DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of species a (nucleobase 176630 and 176835 of SEQ ID NO: 130, species b (SEQ ID NOs: 125 and 126) in the reply filed on 9/19/25 is acknowledged. The traversal is on the ground(s) that it would not be an undue burden to search SEQ ID NOs: 123-126 in species B (see MPEP 803). This is not found persuasive because other than citing this statement from a section of MPEP 803 and asserting that it would not be an undue burden to search sequences in claim 34 or SEQ ID NOs: 123-126 together, the applicant does provide a reason for why it wouldn’t be an undue burden to search SEQ ID NOs: 123-126. Each sequence requires a different search and then another search for the combination of sequences. Applicant does not provide arguments for the species requirement for species a.
The requirement is still deemed proper and is therefore made FINAL.
Upon further consideration, SEQ ID NOs: 123 and 124 are rejoined with the elected species and examined.
Item a and c in claim 33 and items a and c in claim 34 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 9/19/25.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) or 120 as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application Nos. 16/730,517; 15/835,698; 15/045,999; and 62/118,794, fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
The oligonucleotides in instant claims 32-53, 55-62, and 64-65 appear to enjoy priority to 15/045,999 filed on 2/17/16. Table 2 of ’999 discloses instant SEQ ID NOs: 123-126. Instant SEQ ID NO: 130 is also listed in ‘999 and methods of making and using the antisense oligonucleotides to treat cystic fibrosis in a subject in need thereof.
62/118,794 does not disclose instant SEQ ID NO: 130 or SEQ ID NOs: 123-126 targeting exon 23 of a CFTR nucleotide sequence. The specification of ‘794 contemplates making exon skipping antisense oligonucleotide targeting exon 4, exon 23 or exon 24. The appendix of the provisional application discloses exon 23, which is 156 nt in length and exon skipping to restore reading frame of the nonsense mutation transcript. There is nothing in the disclosure of ‘794 to lead the skilled artisan to making and using an antisense oligonucleotides set forth in instant claim 32 and claims dependent therefrom, including SEQ ID NOs: 123-126.
Thus, the oligonucleotides in instant claims 32-66 appear to enjoy priority to ‘999 filed on 2/17/16.
None of the parent or priority applications appear to provide written support for a CFTR modulator in claims 54, 63, and 66 selected from (VX-770), lumacaftor (VX-809), tezacaftor (VX-661), elexacaftor (VX- 445), bamocaftor (VX-659), olacaftor (VX-440), VX-121, deutivacaftor (VX-561) (formerly CTP-656), VX-152, ABBV-2222 (galicaftor, formerly GLPG2222), ABBV-3221, ABBV-3067, ABBV-191, ABBV-974 (formerly GLPG-1837), ABBV-2451 (formerly GLPG-2451), ABBV- 3067 (formerly GLPG3067), EXL-02 (NB124), FDL169, cavonstat (N91115), MRTS005, ataluren (PTC124), posencaftor (PTI-801), nesolicaftor (PTI-428), sodium 4-phenylbutarate (4PBA), VRT-532, N6022, or combinations thereof.
Example 8 of the instant application was first presented in the specification of ‘698. The example discloses using ivacaftor with an exon skipping antisense oligonucleotide in patients.
Ivacaftor in instant claims 54, 63, and 66 was first disclosed in U.S. application no. 15/835698, filed on 12/8/17. The other modulators in these claims only enjoy priority to the instant application filed on 2/12/21.
Drawings
The drawings are objected to because figures 2b, 2c, 2d, 3b, 20c are a color drawing because of the color red or blue.
Applicant needs to file an updated version of their drawings that do not contain color, since
the specification does not indicate drawings were submitted and
there is no Petition for entry of color drawings.
NOTE: the most recent drawings of record control. The most recent set do contain at least one color drawing.
Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification:
The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2).
Claim Objections
The numbering of claims is not in accordance with 37 CFR 1.126 which requires the original numbering of the claims to be preserved throughout the prosecution. When claims are canceled, the remaining claims must not be renumbered. When new claims are presented, they must be numbered consecutively beginning with the number next following the highest numbered claims previously presented (whether entered or not).
Claim 59 is missing.
Misnumbered claims 60-66 have been renumbered 59-65. NOTE: the rejections will be based on the new numbering.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 46 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 46 depends on claim 45 and claim 45 already limits each of the modified nucleosides to LNA or cEt. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Page 44 of the as-filed specification discloses that “modified oligonucleotide” means an oligonucleotide comprising at least one modified nucleoside (backbone, sugar moiety) and/or at least one modified internucleoside linkage. Thus, the product does not read on a product of nature because it requires a chemical modification to the sequence that would not be found in nature.
Claims 32, 33, and 36-65 are rejected under 35 U.S.C. 103 as being unpatentable over PROQR Therapeutics (WO 2014011053).
‘053 teaches a composition comprising a chemically modified single stranded antisense oligonucleotide for treating cystic fibrosis by restoring CFTR protein function and restoring CF phenotype (pages 2 and 34-43). The oligonucleotide may comprise an inosine and/or may comprise modified nucleotides, preferably selected from the group consisting of a 2'-O-alkyl ribose, 2'-O-methyl ribose, 2' Fluoro ribose, phosphorothioate, methylphosphonate, PMO, 5-methyl-dC, 2-amino-dA, С5- pyrimidine. One such preferred example of a stabilized nucleotide is a 2'-O-methyl modified nucleotide, another example is a Locked Nucleic Acid (LNA) nucleotide and/or a Peptide Nucleic Acid (PNA). See page 5. In addition, further optimization of oligonucleotide chemistry may be applied to enhance binding affinity and stability, enhance activity, improve safety, and/or to reduce cost of goods by reducing length or improving synthesis and/or purification procedures. Multiple chemical modifications are generally and/or commercially available to the person skilled in the art, base, sugar, and/or backbone modification. See pages 6-8 and 10. The oligonucleotide can have 1 to 40 modified nucleotides. The oligonucleotide has a length of 15 to 100 nucleotides in length, 20 to 50; more preferable 25 to 45; more preferably 27 to 35 (pages 8 and 16). The method can be in vivo or ex vivo (pages 10-11). The administration of the oligonucleotides according to the invention can be combined with administration of small molecule for treatment of CF, such as potentiator compounds for example Kalydeco (ivacaftor; VХ770), or corrector compounds, for example VX-809 (Lumacaftor) and/or VX-661 (page 12). The oligonucleotide can be in a composition comprising a pharmaceutical acceptable carrier (pages 13-14, 22, and 26-29).
The W1282X nonsense mutation is associated with Delta508 mutation exon 10 of CFTR (pages 3 and 33 and Figure 9C).
PNG
media_image1.png
507
964
media_image1.png
Greyscale
SEQ ID NO: 61 of ‘53 would read an oligonucleotide in instant claim 32.
The region AACTTTGCAACAGTGGAGGAAAGCCTTTG of nucleobase 176630 and 176835 of instant SEQ ID NO: 130 is complementary to SEQ ID NO: 61.
SEQ ID NO: 130 AACTTTGCAACAGTGGAGGAAAGCCTTTG
SEQ ID NO: 61: AUUGAAACGUUGUCACCUCCUUUCGGAAACCUC
SEQ ID NO: 61 (33 nucleotides in length, the oligonucleotide has 27/33 complementary nucleotides and is 81% complementary). The oligonucleotide is longer than the length of the oligonucleotide recited in the instant claims (oligonucleotide consists of 8 to 30 linked nucleosides) and ‘053 does not specifically teach chemically modifying the oligonucleotide or two or more modified oligonucleotides selected from the group consisting of SEQ ID NOs: 123-126.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to make a composition comprising two or more modified oligonucleotide having a sequence of SEQ ID NO: 61 that is 8 to 30 linked nucleosides, namely to arrive at the claimed invention. Several sections of ’053 disclose shortened variants of a sequence, including removing at least 1-12 nucleotides from the 3’ and 5’ end (pages 23) and the oligonucleotide can be preferably between 27 and 35 nucleotides (page 16). It would have been obvious for one of ordinary skill in the art try removing at least 3 nucleotides from either end of the oligonucleotide set forth in SEQ ID NO: 61 to arrive at an oligonucleotide consisting of 30 nucleotides to read on the claimed oligonucleotide the optimize treating CF and/or restoring CFTR protein function. See MPEP 2143(I)E. One of ordinary skill in the art would have been motivated to chemically modify the oligonucleotide to increase the bioavailability of the oligonucleotide in a cell or a subject. ‘053 teaches two or more oligonucleotides can be combined in a pharmaceutical composition (page 14). The broadest reasonable interpretation of the instant claims embrace multiple copies of the same oligonucleotide. Although ‘053 does not teach more than one oligonucleotide in the composition, it would have been obvious when one of ordinary skill in the art makes the composition comprising an oligonucleotide that is at least 80% complementary to a region, nucleobase 176630 and nucleobase 176835 of instant SEQ ID NO: 130, they would arrive at several copies of the oligonucleotide in the composition because a composition has multiple copies of the oligonucleotide and not just one copy of oligonucleotide. ’053 teaches that the oligonucleotide can have multiple chemical modifications, including a modified sugar (2’OMe, 2’F, LNA, morpholino); modified nucleosides; and/or a phosphorothioate internucleoside linkage. One of ordinary skill in the art could try modifying at least 5 nucleosides with the same or different sugar moiety to optimize the bioavailability of the oligonucleotide in a cell. It would have been obvious to add at least one conjugate to the oligonucleotide to assist in the delivery to the oligonucleotide to a cell (pages 21-24). Instant claim 52 is a functional limitation that would be considered inherent in the oligonucleotide made obvious by ‘053 because it has the same structural limitations. One of ordinary skill in the art would have been motivated to make a pharmaceutical composition comprising the oligonucleotides and a pharmaceutically acceptable carrier or diluent to deliver the oligonucleotide to a cell or a subject having CF. ‘053 teaches that the oligonucleotide can be delivered to a cell that is in vitro or in vivo (pages 10-11). ‘053 teaches using to delivery an oligonucleotide to a subject via inhalation or intramuscular (pages 19-20). ’053 teaches that the administration of an oligonucleotides can be combined with administration of small molecule for treatment of CF, such as potentiator compounds for example Kalydeco (ivacaftor; VХ770), or corrector compounds, for example VX-809 (Lumacaftor) and/or VX-661 (page 12).
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 32, 33, 36-53, 55-61, and 63-64 are rejected under 35 U.S.C. 103 as being unpatentable over Editas Medicine (WO 2015157070, published 10/15/15 and priority to 4/9/14).
Absence evidence to the contrary, the instant claims 32-53, 55-62, and 64-65 appear to enjoy priority to 15/045,999 filed on 2/17/16. See reasons set forth under priority heading.
‘070 teaches gRNA molecule comprising a nucleotide sequence that would read on a sequence that is at least 80% complementary to an equal-length portion of a target region of a cystic fibrosis transmembrane conductance regulatory (CFTR) transcript within nucleobase 176630 and 176835 of instant SEQ ID NO: 130. See for example, Table 29B on Pages 348-350 and pages 1746-1783 (claim 8). Table 29B provides examples for correcting a mutation (W128X) in the CFTR gene. Any of the gRNA can be used with Cas9 molecule to generate a double stranded break or a single-stranded break. The gRNA can be combined with at least one more gRNA. The gRNA can be used in a composition in a method of treating cystic fibrosis (CF) in a subject or modulating expression of CFTR transcript in a cell. The gRNA can comprise a chemical modification, including at least one sugar modification (MOE, LNA or OME) or nucleotide modification (morpholino) or a phosphorothioate internucleoside linkage. The gRNA can be attached to a conjugate (table 58, page 1739). Page 1 discloses that current treatment for CF include CFTR modulators.
A sequence between nucleobase 176630 and nucleobase 176835 of SEQ ID NO: 130 (Qy). See SEQ ID NO: 3080 (DB)
PNG
media_image2.png
58
338
media_image2.png
Greyscale
SEQ ID NO: 125 (Qy) and SEQ ID NO: 3080 (Db)
PNG
media_image3.png
56
296
media_image3.png
Greyscale
SEQ ID NO: 126 (QY) and SEQ ID NO: 2996 (Db)
PNG
media_image4.png
71
292
media_image4.png
Greyscale
‘070 does not specifically teach a composition comprising two or more modified oligonucleotide comprising SEQ ID NO: 3080 or 2996 or two or more modified oligonucleotides selected from the group consisting of instant SEQ ID NOs: 123-126.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to add at least one chemical modification to the gRNA taught by ’070 to increase the stability or bioavailability of the gRNA in a cell, namely to arrive at the claimed invention. Table 29B provides examples for correcting a mutation (W128X) in the CFTR gene, including SEQ ID NO: 3080. A person of ordinary skill in the art would have been motivated to make a composition comprising SEQ ID NO: 3080 to correct W128X mutation in the CFTR gene to modulate splicing or expression of the gene. One of ordinary skill in the art would have been motivated to make and use the composition to correct the mutation to express CFTR and treat CF in a subject in need thereof. The broadest reasonable interpretation of the instant claims embrace multiple copies of the same oligonucleotide or two different oligonucleotides. Although the prior art does not teach more than one oligonucleotide in the composition, it would have been obvious when one of ordinary skill in the art makes the composition comprising an oligonucleotide that is complementary to the claimed region of the instant SEQ ID NO: 130, they would arrive at several copies of the oligonucleotide in the composition because a composition has multiple copies of the oligonucleotide and not just one copy of oligonucleotide. SEQ ID NO: 3080 taught by ‘070 has at least 100% complementary to an equal-length portion of the target region of the CFTR transcript. The gRNA can comprise a chemical modification, including at least one sugar modification (MOE, LNA or OME) or nucleotide modification (morpholino) or a phosphorothioate internucleoside linkage. It would have been obvious to one of ordinary skill in the art try making the gRNA have at least 5 nucleotide modifications (LNA or morpholino) or sugar modifications (2’ OMe or MOE) or at least one phosphorothioate linkage to determine the optimal modification for stability of the gRNA in a cell.. See MPEP 2143(I)E. A person of ordinary skill in the art would have been motivated to try modifying each internucleoside linkage with a phosphorothioate internucleoside linkage to reduce the degradation of the gRNA by a nuclease in the cell. The gRNA can be attached to a conjugate (table 58, page 1739). One of ordinary skill in the art would have been motivated to make and use a composition comprising at least one composition and a pharmaceutically acceptable carrier or diluent to assist in delivery of the oligonucleotide to a cell (page 1730-1749). ‘070 teaches an ex vivo or in vivo method treating CF using a composition comprising the gRNA (e.g., pages 38 and 1744-1748). ‘070 teaches using several routes of administration (e.g., intramuscular) to deliver the composition to a subject (pages 38 and 1744-1745). The subject can be either a human or a mouse (page 48). Page 1 discloses that current treatment for CF include CFTR modulators. One of ordinary to observe an additive effect to treat CF by combining a CFTR modulator with a composition comprising the gRNA.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 54, 62, and 65 are rejected under 35 U.S.C. 103 as being unpatentable over ‘070 as applied to claim 32, 33, 36-53, 55-61, and 63-64 above, and further in view of Attenbach et al. (US 20160355480, published 12/8/16 and priority to 6/2/15).
As stated under the priority heading, Ivacaftor in instant claims 54, 63, and 66 was first disclosed in U.S. application no. 15/835698, filed on 12/8/17. Absence evidence to the contrary, the other modulators in these claims only enjoy priority to the instant application filed on 2/12/21.
‘070 teaches that CFTR modulators are used in the prior art to treat CF, but does not specifically teach the CFTR modulators set forth in instant claims 54, 64, and 66.
However, Attenbach teaches for using CFTR modulators for treating CF in a subject in need thereof (pages 32-34 and 117), wherein the modulator can be VX-152, ivacafffor, lumacaffor.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘070 taken with Attenbach, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to use a CFTR modulator (VX-152. Ivacaffor, lumacaffor) in the method to observe an additive effect for treating CF in a subject in need thereof.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claims 32-34, 36-52, and 55 are rejected under 35 U.S.C. 103 as being unpatentable over (US20050048544, cited on an IDS) taken with Brown et al. (US 8153772).
‘544 discloses unmodified CFTR probe sequences that would read on SEQ ID NO: 123 (Qy). See SEQ ID NO: 397 (Db)
Qy 1 ATCCAGTTCTTCCCAAGAGGCCCAC 25
Db 1 ATCCAGTTCTTCCCAAGAGGCCCAC 25
The probe is used in an array comprising several probes to determine if a subject carried a CFTR gene mutation (pages 66-67). A nucleic acid would be obtained from cells or tissues of a subject and subject to a protocol to amplify the CFTR in the sample, then further processed then used with the array (pages 4-6).
However, ‘544 does not specifically teach chemically modifying the probe. In addition, ’544 does not specifically teach or suggest two or more modified oligonucleotides selected from the group consisting of SEQ ID NOs: 123-126.
‘772 teaches oligomer compounds having sugar and backbone modifications for use in detecting a gene in a sample. See columns 1-28 and 63-66. The modification include phosphorothioate, 2’-O-subsituted (2’-OMe) phosphorothioate, 2’F, deoxy analogs, and morpholino (column 6). The modification can be about 5-10, 11-20, or 5-20 modified nucleic acid bases. The probe can comprise a detectable label.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘544 taken with ‘772 to chemically modified the probe, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to chemically modify the probe to increase the stability or binding of the probe to its target sequence. Although the ‘772 does not teach more than one oligonucleotide in the composition, it would have been obvious when one of ordinary skill in the art makes the composition comprising the instant SEQ ID NO: 123, they would arrive at several copies of the oligonucleotide in the composition because a composition has multiple copies of the oligonucleotide and not just one copy of oligonucleotide. It would have been obvious to one of ordinary skill in the art to try making the probe have at least 5 nucleotide modifications (morpholino) or sugar modifications (2’ OMe or 2’F) or at least one phosphorothioate linkage to determine the optimal modification for stability or binding of the probe. ‘544 and ‘772 teaches a composition comprising a conjugate (label) and an oligomer and one of ordinary skill in the art can attach to a conjugated to an oligonucleotide to assist in identifying the oligonucleotide in a sample. Instant claim 52 is a functional limitation that would be considered inherent in the oligonucleotide made obvious by ‘’544 because it has the same structural limitations. ‘544 teaches a composition comprising the probe and a pharmaceutical excipient (page 6).
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
NOTE: It would not have been obvious to one of ordinary skill in the art to use the probe in the claimed methods because a probe is used in a diagnostic assay for determining if a subject carries a particular CFTR gene mutation (page 6 of ‘544) and not a therapeutic method. In addition, the specification has shown the highest skipping was achieved with a composition comprising two or more different modified oligonucleotides selected from SEQ ID NOs: 123-126 for modulating splicing of CFTR transcript and/or treating CF in a subject in need thereof as set forth in the working examples of the instant application.
In addition, SEQ ID NO: 419 (Db) in ‘544 is 92% identical to instant SEQ ID NO: 125, Qy.
Qy 3 GTTATTGAATCCCAAGACACACC 25
Db 1 GTTATTGAATCCCAAGACACACCAT
There is no teaching or suggestion in the prior art to pick this sequences from hundreds of probes taught in ‘544 and add specific nucleotides to the 5’ end and remove AT from the 3’ end of SEQ ID NO: 170 to arrive at SEQ ID NO: 125. The combination of nucleotides that can be added or removed from SEQ ID NO: 419 is in the thousands, if not millions, indicating that there is no finite number of identified, predictable probes to arrive at the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 32-52, 55-60, and 63 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-33 of U.S. Patent No.11116785. Although the claims at issue are not identical, they are not patentably distinct from each other because both set of claims embrace a composition comprising a modified oligonucleotide comprising SEQ ID NO: 126. The only differences between the set of claims is that the instant claims embrace at least two or more modified oligonucleotides in the composition. However, the broadest reasonable interpretation of the instant claims embrace the multiple copies of the same oligonucleotide. When one of ordinary skill in the art makes the composition comprising SEQ ID NO: 126, they would arrive at several copies of the oligonucleotide in the composition because a composition has multiple copies of the oligonucleotide and not just one oligonucleotide. The dependent claims of ‘785 read on the limitations in the dependent claims of instant application. Claims 2-24 of ‘785 reads on the structural limitations of the oligonucleotide and a composition comprising the oligonucleotide and a pharmaceutical carrier or a conjugate as recited in instant claims 33-53. Claims 25-33 of ‘785 read on a method of treating CF using the composition recited in instant claims 55-63 and 64-65.
Claims 53, 54, 61-62, and 64-65 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-33 of U.S. Patent No. 11116785 in view of Attenbach et al. (US 20160355480).
The rejections of claims 32-52, 55-60, and 63 over the claims from ‘785 are incorporated herein.
The claims of ‘785 do not disclose or suggest using the specific CFTR modulators recited in instant claims 54, 62, and 65 in a method of treating CF.
However, Attenbach teaches for using CFTR modulators for treating CF in a subject in need thereof (pages 32-34 and 117), wherein the modulator is VX-152, ivacafffor, lumacaffor.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the claims of ‘785 taken with Attenbach, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to use a CFTR modulator (VX-152. Ivacaffor, lumacaffor) in the method to observe an additive effect for treating CF in a subject in need thereof.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Allowable Subject Matter
The only rejection for claim 35 is a NSDP rejection, the prior art of record does not teach or suggest these chemically modified antisense oligomers selected from the group consisting of SEQ ID NOs: 125-126. The closest prior art is discussed below:
SEQ ID NOs: 3080 and 2996 in Editas Medicine (WO 2015157070, published 10/15/15 and priority to 4/9/14) disclose oligonucleotide sequences targeting a CFTR gene.
Instant SEQ ID NO: 125 and SEQ ID NO: 3080 (Db)
PNG
media_image3.png
56
296
media_image3.png
Greyscale
Instant SEQ ID NO: 126 and SEQ ID NO: 2996 (Db)
PNG
media_image4.png
71
292
media_image4.png
Greyscale
There is no teaching or suggestion in the prior art to add several specific nucleotides to either the 5’ and 3’ end of the sequences taught by ‘070 to arrive at SEQ ID NOs: 125 and/or 126. The combination of nucleotides that can be added to either SEQ ID NO: of ‘070 is in the thousands, if not millions, indicating that there is no finite number of identified predictable oligomer to arrive at the claimed invention
Saltzmann et al. (US 20170283830) discloses a sequence (SEQ ID NO: 170, Fig 8A), which is 81% identical to the claimed sequence SEQ ID NO: 126.
Qy is SEQ ID NO: 126 and Db is SEQ ID NO: 170.
Qy 1 CTAAGTCCTTTTGCTCACCTGTGGT 25
Db 1 TTTTNNTTCCTTTTGCTCACCTGTGGT 27
There is no teaching or suggestion in the prior art to remove TTTTNNG from the 5’ end of SEQ ID NO: 170 and replace with a specific nucleotide sequence (CTAAG) to the 5’ end of the sequence taught by ‘830 to arrive at SEQ ID NO: 126. The combination of nucleotides that can be added to SEQ ID NO: 170 of ‘830 is in the thousands, if not millions, indicating that there is no finite number of identified predictable oligomers to arrive at the claimed invention.
Conclusion
See attached PTO-326 for disposition of claims.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636