DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 06/26/2025 was entered.
Election/Restrictions
Claims 1, 13-25 are pending.
Claims 1, 15, 22-25 are examined here. Applicant had elected Group I invention, i.e. product claim, an agent that binds to SARS-CoV-2, in the reply filed on 02/14/2023. Thus, product claims 22, 24 are rejoined.
Claims 13-14, 16-21 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 02/14/2023.
The elected species (SEQ ID NO: 1, 4, 7) was canceled earlier, with an action received on non-elected species. The species election of 12/16/2022 is withdrawn and all species are considered rejoined.
Priority
It should be noted that SEQ ID NOs: 2/5/8 or SEQ ID NOs: 3/6/9 are not supported by the priority document, provisional application 63/094036.
Thus, current claims 1, 15, 22- 25 enjoy the benefit of 10/20/2021 filing.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 15, 22-25 are rejected under 35 U.S.C. 103 as being unpatentable over Crooke et al. (US20050100885, pub. 05/12/2005, referred hereafter as Crooke ‘885) and Crooke et al. (2008, in Antisense Drug Technology, Ed. Crooke, Ch. 1, pg. 3-46, referred as Crooke) and Akinc et al. (WO2021195307, pub. 09/30/2021, referred as Akinc).
SEQ ID NOs: 2, 5 and 8 are the following 26 nt. sequence: aagaagcuauuaaaaucacaugggga (cl. 1).
SEQ ID NO: 3, 6, and 9 are uaggcagcuc ucccuagcau ugu, a 23 nt. sequence (cl. 1, 23)
Crooke ‘885 discloses oligomeric compounds targeting SARS virus and discloses a range of sequences from SEQ ID NO: 29691-29703 that target SARS-Coronavirus (SARS-CoV) and the range of identity is 20/20 to 16/20 nt. with instant SEQ ID NO: 2/5/8. An alignment for SEQ ID NO: 29695 and SEQ ID NO: 29701 are provided below (the bolded/underlined portion of SEQ ID NO: 2/8 above); both ASO cover the whole span of instant SEQ ID NO: 2/5/8. Thus, Crooke ‘885 discloses a 20 nt. sequence portion of SEQ ID NO: 2/8. Further Crooke ‘885 discloses that oligonucleotide can be of 8-80 nt. in length (cl. 1), and that the ends of the strands may be modified by the addition of one or more natural modified nucleobase (par. 404; it should be noted that there appears to be par. discrepancy between hard copy pub. and Google pub.; e.g. here Google pub. par. 404 corresponds to par. 455 in hard copy pub.; Examiner will use the Google pub. par. #s); and provides embodiments of oligonucleotides of varying lengths (20 and 32 nt. in length; Table 9).
RESULT 27
US-10-831-901A-29695
Sequence 29695, US/10831901A
Publication No. US20050100885A1
GENERAL INFORMATION
APPLICANT: Crooke, Stanley T.
APPLICANT: Ecker, David J.
APPLICANT: Sampath, Rangarajan
APPLICANT: Freier, Susan M.
APPLICANT: Massire, Christian
APPLICANT: Hofstadler, Steven A.
APPLICANT: Lowery, Kristin Sannes
APPLICANT: Swayze, Eric
APPLICANT: Baker, Brenda F.
APPLICANT: Bennett, C. Frank
TITLE OF INVENTION: Compositions And Methods For The Treatment Of Severe
TITLE OF INVENTION: Acute Respiratory Syndrome (SARS)
FILE REFERENCE: ISIS0083-100 (BIOL0008US)
CURRENT APPLICATION NUMBER: US/10/831,901A
CURRENT FILING DATE: 2004-04-26
PRIOR APPLICATION NUMBER: 60/466,426
PRIOR FILING DATE: 2003-04-28
PRIOR APPLICATION NUMBER: 60/468,562
PRIOR FILING DATE: 2003-05-06
PRIOR APPLICATION NUMBER: 60/467,770
PRIOR FILING DATE: 2003-04-30
PRIOR APPLICATION NUMBER: 60/468,627
PRIOR FILING DATE: 2003-05-06
PRIOR APPLICATION NUMBER: 60/477,637
PRIOR FILING DATE: 2003-06-10
PRIOR APPLICATION NUMBER: 60/483,579
PRIOR FILING DATE: 2003-06-27
NUMBER OF SEQ ID NOS: 30063
SEQ ID NO 29695
LENGTH: 20
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense compound
Query Match 76.9%; Score 20; Length 20;
Best Local Similarity 75.0%;
Matches 15; Conservative 5; Mismatches 0; Indels 0; Gaps 0;
Instant SEQ ID NO: 2 7 CUAUUAAAAUCACAUGGGGA 26
|:|::||||:||||:|||||
Crooke SEQ ID NO: 29695 1 CTATTAAAATCACATGGGGA 20
Instant SEQ ID NO: 2 1 AAGAAGCUAUUAAAAUCACA 20
|||||||:|::||||:||||
Crooke SEQ ID NO: 29701 1 AAGAAGCTATTAAAATCACA 20
Crooke ‘885 discloses the antisense strand can be modified with a LNA modification (par. 132-139); par. 401 (or Table 6) provides various oligonucleotides that target SARS and are uniformly LNA modified (relevant to instant cl. 1iv). Crooke ‘885 also discloses 2’-sugar substituent including arabino (up) position and a suitable 2’-arabino modification is 2’-F, i.e. instant 2’-deoxy-2’-fluoroarabino (par. 145, relevant to instant cl. 1iii, 22). Crooke ‘885 discloses oligomeric compounds that can be utilized in pharmaceutical composition with suitable diluents (par. 283, relevant to instant cl. 15, 24).
Akinc discloses a siRNA Duplex ID AD-1184291 (also referred as AD-1231477.1), which is a duplex ID with sense and antisense strands , which targets the sequence 5’ TCCCCATGTGATTTTAATAGCTT of SARS-CoV-2 virus (SEQ ID NO: 1793 is the target sequence, AD-1184291 comprises SEQ ID NOs: 371 and 726; pg. 181). Table 6 discloses Duplex ID AD-1184291.1 discloses that there is ~93% inhibition of reporter gene containing the target sequence (Table 6, pg. 208, see excerpt below).
PNG
media_image1.png
105
528
media_image1.png
Greyscale
Further, AD-1231477.1 demonstrates in a dose response study inhibition of viral target sequence fused to luciferase expression vector (pg. 205, Table 5 shows sequence of AD-1231477; pg. 216, Table 7 shows 10 nM with 13.7% mRNA remaining). Thus, it shows that the antisense oligonucleotide will bind to its target sequence.
Thus, SEQ ID NO 29695 (CTATTAAAATCACATGGGGA) of Crooke ‘885, corresponding to instant SEQ ID NO: 2/5/8 pos. 7-26 and is complementary to 5’ TCCCCATGTGATTTAATAG, inherently will bind to its complementary sequence, as evidenced by Akinc.
However, Crooke ‘885 does not disclose a full length oligonucleotide of SEQ ID NO: 2/5/8.
Crooke discloses that to exploit fully the theoretical potential for specificity of an oligonucleotide in a therapeutic context it is necessary to manipulate the length of the oligonucleotide and its concentration at target (pg. 13).
Although Crooke ‘885 does not disclose the binding of the oligomeric compound to SARS-CoV-2 or preventing and/or disrupting the interaction of recited microRNAs, the inherent function of the oligomer would be to bind to its complementary strand, here in SARS-CoV-2, and therefore would prevent/disrupt binding of microRNAs to a region of SARS-CoV.
Under MPEP 2112(V): "[T]he PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his [or her] claimed product. Whether the rejection is based on ‘inherency’ under 35 U.S.C. 102, on ‘prima facie obviousness’ under 35 U.S.C. 103, jointly or alternatively, the burden of proof is the same." In re Best, 562 F.2d 1252, 1255, 195 USPQ 430, 433-34 (CCPA 1977) (footnote and citation omitted).
The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings:
(1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Here, as Akinc points out that coronavirus (CoV) causes illness ranging from cold to more severe diseases, and, specifically, points out that SARS-CoV-2, a novel coronavirus, was a “a major threat to public health worldwide” resulting in 2,600 deaths with “no specific antiviral treatments available or proven to be effective to treat or prevent coronavirus infection in subjects” (pg. 1-2). Here, Crooke ‘885 discloses various ASOs that inherently target SARS-CoV-2 based on Watson-Crick complementary binding, while both Crooke ‘885 and Crooke disclose that to optimize the ASO requires varying its length.
One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the LNA-modified ASO SEQ ID NO: 29695 of Crooke ‘885 in view of Akinc and Crooke and arrive at the claimed invention with a reasonable expectation of success. Based on Crooke’s disclosure of SEQ ID NO: 29,695 that can comprise LNA modification or FANA modification, and Akinc disclosing that inherently that the antisense targeting the same region as Crooke ‘885 results in efficient inhibition of target SARS-CoV-2, and Crooke teaching that various lengths of ASO need to be tested for optimization of the ASO, a skilled artisan would reasonably expect success in inhibition of SARS-CoV-2 and thus preventing binding of recited miRNAs by trying different lengths (20-30 nt.) of ASOs comprising Crooke ‘885’s SEQ ID NO: 29,695 modified with either LNA or FANA (2’-deoxy-2-fluoroarabino) modification. Thus, cl. 1 and 15 are obvious.
Regarding instant cl. 23 and 25, Crooke ‘885 discloses the SEQ ID NOs 29,632, which comprises 20 of 23 nt. of instant SEQ ID NO: 3/6/9 (see alignment below, relevant to instant. cl. 23). Crooke ‘885 discloses oligomeric compounds that can be utilized in pharmaceutical composition with suitable diluents (par. 283, relevant to instant cl. 25). Crooke ‘885 also discloses 2’-sugar substituent including arabino (up) position and a suitable 2’-arabino modification is 2’-F, i.e. instant 2’-deoxy-2’-fluoroarabino (par. 145, relevant to instant cl. 23).
Instant SEQ ID NO: 3 1 UAGGCAGCUCUCCCUAGCAU 20
:|||||||:|:|||:||||:
Crooke ‘885 SEQ ID NO: 29,632 1 TAGGCAGCTCTCCCTAGCAT 20
It should be noted that Uracil and Thymine are functionally equivalent in ASOs and one can be replaced for the other (See Crooke ‘885, par. 442).
Thus, as noted above based on Crooke ‘885 and Crooke, increasing the length of SEQ ID NO: 29,632 would be obvious to try to optimize the function of SEQ ID NO: 29,632, based on disclosed SARS-CoV-2 sequence, and inherently will bind to the target sequence of SARS-CoV-2 and disrupt the binding of the recited miRNA.
Response to Arguments
Applicant's arguments filed 06/26/2025, “the Remarks” along with the Declaration of Mihailescu (the Declaration appears to be incorporated into the Remarks, thus the language quoted below from the Remarks also address the Declaration), have been fully considered but they are not persuasive.
The arguments are that (1) Crooke ‘885 does not disclose SARS-CoV-2, nor the same length as instant SEQ ID NO 2/5/8, and also merely proposes the noted ASO(s) (pg. 9), furthermore, (2) Crooke ‘885 and Akinc fail to disclose the functional element of the recited claim (prevention of binding/disruption of recited microRNA) (pg. 9), and (3) suggest that introduction of double mutations introduced 3’-UTR (specifically in the DIS-s2m for FANA-34a and within the 3’-UTR terminus for FANA-760) in the target sequence can result in severely reduced effectiveness of the oligonucleotides (pg. 9-10).
The arguments are not persuasive.
Addressing (1) Crooke ‘885 not disclosing SARS-CoV-2, this argument fails to consider other arts cited, specifically Akinc, which discloses the same target sequence within SARS-CoV-2 as Crooke ‘885’s SARS-CoV and Akinc is able to inhibit the SARS-CoV-2 expression levels targeting the same region, illustrating that the target sequence is accessible. Second, Akinc’s observation confirms the inherency of ASOs (SEQ ID NO: 29695) of Crooke’ 885, that a known ASO will inherently bind to its complementary target sequence. Thus, once a modified ASO binds to its target sequence it will also prevent binding of recited miRNAs to the same target sequence on the SARS-CoV-2 virus, thus reading on the functional element of the claims (argument 2).
Regarding the cited art not disclosing the exact length sequence length as instant claims, modification of ASOs length is well-known in the art, in fact, Crooke ‘885 discloses that a nt. can be added to a ASO. Further, Monia et al. (1992, J. of Biol. Chem., 267, pg. 19954-19962) discloses that a nt. can be added at either end of an ASO; the authors begin with an ASO of 5 nt. and add nt. at both ends until getting an ASO of 25 nt. in length (see Fig. 1, pg. 19956). Thus, elongating an ASO at either or both end to optimize its function is not novel.
Further, the Remarks (and Declaration) and the specification fail to provide evidence why the difference in ASO length is patentably distinct, i.e. currently, SEQ ID NO: 29,695 of Crooke ‘885, is 20 nt., it would still perform the function of binding to SARS-CoV-2 and prevent binding of the recited miRNA, so it is not patentably distinct from instant SEQ ID NO: 2/5/8, a 26 nt. sequence.
Regarding (3) Fig. 1 of Declaration noting that FANA-760 and FANA-34 (i.e. SEQ ID NO: 5 and 6, respectively) show inhibition of the luciferase reporter that contains SARS-CoV-3’-UTR and that upon introduction of double mutations within the 3’-UTR abrogates the inhibition of the reporter gene. Here, the art of record discloses the target sequence on the SARS-CoV-2 being accessible for binding to a ASO, thus it is reasonable to expect by a skilled artisan that noted ASOs with complementarity will bind to the SARS-CoV-2 and disrupt binding by miRNAs that will bind to the same sequence. Further, here the Declaration and the Remarks do not disclose where the double mutations are on the 3’-UTR of the virus. A skilled artisan appreciates that even single nt. mutation in a RNA sequence can alter its 2D or 3D structural conformation, and may make a previous accessible sequence inaccessible to bind to complementary sequence.
Further, the argument regarding “experiments done in Figure 8 of Appendix A [citing a Frye article] were done in context of entire 3’-UTR, which is stronger data than if isolated target sequence had been used” (pg. 10). The argument does not provide evidence or a rationale why an entire 3’-UTR would be a “stronger data.” Here the noted SEQ ID NOs of prior art will inherently bind to its complementary sequence, and the evidence does not provide evidence that modulating the length of the target sequence will interfere with the binding of the ASO to its target sequence.
Thus, the examined claims remain rejected.
Allowable Subject Matter
Claims 1, 15, 22-25 are not allowable.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600