USPQ2d 1029, 1033 (Fed. Cir. 1999). The term “native” in claim 50 is indefinite because the specification does not clearly redefine the term. Applicant urges that the claims have been amended (Remarks, page 5, paragraph 11). This argument is unpersuasive, because the claims have not been amended to address the rejections regarding the intended definition of “native” (claim 50), the antecedent basis for "the native grass-monocotyledonous, non-grass monocotyledonous or dicotyledonous plant" (claim 50), the relative term of “increasing” (claim 47), or the meaning of “at least 30% the production of seeds” (claim 47). Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 48 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Van Eck et al (2014) Setaria viridis in Wang (ed.), Agrobacterium Protocols: 1, Methods in Molecular Biology, vol. 1223: pages 57-67 (hereafter Van Eck), taken with the evidence of NCBI reference sequence XM_034727194.1 (available 5/25/2020). This is a new rejection necessitated by amendment. Applicant’s arguments filed 1/29/2026 have been considered to the extent they apply to the new rejection but are not persuasive. Claim 48 is drawn to a transgenic grass-monocotyledonous plant comprising a nucleic acid sequence encoding a RAMOSA1 transcription factor, wherein the nucleic acid sequence is SEQ ID NO: 2. Claim 48 does not require that the nucleic acid sequence of SEQ ID NO: 2 is a transgene. Van Eck discloses a method of transforming Setaria viridis of variety A10.1 with Agrobacterium (figure 1) and growng the transgenic plants to maturity in a growth chamber (page 66, step 9). S. viridis is in the Poaceae family (page 57, paragraph 1), which reads on a grass monocot plant. Although Van Eck is silent as to the presence of a nucleic acid of SEQ ID NO: 2 in S. viridis, NCBI reference sequence XM_034727194.1 discloses a mRNA sequence from S. viridis cultivar A10 with 100% sequence identity to instant SEQ ID NO: 2. See alignment below; SEQ ID NO: 2 is on top. Although the sequence was not available online until 2020, the transformed plants of Van Eck disclosed in 2014 would have comprised a mRNA nucleic acid sequence of SEQ ID NO: 2, and thus the T1 transgenic plants of Van Eck anticipate claim 48. PREDICTED: Setaria viridis transcriptional regulator SUPERMAN-like (LOC117846092), mRNA Sequence ID: XM_034727194.1Length: 893Number of Matches: 1 Related Information Genome Data Viewer-aligned genomic context Range 1: 26 to 547GenBankGraphicsNext MatchPrevious Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 965 bits(522) 0.0 522/522(100%) 0/522(0%) Plus/Plus Query 1 ATGGAGAGAGATGATGGCTACACCAAGCTTCAGCAGCTACCTTGCAGCGACAACTTCAGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 26 ATGGAGAGAGATGATGGCTACACCAAGCTTCAGCAGCTACCTTGCAGCGACAACTTCAGC 85 Query 61 TTGGCCGCCTCCTCTTCATGGCCGTCGCCACAGATAAGGTCGTCGTCCTCCGCGACGTCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 86 TTGGCCGCCTCCTCTTCATGGCCGTCGCCACAGATAAGGTCGTCGTCCTCCGCGACGTCC 145 Query 121 CACATCTGCGGGTATTGCAAGAGGGAGTTCAGGTCAGCACAAGGGCTGGGAGGTCACATG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 146 CACATCTGCGGGTATTGCAAGAGGGAGTTCAGGTCAGCACAAGGGCTGGGAGGTCACATG 205 Query 181 AACGTCCACAGGTTGGACAGGGCCAGGCTGATCCACCACCAGTGCTCCTCACACCACCAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 206 AACGTCCACAGGTTGGACAGGGCCAGGCTGATCCACCACCAGTGCTCCTCACACCACCAT 265 Query 241 CTAGCTCTTGCTGCTCCCCCTCCAAACCCTAACCCTAGTCGCGCAGTTGTTGAACTCATG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 266 CTAGCTCTTGCTGCTCCCCCTCCAAACCCTAACCCTAGTCGCGCAGTTGTTGAACTCATG 325 Query 301 AGCTCAGGTTGTCGCGCGCACGGTGCTGCCAGCGATGGAGGCTCGGCTGTGCCGCCAGCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 326 AGCTCAGGTTGTCGCGCGCACGGTGCTGCCAGCGATGGAGGCTCGGCTGTGCCGCCAGCG 385 Query 361 GCAAAGCCGGGCGTCTGCCGTTTCTCCTTGGCATCGTCGTCGTCCGCCTTGACAAAGGAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 386 GCAAAGCCGGGCGTCTGCCGTTTCTCCTTGGCATCGTCGTCGTCCGCCTTGACAAAGGAC 445 Query 421 ATCGAGGCGATCAAGAACTTGGAGTTGAGGATGGGAGCGTGCAGCCATGGCGACGACGCG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 446 ATCGAGGCGATCAAGAACTTGGAGTTGAGGATGGGAGCGTGCAGCCATGGCGACGACGCG 505 Query 481 GAAGAGCGTCTGGATCTAGAGCTAAGACTTGGCCACTCCTGA 522 |||||||||||||||||||||||||||||||||||||||||| Sbjct 506 GAAGAGCGTCTGGATCTAGAGCTAAGACTTGGCCACTCCTGA 547 Applicant urges that claim 48 requires a “recombinant DNA construct stably integrated” comprising SEQ ID NO: 2 and so every element is not found in the prior art (Remarks, page 6, paragraphs 1-3). This argument is unpersuasive, because a “recombinant DNA construct stably integrated” comprising SEQ ID NO: 2 is not found in claim 48 or any of the examined claims of the claim set filed 1/29/2026. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claim(s) 32, 47-48 & 50 are rejected under 35 U.S.C. 103 as being unpatentable over Kovalic et al US 2017/0314037 A1 (published 11/2/2017, hereafter Kovalic) in view of GenBank CM009912.1, bases 110431627 to 110432154 (available 6/13/2018) and in view of NCBI Reference Sequence: XM_004956727.1 (available 10/13/2017). This is a New Rejection due to Applicant' s amendment of the claims. Applicant’s arguments filed 1/29/2026 have been considered as they apply to the current rejection but are found unpersuasive. Claims 32 & 47 are drawn to a method to improve agronomic characteristics of a rice plant comprising genetically transforming the rice plant with a nucleic acid sequence encoding a RAMOSA1 transcription factor and claims 48 & 50 are drawn to a transgenic plant comprising a nucleic acid sequence of SEQ ID NO: 2 encoding a RAMOSA1 transcription factor. Kovalic teaches a nucleic acid sequence (Kovalic SEQ ID NO: 3097). Kovalic SEQ ID NO: 3097 encodes an amino acid sequence of Kovalic SEQ ID NO: 46472, as provided in the sequence listing entry for Kovalic SEQ ID NO: 3097. Kovalic teaches a transgenic rice seed comprising transgenic cells comprising a DNA construct encoding a protein of Kovalic SEQ ID NO: 46472 operably linked to a promoter functional in a plant and stably integrated into a chromosome, providing for increased yield (Kovalic claim 11). Kovalic teaches promoters that can be used in plant cells such as a rice actin promoter or maize aldolase promoter (paragraph [0064]) and teaches that promoters can be altered to contain multiple enhancer sequences to elevate gene expression (paragraph [0065]). Kovalic teaches that the expression of the DNA constructs provide the enhanced agronomic trait (paragraph [00063]). Kovalic teaches that an enhanced trait includes enhanced agronomic traits such as enhanced morphology, physiology, growth and development, yield, nutritional enhancement, disease or pest resistance, or environmental or chemical tolerance and also teaches that increased yield can be measured as seed number per plant (paragraph [0026-0027]). Kovalic envisions a use of the plants wherein seeds of the invention are planted, grown and harvested to produce a crop or terminal crop (paragraph [0028]). Kovalic also envisions a method of screening a population of transgenic plants for enhanced traits relative to a control plant (Kovalic claim 13). Kovalic does not teach a nucleic acid of SEQ ID NO: 2 and does not explicitly teach that the improved agronomic characteristics comprise increased biomass and seed production, including increased biomass of at least 50% and at least 30% the production of seeds. GenBank CM009912.1 teaches that a nucleic acid sequence with 100% sequence identity to Kovalic SEQ ID NO: 3097 is a “SUP” gene encoding the transcriptional regulator SUPERMAN. See alignment below, Kovalic SEQ ID NO: 3097 is on top. Score Expect Identities Gaps Strand 976 bits(528) 0.0 528/528(100%) 0/528(0%) Plus/Plus Query 1 ATGGAGGGAGAAGATGACGGCGCCCAAATGAAACTGCAGCAACAACAACAGTCGCCTTGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATGGAGGGAGAAGATGACGGCGCCCAAATGAAACTGCAGCAACAACAACAGTCGCCTTGC 60 Query 61 AGTGACAACTTGAGCTTGTCCGCCGCCTCCTCATGGCTGCCGCCACAGGTAAGgtcgtcg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 AGTGACAACTTGAGCTTGTCCGCCGCCTCCTCATGGCTGCCGCCACAGGTAAGGTCGTCG 120 Query 121 tcgtcgtcgtcgtcgtACACCTGCGGGTATTGCAAGAAGGAGTTCAGATCAGCACAAGGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 TCGTCGTCGTCGTCGTACACCTGCGGGTATTGCAAGAAGGAGTTCAGATCAGCACAAGGG 180 Query 181 CTGGGAGGCCACATGAACATCCACAGGCTGGACAGGGCCAGACTGATCCACCAACAGTAC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 CTGGGAGGCCACATGAACATCCACAGGCTGGACAGGGCCAGACTGATCCACCAACAGTAC 240 Query 241 ACTTCACACCGTATTGCTGCTCCCCATCCAAACCCTAATCCTAGTTGCACATCAGTTCTT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 ACTTCACACCGTATTGCTGCTCCCCATCCAAACCCTAATCCTAGTTGCACATCAGTTCTT 300 Query 301 GACCTTGAGCTCAGCTTGTCGTCGCTGCTAGCGCATGGTGCTGCCAGCAGCGACGGAGGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 GACCTTGAGCTCAGCTTGTCGTCGCTGCTAGCGCATGGTGCTGCCAGCAGCGACGGAGGC 360 Query 361 TTGTCTGTTCCAGTGGCAAAGCTGGCGGGCAACCGTTTCTCCTCCGCATCGCTCCCCACG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 TTGTCTGTTCCAGTGGCAAAGCTGGCGGGCAACCGTTTCTCCTCCGCATCGCTCCCCACG 420 Query 421 ACCAAGGACGTCGAGGGGAAGAACTTAGAGTTGAGGATAGGAGCGTGCAGTCATGGCGAT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 ACCAAGGACGTCGAGGGGAAGAACTTAGAGTTGAGGATAGGAGCGTGCAGTCATGGCGAT 480 Query 481 GGCGCGGAAGAGCGTCTGGATCTTCAGCTTAGACTGGGCTACTACTGA 528 |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 481 GGCGCGGAAGAGCGTCTGGATCTTCAGCTTAGACTGGGCTACTACTGA 528 NCBI Reference Sequence: XM_004956727.1 teaches a nucleic acid sequence from Setaria italica encoding a transcriptional regulator SUPERMAN with 100% sequence identity to instant SEQ ID NO: 2. See alignment below; instant SEQ ID NO: 2 is on the top. Score Expect Identities Gaps Strand 965 bits(522) 0.0 522/522(100%) 0/522(0%) Plus/Plus Query 1 ATGGAGAGAGATGATGGCTACACCAAGCTTCAGCAGCTACCTTGCAGCGACAACTTCAGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATGGAGAGAGATGATGGCTACACCAAGCTTCAGCAGCTACCTTGCAGCGACAACTTCAGC 60 Query 61 TTGGCCGCCTCCTCTTCATGGCCGTCGCCACAGATAAGGTCGTCGTCCTCCGCGACGTCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 61 TTGGCCGCCTCCTCTTCATGGCCGTCGCCACAGATAAGGTCGTCGTCCTCCGCGACGTCC 120 Query 121 CACATCTGCGGGTATTGCAAGAGGGAGTTCAGGTCAGCACAAGGGCTGGGAGGTCACATG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 121 CACATCTGCGGGTATTGCAAGAGGGAGTTCAGGTCAGCACAAGGGCTGGGAGGTCACATG 180 Query 181 AACGTCCACAGGTTGGACAGGGCCAGGCTGATCCACCACCAGTGCTCCTCACACCACCAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 181 AACGTCCACAGGTTGGACAGGGCCAGGCTGATCCACCACCAGTGCTCCTCACACCACCAT 240 Query 241 CTAGCTCTTGCTGCTCCCCCTCCAAACCCTAACCCTAGTCGCGCAGTTGTTGAACTCATG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 241 CTAGCTCTTGCTGCTCCCCCTCCAAACCCTAACCCTAGTCGCGCAGTTGTTGAACTCATG 300 Query 301 AGCTCAGGTTGTCGCGCGCACGGTGCTGCCAGCGATGGAGGCTCGGCTGTGCCGCCAGCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 301 AGCTCAGGTTGTCGCGCGCACGGTGCTGCCAGCGATGGAGGCTCGGCTGTGCCGCCAGCG 360 Query 361 GCAAAGCCGGGCGTCTGCCGTTTCTCCTTGGCATCGTCGTCGTCCGCCTTGACAAAGGAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 361 GCAAAGCCGGGCGTCTGCCGTTTCTCCTTGGCATCGTCGTCGTCCGCCTTGACAAAGGAC 420 Query 421 ATCGAGGCGATCAAGAACTTGGAGTTGAGGATGGGAGCGTGCAGCCATGGCGACGACGCG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 421 ATCGAGGCGATCAAGAACTTGGAGTTGAGGATGGGAGCGTGCAGCCATGGCGACGACGCG 480 Query 481 GAAGAGCGTCTGGATCTAGAGCTAAGACTTGGCCACTCCTGA 522 |||||||||||||||||||||||||||||||||||||||||| Sbjct 481 GAAGAGCGTCTGGATCTAGAGCTAAGACTTGGCCACTCCTGA 522 Before the filing date of the instant application, it would have been obvious to one of ordinary skill in the art to modify the method of producing the plants of Kovalic to substitute a nucleic acid of SEQ ID NO: 2 for Kovalic SEQ ID NO: 3097. One of ordinary skill in the art would have been motivated to use a nucleic acid of SEQ ID NO: 2 because this sequence was known in Setaria italica to encode a SUPERMAN transcriptional regulator, and the sequence of Kovalic SEQ ID NO: 2 had also been annotated as a SUPERMAN transcriptional regulator in maize. Substitution of one gene homolog for another in another species would have been an obvious design choice. One of ordinary skill in the art would have had reasonable expectation of success because both sequences had been annotated as SUPERMAN genes in Poaceae species. Furthermore, one of ordinary skill in the art would have been motivated to overexpress the nucleic acid sequence with a plant promoter, because Kovalic teaches plant promoters suitable for the expression of the nucleic acid sequence and teaches using enhancers to elevate expression, which reads on overexpression. One of skill in the art would have been motivated to elevate expression in order to provide the enhanced agronomic trait. One of skill in the art would have had reasonable expectation of success, because the selection and use of plant promoters to express transgenes was routine in the art at the time of filing of the instant application. Thus, claim 32 would have been obvious to one of ordinary skill in the art. Kovalic teaches increased yield as a result of transforming a plant with a nucleic acid, which reads on increased biomass and/or seed production. While Kovalic does not explicitly teach that biomass is increased at least 50% in a transformed rice plant, or at least 30% the production of seeds, these traits are results of the transformation of a rice plant with this sequence. It would have been obvious to one of ordinary skill in the art to screen transformants for enhanced traits, as taught by Kovalic, and to select a rice plant with biomass increased at least 50% or at least 30% the production of seeds. Kovalic teaches a method wherein the transformed plant is cultivated, either to produce a crop or terminal crop or to compare phenotypically to a control plant. This reads on cultivating the rice plant after transformation under conditions that promote its growth (claims 47). Finally, the transformed rice plants comprising a construct of instant SEQ ID NO: 2 read on the transgenic grass-monocotyledonous plant of instant claim 48. Such a plant would have increased biomass, seed production, and life cycle (instant claim 50) because, as presented above, those phenotypes would be an inherent result of transforming a rice plant with a construct comprising a nucleic acid sequence of a SUPERMAN transcriptional regulator like instant SEQ ID NO: 2. Applicant urges that amended claims require SEQ ID NO: 2 whereas Kovalic teaches SEQ ID NO: 1. Applicant urges that there is no motivation to substitute SEQ ID NO: 2 for maize RAMOSA1 sequences because the cited references provide no teaching, suggestion or motivation to replace maize RAMOSA1 sequences with SEQ ID NO: 2 nor to do so in rice (Remarks, page 6, paragraph 6-page 7 paragraph 2). This argument is unpersuasive, because the sequence of Kovalic with 100% identity to SEQ ID NO: 1 also has 100% sequence identity to a transcript in maize that was annotated as a SUPERMAN gene before the filing of the instant application. The sequence of instant SEQ ID NO: 2 is identical to a sequence known in the art prior to the filing of the instant application annotated to be a SUPERMAN gene. Thus, both SEQ ID NO: 1 and SEQ ID NO: 2 were taught in the art to be SUPERMAN genes prior to the filing of the instant application. It would have been obvious to one of ordinary skill in the art to substitute a homologous gene from one grass species for another, or for expression in another grass species, as part of routine design. Applicant urges that the improved agronomic traits recited by the claims are sequence and species specific and not inherent to RAMOSA1 overexpression. Applicant urges that transcription factors are highly context-dependent. Because the cited references do not establish that overexpression of SEQ ID NO: 2 in rice would necessarily and inevitably result in the recited quantitative thresholds, Applicant urges that the recited quantitative thresholds are not obvious or inherent over the cited references (Remarks, page 7, paragraphs 3-4). This argument is unpersuasive. First, in regard to claims 32 & 47, the method is “to improve agronomic characteristics”, but there is no active step wherein a plant with the recited agronomic characteristics is recovered. Second, Kovalic teaches the expression in rice of a maize nucleic acid sequence that was known in the art to encode a protein homologous to the protein encoded by instant SEQ ID NO: 2. Substitution of a homologous gene for another would have been obvious to one of skill in the art, and so the combination of the sequence and species required by the claims would have been obvious prior to the filing of the instant application whether or not increasing biomass at least 50%, at least 30% the production of seeds, or increased biomass, seed production and life cycle was a known effect of the combination. The motivation to combine elements does not need to be Applicant’s own in order to be obvious. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Victoria L DeLeo whose telephone number is (703)756-5998. The examiner can normally be reached M-F 8:00am-12pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at (571) 270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /VICTORIA L DELEO/ Examiner, Art Unit 1662 /Anne Kubelik/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Sep 17, 2021
Application Filed
Oct 03, 2024
Non-Final Rejection — §102, §103, §112
Apr 08, 2025
Response Filed
Jun 02, 2025
Final Rejection — §102, §103, §112
Sep 12, 2025
Response after Non-Final Action
Oct 06, 2025
Request for Continued Examination
Oct 07, 2025
Response after Non-Final Action
Oct 30, 2025
Non-Final Rejection — §102, §103, §112
Jan 29, 2026
Response Filed
Apr 06, 2026
Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584117
Use of Gene Encoding Gibberellin 3Beta-Hydroxylase of Glycine Max, GmGA3ox1
2y 5m to grant Granted Mar 24, 2026
Patent 12577577
COMPOSITIONS AND METHODS TO INCREASE RESISTANCE TO PHYTOPHTHORA SOJAE IN SOYBEAN
2y 5m to grant Granted Mar 17, 2026
Patent 12545926
NUCLEIC ACID MOLECULES FOR CONFERRING INSECTICIDAL PROPERTIES IN PLANTS
2y 5m to grant Granted Feb 10, 2026
Patent 12522839
USE OF ZLMYB1 AND ZLMYB2 GENES FROM ZIZANIA LATIFOLIA IN INCREASING ANTHOCYANIDIN CONTENT OF RICE SEED
2y 5m to grant Granted Jan 13, 2026
Patent 12460220
METHOD FOR PROMOTING EXPRESSION OF FOREIGN GENE IN SOYBEAN, ARABIDOPSIS OR TOBACCO USING GENE PROMOTER pEIF1 OR pEIF1-I
2y 5m to grant Granted Nov 04, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

5-6
Expected OA Rounds
38%
Grant Probability
-2%
With Interview (-40.0%)
2y 6m
Median Time to Grant
High
PTA Risk
Based on 21 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month