Prosecution Insights
Last updated: October 04, 2026
Application No. 17/451,521

MICRO RNA INTERACTIONS AS THERAPEUTIC TARGETS FOR COVID-19 AND OTHER VIRAL INFECTIONS

Final Rejection §103
Filed
Oct 20, 2021
Priority
Oct 20, 2020 — provisional 63/094,036
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Duquesne University Of The Holy Spirit
OA Round
6 (Final)
49%
Grant Probability
Moderate
7-8
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 49% of resolved cases
49%
Career Allowance Rate
38 granted / 77 resolved
-10.6% vs TC avg
Strong +61% interview lift
Without
With
+60.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
42 currently pending
Career history
123
Total Applications
across all art units

Statute-Specific Performance

§101
5.2%
-34.8% vs TC avg
§103
35.7%
-4.3% vs TC avg
§102
17.0%
-23.0% vs TC avg
§112
25.5%
-14.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 77 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Amended claims 1, 13-14, 16-25 are pending and claims 26 and 27 are new. Claims 1, 15, 22-27 are examined here. Claims 13-14, 16-21 stand withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 02/14/2023. The elected species (SEQ ID NO: 1, 4, 7) were canceled earlier, with an action issued on non-elected species. The species election of 12/16/2022 is withdrawn and all species are considered rejoined. Priority It should be noted that SEQ ID NOs: 5 or SEQ ID NOs: 6 are not supported by the priority document, provisional application 63/094036. Thus, current claims 1, 15, 22- 27 enjoy the benefit of 10/20/2021 filing. Claim Rejections - 35 USC § 103 Rejection of claims 1, 15, 22-25 is maintained and new claims 26 and 27 are rejected as noted below. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 15, 22-27 are rejected under 35 U.S.C. 103 as being unpatentable over Crooke et al. (US20050100885, pub. 05/12/2005, referred hereafter as Crooke ‘885) and Crooke et al. (2008, in Antisense Drug Technology, Ed. Crooke, Ch. 1, pg. 3-46, referred as Crooke) and Akinc et al. (WO2021195307, pub. 09/30/2021, referred as Akinc). SEQ ID NO: 5 is the following 26 nt. sequence: aagaagcuauuaaaaucacaugggga (cl. 1, 22, 26). SEQ ID NO: 6, is uaggcagcuc ucccuagcau ugu, a 23 nt. sequence (cl. 1, 23, 27) Regarding instant cl. 1, 15, 22, 24, and 26, Crooke ‘885 discloses oligomeric compounds targeting SARS virus and discloses a range of sequences from SEQ ID NO: 29691-29703 that target SARS-Coronavirus (SARS-CoV) and the range of identity is 20/20 to 16/20 nt. with instant SEQ ID NO: 5. An alignment for SEQ ID NO: 29695 and SEQ ID NO: 29701 are provided below (the bolded/underlined portion of SEQ ID NO: 5 above); both ASOs cover the whole span of instant SEQ ID NO: 5. Thus, Crooke ‘885 discloses a 20 nt. sequence portion of SEQ ID NO: 5. Further Crooke ‘885 discloses that oligonucleotide can be of 8-80 nt. in length (cl. 1), and that the ends of the strands may be modified by the addition of one or more natural modified nucleobase (par. 404; it should be noted that there appears to be par. discrepancy between hard copy pub. and Google pub.; e.g. here Google pub. par. 404 corresponds to par. 455 in hard copy pub.; Examiner will use the Google pub. par. #s); and provides embodiments of oligonucleotides of varying lengths (20 and 32 nt. in length; Table 9). RESULT 27 US-10-831-901A-29695 Sequence 29695, US/10831901A Publication No. US20050100885A1 GENERAL INFORMATION APPLICANT: Crooke, Stanley T. APPLICANT: Ecker, David J. APPLICANT: Sampath, Rangarajan APPLICANT: Freier, Susan M. APPLICANT: Massire, Christian APPLICANT: Hofstadler, Steven A. APPLICANT: Lowery, Kristin Sannes APPLICANT: Swayze, Eric APPLICANT: Baker, Brenda F. APPLICANT: Bennett, C. Frank TITLE OF INVENTION: Compositions And Methods For The Treatment Of Severe TITLE OF INVENTION: Acute Respiratory Syndrome (SARS) FILE REFERENCE: ISIS0083-100 (BIOL0008US) CURRENT APPLICATION NUMBER: US/10/831,901A CURRENT FILING DATE: 2004-04-26 PRIOR APPLICATION NUMBER: 60/466,426 PRIOR FILING DATE: 2003-04-28 PRIOR APPLICATION NUMBER: 60/468,562 PRIOR FILING DATE: 2003-05-06 PRIOR APPLICATION NUMBER: 60/467,770 PRIOR FILING DATE: 2003-04-30 PRIOR APPLICATION NUMBER: 60/468,627 PRIOR FILING DATE: 2003-05-06 PRIOR APPLICATION NUMBER: 60/477,637 PRIOR FILING DATE: 2003-06-10 PRIOR APPLICATION NUMBER: 60/483,579 PRIOR FILING DATE: 2003-06-27 NUMBER OF SEQ ID NOS: 30063 SEQ ID NO 29695 LENGTH: 20 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Antisense compound Query Match 76.9%; Score 20; Length 20; Best Local Similarity 75.0%; Matches 15; Conservative 5; Mismatches 0; Indels 0; Gaps 0; Instant SEQ ID NO: 2 7 CUAUUAAAAUCACAUGGGGA 26 |:|::||||:||||:||||| Crooke SEQ ID NO: 29695 1 CTATTAAAATCACATGGGGA 20 Instant SEQ ID NO: 2 1 AAGAAGCUAUUAAAAUCACA 20 |||||||:|::||||:|||| Crooke SEQ ID NO: 29701 1 AAGAAGCTATTAAAATCACA 20 Crooke ‘885 also discloses 2’-sugar substituent including arabino (up) position and a suitable 2’-arabino modification is 2’-F, i.e. instant 2’-deoxy-2’-fluoroarabino (par. 145, relevant to instant cl. 1, 22). Crooke ‘885 discloses oligomeric compounds can be utilized in pharmaceutical composition with suitable diluents (par. 283, relevant to instant cl. 15, 24). Akinc discloses a siRNA Duplex ID AD-1184291 (also referred as AD-1231477.1), which is a duplex ID with sense and antisense strands , which targets the sequence 5’ TCCCCATGTGATTTTAATAGCTT of SARS-CoV-2 virus (SEQ ID NO: 1793 is the target sequence, AD-1184291 comprises SEQ ID NOs: 371 and 726; pg. 181). Table 6 discloses Duplex ID AD-1184291.1 discloses that there is ~93% inhibition of reporter gene containing the target sequence (Table 6, pg. 208, see excerpt below). PNG media_image1.png 105 528 media_image1.png Greyscale Further, in a dose response study, AD-1231477.1 demonstrates inhibition of viral target sequence fused to luciferase expression vector (pg. 205, Table 5 shows sequence of AD-1231477; pg. 216, Table 7 shows 10 nM with 13.7% mRNA remaining). Thus, it shows that the antisense oligonucleotide will bind to its target sequence. Thus, SEQ ID NO 29695 (CTATTAAAATCACATGGGGA) of Crooke ‘885, corresponding to instant SEQ ID NO: 5 pos. 7-26 and is complementary to 5’ TCCCCATGTGATTTAATAG, inherently will bind to its complementary sequence, as evidenced by Akinc. However, Crooke ‘885 does not disclose a full length oligonucleotide of SEQ ID NO: 5. Crooke discloses that to exploit fully the theoretical potential for specificity of an oligonucleotide in a therapeutic context it is necessary to manipulate the length of the oligonucleotide and its concentration at target (pg. 13, relevant to instant cl. 26). Although Crooke ‘885 does not disclose the binding of the oligomeric compound to SARS-CoV-2 or preventing and/or disrupting the interaction of recited microRNAs, the inherent function of the oligomer would be to bind to its complementary strand, here in SARS-CoV-2, and therefore would prevent/disrupt binding of microRNAs to that region of SARS-CoV. Under MPEP 2112(V): "[T]he PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his [or her] claimed product. Whether the rejection is based on ‘inherency’ under 35 U.S.C. 102, on ‘prima facie obviousness’ under 35 U.S.C. 103, jointly or alternatively, the burden of proof is the same." In re Best, 562 F.2d 1252, 1255, 195 USPQ 430, 433-34 (CCPA 1977) (footnote and citation omitted). The KSR’s “obvious to try” rationale for supporting conclusion of obviousness requires the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success. Here, Akinc points out that coronavirus (CoV) causes illness ranging from cold to more severe diseases, and, specifically, points out that SARS-CoV-2, a novel coronavirus, was a “a major threat to public health worldwide” resulting in 2,600 deaths with “no specific antiviral treatments available or proven to be effective to treat or prevent coronavirus infection in subjects” (pg. 1-2). Here, Crooke ‘885 discloses various ASOs that inherently target SARS-CoV-2 based on Watson-Crick complementary binding, while both Crooke ‘885 and Crooke disclose that to optimize the ASO requires varying its length. One of the KSR rationale that may be used to support a conclusion of obviousness is obvious to try. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the FANA-modified ASO SEQ ID NO: 29695 of Crooke ‘885 in view of Akinc and Crooke and arrive at the claimed invention with a reasonable expectation of success. Based on Crooke’s disclosure of SEQ ID NO: 29,695 that can comprise FANA modification, and Akinc disclosing that inherently that the antisense targeting the same region as Crooke ‘885 results in efficient inhibition of target SARS-CoV-2, and Crooke’s teaching that various lengths of ASO need to be tested for optimization of the ASO, a skilled artisan would reasonably expect success in inhibition of SARS-CoV-2 and thus preventing binding of recited miRNAs by trying different lengths (20-30 nt.) of ASOs comprising Crooke ‘885’s SEQ ID NO: 29,695 modified with FANA (2’-deoxy-2-fluoroarabino) modification. Thus, cl. 1, 15, 22, 24, 26 are obvious. Regarding instant cl. 23, 25, 27 Crooke ‘885 discloses the SEQ ID NOs 29,632, which comprises 20 of 23 nt. of instant SEQ ID NO: 6 (see alignment below, relevant to instant. cl. 23). Crooke ‘885 discloses oligomeric compounds that can be utilized in pharmaceutical composition with suitable diluents (par. 283, relevant to instant cl. 25). Crooke ‘885 also discloses 2’-sugar substituent including arabino (up) position and a suitable 2’-arabino modification is 2’-F, i.e. instant 2’-deoxy-2’-fluoroarabino (par. 145, relevant to instant cl. 23). Instant SEQ ID NO: 3 1 UAGGCAGCUCUCCCUAGCAU 20 :|||||||:|:|||:||||: Crooke ‘885 SEQ ID NO: 29,632 1 TAGGCAGCTCTCCCTAGCAT 20 It should be noted that Uracil and Thymine are functionally equivalent in ASOs and one can be replaced for the other (See Crooke ‘885, par. 442). Thus, as noted above based on Crooke ‘885 and Crooke, increasing the length of SEQ ID NO: 29,632 would be obvious to try to optimize the function of SEQ ID NO: 29,632, based on disclosed SARS-CoV-2 sequence, and inherently will bind to the target sequence of SARS-CoV-2 and disrupt the binding of the recited miRNA (relevant to instant cl. 27). Thus, the agent of cl. 23, 25 and 27 would be prima facie obvious. Response to Arguments Applicant's arguments filed 05/01/2026 have been fully considered but they are not persuasive. The Remarks note the submission of Declaration of the inventor "Declaration B" and the prior submitted Declaration of the inventor dated 06/26/2025 ("Declaration A"). The Remarks of 05/01/2026 argue the following: Since Crooke '885 does not provide the full length SEQ IDNO: 5/6, the obvious to try cannot apply because Crooke '885 does not provide a definitive number of options and does not provide any reason to select the sequences recited in the instant claims from the myriad possible agents (pg. 9). "Thus, the assumption that Crooke '885 teaches the selection of SEQ ID NO: 2/3 is invalid" because the rationale does not present a finite number of potential starting compounds (pg. 9); SEQ ID NO: 2/3 are SEQ ID NO: 5/6, respectively. And, as argued and addressed previously, the secondary references do not provide "any specific guidance on how to manipulate the length and which end of the oligonucleotide to modify, and in which way to modify it to target a different virus" (pg. 9). The results of Dec. A show that when two mutations are introduced in the target SARS, the claimed agents fail to inhibit the translation of the reporter (pg. 10). Further, shortening the oligos of SEQ ID NO: 6 to 14 nt. and SEQ ID NO: 5 to 16 contiguous nt. abolished their inhibitory activity (pg. 10). Thus, the teaching of Crooke does not teach how to manipulate the length of the oligonucleotides and argues that "Applicant's results show that the nucleotides cannot be less than 23 (SEQ ID NO: 6) or 26 (SEQ ID NO: 5) nt. since by shortening the binding site to 14 nt. or 16 nt., which is the equivalent with shortening the length of the ASOs, their translation inhibitory activity is lost" (pg. 10). The Remarks add that neither of the references teach the functional limitation of blocking of the miRNA (pg. 10). The Remarks indicate that it "is correct the siRNA duplex ID AD-1184291.1 inhibits 93% a reporter gene containing the target sequence. However these results cannot teach about the inhibitory effect of SEQ ID NO: 5 and 6 for at least the following reasons” (A summary of points provided below: Akinc only partially overlaps SEQ ID NO: 5 and does not disclose or suggest SEQ ID NO: 6; siRNAs and ASOs are structurally different and implement different endogenous systems; Different cells type used by Akinc and A-549 cells, a lung specific model system (pg. 12), which mimics SARS-COV-2 infection in human respiratory tract. The difference is important because "Applicant could not find any evidence in the literature that the Cos-7 cells express miR-34a-5p or miR-760-3p" (pg. 12). The argument is not persuasive. Regarding selection of a particular ASO of Crooke ‘885, which targets a SARS-CoV, is based on evidentiary support provided by Akinc targeting the same site on a slightly different strain of SARS virus, a more recent SARS-CoV-2 virus. Crooke ‘885 does not need to teach that every species disclosed will have inhibitory/binding activity, as long as it provides support for some species of ASOs having binding/inhibitory activity. A skilled artisan would use guidance of both references since the virus is different in each case and Akinc provides support that even in the more recent strain of SARS-CoV-2 the target region is accessible. Thus, both references provide support for targeting a specific 3’-UTR region of the virus. The testing of ASO lengths by either shortening or lengthening the ASO in either direction has been addressed earlier, see pg. 10 of 11/04/2025 citing Monia testing ASO of 5 nt. up to 25 nt. in either direction. Further, as also pointed out in prior action, the Remarks/Declarations fail to provide evidence why the difference in ASO length (i.e. only partially overlaps) is patentably distinct (pg. 10): Akinc’s antisense strand SEQ ID NO: 726, aagcuauuaaaaucacaugggga, the 23 nt. sequence is a sub-sequence of instant 26 nt. And interestingly, the 3’ end of Akinc’s antisense strand still comprises the essential sequence of ugggga (underlined above), which would block the miRNA-760-3p binding site on the 3’-UTR of the virus (see Frye Fig. 5A below). The prior art supports obvious to try rationale. The Remarks and Declarations, on one hand, raise the point that decreasing the oligo to a certain length makes it lose its inhibitory activity (e.g., SEQ ID NO: 5 from 26 to 16 nt.). And on the other hand, the Frye exhibit notes that only ~8 nt. of miR-760-3p has canonical/non-canonical complementarity to the target virus sequence, (Frye, Fig. 5A, pg. 36154, see excerpt below, the boxed region points out potentially complementary sequence between the miR-760-3p (bottom sequence) and 3’-UTR TL of SARS-CoV-2 (top). PNG media_image2.png 192 663 media_image2.png Greyscale Based on the support that shorter sequences can bind to a viral target (it is known that usually the seed position of miRNA (nucleotide pos. 2-9 out of ~21 length of miRNA) bind to a target region), a skilled artisan would reasonably expect success by obviously trying ASOs starting with at least 8 nt. in length to target an accessible region of the SARS viruses noted in Crooke ‘885 and Akinc. Here, both Akinc (see Table 6) and Crooke ‘885 (see Tables 14/15) initially tested hundreds of sequences; thus in the art of antisense therapeutics it is customary to test numerous, yet finite number of sequences. A much fewer number of ASOs would be required to be tested based on accessible regions disclosed by both prior arts. Further, a skilled artisan is also not expecting that all the tested sequences will be sufficiently inhibitory. Thus, the obvious to try rationale is supported by prior art. Although Akinc’s siRNA and Crooke ‘885’s ASO are distinct, prior art shows that inhibition of target transcript with siRNAs correlates with ASOs. Vickers et al. discloses that “[e]xamination of 80 siRNA oligonucleotide duplexes designed to bind to RNA from four distinct human genes revealed that, in general, activity correlated with the activity to RNase H-dependent oligonucleotides designed to the same site” with minor exceptions that do not apply here (abstract, 2003, JBC, 278, 7108-7118, e.g., see also Fig. 1). The introduction of mutations is addressed in prior action, pg. 10 of 11/04/2025 action. Regarding the distinction of cell types, regardless whether the cell-type carries the claimed miRNAs, the antisense strands binding to the target virus region will effectively block miRNAs from binding to the same region. Further, regarding Akinc not disclosing SEQ ID NO: 6 activity, Akinc does disclose siRNAs that target the flanking regions of the target region of instant SEQ ID NO: 6, thus a skilled artisan would reasonably expect success in targeting a region in between two accessible regions. Akinc siRNA duplex ID: AD1184285, whose target region is ~ 80 nt. upstream of the target region of instant SEQ ID NO: 6, demonstrates inhibitory activity (Table 6, pg. 209, 2nd row, shows only 8.55 mRNA remaining). The target region of instant SEQ ID NO: 5 is ~ 50 nt. downstream of SEQ ID NO: 6 and inhibitory activity of the siRNA targeting SEQ ID NO: 5 is noted above. Thus, a skilled artisan would reasonably expect success in targeting a region in between the target regions of AD1184285 and instant SEQ ID NO: 5. Thus the examined claims are rejected under 35 USC 103. Allowable Subject Matter No claim allowed. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Show 10 earlier events
Jun 26, 2025
Request for Continued Examination
Jun 30, 2025
Response after Non-Final Action
Nov 04, 2025
Non-Final Rejection mailed — §103
Apr 07, 2026
Interview Requested
Apr 20, 2026
Examiner Interview Summary
May 01, 2026
Response after Non-Final Action
May 01, 2026
Response Filed
Jun 30, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747273
HTT REPRESSORS AND USES THEREOF
5y 2m to grant Granted Sep 29, 2026
Patent 12723260
AAV-COMPATIBLE LAMININ-LINKER POLYMERIZATION PROTEINS
5y 9m to grant Granted Sep 01, 2026
Patent 12708608
METHODS OF TREATING SCHIZOPHRENIA AND OTHER NEUROPSYCHIATRIC DISORDERS
5y 8m to grant Granted Aug 18, 2026
Patent 12703863
AN RNA G-QUADRUPLEX STRUCTURE IN PRE-miRNA-1229 AS A THERAPEUTIC TARGET FOR ALZHEIMER'S DISEASE AND VARIOUS CANCERS
5y 3m to grant Granted Aug 11, 2026
Patent 12703865
SMALL INTERFERING RNA TARGETING C3 AND USES THEREOF
2y 3m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

7-8
Expected OA Rounds
49%
Grant Probability
99%
With Interview (+60.8%)
3y 8m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 77 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month