DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of group 1, SEQ ID NO 252, the bridge molecule is a polypeptide and portable waste water monitor in the reply filed on 12/10/2024 and 2/15/2026 is acknowledged. The traversal is on the ground(s) that the response asserts applicant could not reach the examiner and it is not clear why there is a search burden. This is not found persuasive because the restriction requirement states, “The species are independent or distinct because searching on nucleic acid sequence will not inherently provide art on another nucleic acid sequence. Further searching a bridging molecule which is a polypeptide will not inherently provide art on a peptide or nucleic acid. Further searching a method or device with one pixel will not inherently provide art on a method or device with 2 or more pixels. Searching a device for waste water analysis will not inherently provide art on devices or method for breath analysis.” Further it is noted the representative did contact the examiner on July8, 2025 and did not discuss any issues other than asking the examiner to abandon the examiner as soon as possible.
Claims 14-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected species/invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 2/15/2026.
Priority
The instant application was filed 09/15/2021 and is a continuation in part of PCT/US2021/24730 , filed 03/29/2021 and claims priority from provisional application 63080673 , filed 09/18/2020; claims priority from provisional application 63078894 , filed 09/15/2020; claims priority from provisional application 63003653 , filed 04/01/2020; and claims priority from provisional application 63001249 , filed 03/27/2020.
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e), 120, 121, 365(c), or 386(c) as follows: The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application No. PCT/US2021/24730 , 63080673 , 63078894, 63003653, 63001249 fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application. The PCT does not have SEQ ID NO; 252 or SEQ ID no: 254. Thus the claims are being the filing date of the instant application.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 4/4/2022, 6/1/2022, 6/27/2022, 8/2/2022 are being considered by the examiner.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code(page 40, lines 34; Table 2 for example). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claim(s) 1-13 is/are rejected under 35 U.S.C. 103 as being unpatentable over Merriman (WO2017/123416), Yoon (KR20120139512)
Claim 1 recites, “a hybridization probe having a sequence at least 95% sequence identity to one of the preceding.” The broadest reasonable interpretation of this limitation is it encompasses a fragment of SEQ ID NO 252 which has 95% identity to SEQ ID NO 252.
Claim 1 recites, “sensor pixel.” The specification teaches, “[00105] In various embodiments, the term "pixel" refers to a sensor circuit and/or a measurement circuit that is repeated throughout an array of such identical circuits disposed on a chip. A pixel may in context refer to just a measurement circuit, such as an electrical current meter measuring circuit, or may also include a sensor transducer element or elements affiliated with the circuit, which here are the molecular electronic components, i.e., molecules attached to nanoelectrodes. In various embodiments, a pixel may comprise at least one sensor, wherein each sensor comprises first and second nanoelectrodes separated by a nanogap and a bridge molecule bridging the gap and conjugated to at least one hybridization probe. In various embodiments, a pixel may comprise only one sensor circuit, i.e., only one pair of electrodes with its associated bridging molecular complex. In other embodiments, a pixel may comprise more than one molecular sensor, even a plurality of sensors. For definiteness, the tern " measurement pixel" as used herein refers to a measurement circuitry of the pixel, and the term "sensor pixel" refers to a pixel circuit affiliated with a given sensor element. The origins of this term come from image sensors. where such pixels contain light sensing elements and measurement circuitry for capturing an element of a picture. In accordance with the present context, the term pixel is unrelated to light sensing or imaging, but rather the pixels disclosed herein are configured for sensing chemical interactions rather than light.” Thus the broadest reasonable interpretation of a pixel is two electrodes with a nanogap and bridge molecule.
With regards 1, Merriman teaches, “00137] In various embodiments, use of linear biopolymers comprised of DNA or amino acids permits the straightforward construction of nano-scale sensor components having a predetermined length based on the monomeric composition (i.e., the primary structure) of the biopolymer. Without wishing to be bound by theory, use of a linear biopolymer with an end-to-end length of less than the persistence length may enhance the efficiency of a self-assembly step during construction of a biomolecular sensing device in accordance with various embodiments.” Merriman teaches, “[00119] In various embodiments, a single molecule biosensor device can comprise a first electrode and a second electrode. The first electrode and the second electrode are separated by a sensor gap defined by the electrodes and/or contacts attached to the electrodes. The first and second electrodes can be coupled by a bridge molecule spanning the sensor gap. The bridge molecule can comprise a biopolymer, such as nucleic acid or amino acid polymers. The bridge may also comprise a chemically synthesized molecule, which may include a synthetic organic molecule, a polymer comprising synthetic analogs of biopolymer monomers, or other wholly synthetic monomers not derived from a biological molecule. The differences between a "biopolymer" and a "chemically synthesized molecule" is not meant to be so strictly literal as to exclude the possibility for synthetic transformations that modify an otherwise natural biopolymer into a useful bridge molecule, such as, for example, synthetically modifying the 3' and 5' ends of an otherwise naturally occurring poly nucleic acid sequence for subsequent binding and bridging. A bridge molecule, whether comprised of a biopolymer or a synthetic molecule, may have a known, atomically precise molecular structure. The bridge molecule attachment to the electrodes may be mediated by a contact. A probe molecule or molecular complex can be coupled to the bridge molecule. The probe can be a biomolecule such as an enzyme configured to interact with a single target molecule. In various embodiments, a sensor device can comprise multiple single molecule biosensors arrayed in parallel. Such multi-sensor devices can be used to perform parallel detection, discrimination, and/or characterization or identification of multiple individual target molecules in a complex mixture of target and other molecules.”
Merriman does not teach hybridization probes of the instant claim .
However, Yoon teaches, “(0002) The present invention relates to a aptamer specific to Severe Acute Respiratory Syndrome (SARS).” Yoon teaches SEQ ID NO 1 is the aptamer (page 3 of translation).
Therefore it would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claims to use the Sars-CoV sequences of Yoon with the nanogap sensors device of Merriman. The artisan would be motivated to detect SARS virus to monitor disease. The artisan would have a reasonable expectation of success as the artisan is merely using known nucleic acids with known devices.
With regards to claim 2-4, Merriman teaches, “The probe can be a biomolecule such as an enzyme configured to interact with a single target molecule. In various embodiments, a sensor device can comprise multiple single molecule biosensors arrayed in parallel. Such multi-sensor devices can be used to perform parallel detection, discrimination, and/or characterization or identification of multiple individual target molecules in a complex mixture of target and other molecules.”
In re Harza, 274 F.2d 669, 124 USPQ 378 (CCPA 1960) the courts held that mere duplication of parts has no patentable significance unless a new and unexpected result is produced (MPEP 2144.04 (VI)(B)).
Therefore it would have prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claims to duplicate the sensor of Merriman. The artisan would be motivated as Merriman specifically suggests the use of multiple sensor. The artisan would have a reasonable expectation of success as the artisan is merely following the teachings of the prior art.
With regards to claims 5-7, 9, Merriman teaches, “Merriman teaches, “00137] In various embodiments, use of linear biopolymers comprised of DNA or amino acids permits the straightforward construction of nano-scale sensor components having a predetermined length based on the monomeric composition (i.e., the primary structure) of the biopolymer” Thus Merriman teaches the biopolymer can be DNA or a polypeptide.
With regards to claims 8 and 10, Merriman teaches the biopolymer (bridge) is a DNA double helix or double stranded nucleic acid (0133)
With regards to claim 11, Merriman teaches the use of decoding probes to determine sequence of probe (0328). Merriman teaches the decoding probes are part of sequencing by synthesis.
With regards to claim 12, Yoon teaches SEQ ID NO 4 which is instant SEQ ID NO 235.
Therefore it would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claims to use the Sars-CoV sequences of Yoon with the nanogap sensors device of Merriman. The artisan would be motivated to detect SARS virus to monitor disease. The artisan would have a reasonable expectation of success as the artisan is merely using known nucleic acids with known devices.
The specification provides no specific guidance on what is required of configures as a portable wastewater monitor. Thus the broadest reasonable interpretation is any device can be configured for a portable wastewater device.. Thus the cited prior art renders this obvious.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-13 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1-20 of copending Application No. 18709785 in view of Yoon (KR20120139512)
This is a provisional nonstatutory double patenting rejection.
The instant claims are drawn to sensor a device comprising: a plurality of sensor pixels configured in an array on a semiconductor chip, the plurality of sensor pixels comprising at least a first subset of sensor pixels and a second subset of sensor pixels; wherein each at least one sensor pixel in the plurality of sensor pixels comprises a molecular electronics sensor further comprising: a first electrode; a second electrode spaced-apart from the first electrode by a nanogap; a bridge molecule having a first end and a second end, the first end coupled to the first electrode and the second end coupled to the second electrode; and a hybridization probe having an oligonucleotide sequence conjugated to the bridge molecule; wherein each molecular electronics sensor in the first subset of sensor pixels includes a first hybridization probe comprising a first oligonucleotide sequence selected from SEQ ID NO:252 (GCAATGGTACGGTACTTCCGGGATGCGGAAACTGGCTAATTGGTGAG GCTGGGGCGGTCGTGCAGCAAAAGTGCACGCTACTTGCTAA), SEQ ID NO:254 (CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATG GACA), or a hybridization probe having a sequence at least 95% sequence identity to one of the preceding; and wherein each molecular electronics sensor in the second subset of sensor pixels includes a second hybridization probe comprising a second oligonucleotide sequence at least partially complementary to the first hybridization probe.
The claims of 785 are drawn to A sensor device comprising: a first contact coupled to a first electrode; a second contact coupled to a second electrode; a sensor gap defined between one of the first contact and the first electrode and one of the second contact and the second electrode; a bridge molecule comprising a first end and a second end; wherein the bridge molecule is coupled to the first contact at the first end and coupled to the second contact at the second end; an aptamer that is coupled tot the bridge molecule; a binding partner that binds to the aptamer; and wherein the binding interaction of the binding partner with the target ligand is detectable by the sensor... Dependent claims are drawn to detection of COVID 19
The claims do not specifically teach SEQ ID NO 252 or SEQ ID NO 253.
However, Yoon teaches, “(0002) The present invention relates to a aptamer specific to Severe Acute Respiratory Syndrome (SARS).” Yoon teaches SEQ ID NO 1 is the aptamer (page 3 of translation).
Therefore it would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claims to use the Sars-CoV sequences of Yoon with the nanogap sensors device of the claims. The artisan would be motivated to detect SARS virus to monitor disease. The artisan would have a reasonable expectation of success as the artisan is merely using known nucleic acids with known devices.
With regards to claim 12, Yoon teaches SEQ ID NO 4 which is instant SEQ ID NO 235.
Therefore it would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claims to use the Sars-CoV sequences of Yoon with the nanogap sensors device of claims. The artisan would be motivated to detect SARS virus to monitor disease. The artisan would have a reasonable expectation of success as the artisan is merely using known nucleic acids with known devices.
Dependent claims are rejected as they are coextensive in scope.
Claims 1-13 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 28-31, 34-37, 41-55 of co-pending Application No. 17476424in view of Yoon (KR20120139512)
This is a provisional nonstatutory double patenting rejection.
The instant claims are drawn to sensor a device comprising: a plurality of sensor pixels configured in an array on a semiconductor chip, the plurality of sensor pixels comprising at least a first subset of sensor pixels and a second subset of sensor pixels; wherein each at least one sensor pixel in the plurality of sensor pixels comprises a molecular electronics sensor further comprising: a first electrode; a second electrode spaced-apart from the first electrode by a nanogap; a bridge molecule having a first end and a second end, the first end coupled to the first electrode and the second end coupled to the second electrode; and a hybridization probe having an oligonucleotide sequence conjugated to the bridge molecule; wherein each molecular electronics sensor in the first subset of sensor pixels includes a first hybridization probe comprising a first oligonucleotide sequence selected from SEQ ID NO:252 (GCAATGGTACGGTACTTCCGGGATGCGGAAACTGGCTAATTGGTGAG GCTGGGGCGGTCGTGCAGCAAAAGTGCACGCTACTTGCTAA), SEQ ID NO:254 (CAGCACCGACCTTGTGCTTTGGGAGTGCTGGTCCAAGGGCGTTAATG GACA), or a hybridization probe having a sequence at least 95% sequence identity to one of the preceding; and wherein each molecular electronics sensor in the second subset of sensor pixels includes a second hybridization probe comprising a second oligonucleotide sequence at least partially complementary to the first hybridization probe.
The claims of 424 are drawn to A sensor device comprising: a plurality of sensor pixels configured in an array on a semiconductor chip, the plurality of sensor pixels comprising at least a first subset of sensor pixels and a second subset of sensor pixels; wherein each sensor pixel in the plurality of sensor pixels comprises a molecular electronics sensor further comprising: a first electrode; a second electrode spaced-apart from the first electrode by a nanogap; a bridge molecule having a first end and a second end, the first end coupled to the first electrode and the second end coupled to the second electrode; and a hybridization probe having an oligonucleotide sequence conjugated to the bridge molecule; wherein each molecular electronics sensor in the first subset of sensor pixels includes a first hybridization probe comprising a first oligonucleotide sequence complementary to a segment of a genome of a first pathogen; wherein each molecular electronics sensor in the second subset of sensor pixels includes a second hybridization probe comprising a second oligonucleotide sequence complementary to a segment of a genome of a second pathogen; wherein the first pathogen is SARS-CoV-2;wherein the second pathogen is an Influenza A virus strain, an Influenza B virus strain, or Respiratory Syncytial Virus (RSV); and wherein each bridge molecule in the plurality of sensor pixels comprises a polypeptide having the amino acid sequence SEQ ID NO:3, or polypeptide consisting of at least 95% sequence identity to SEQ ID NO: 3.
The claims do not specifically teach SEQ ID NO 252 or SEQ ID NO 253.
However, Yoon teaches, “(0002) The present invention relates to a aptamer specific to Severe Acute Respiratory Syndrome (SARS).” Yoon teaches SEQ ID NO 1 is the aptamer (page 3 of translation).
Therefore it would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claims to use the Sars-CoV sequences of Yoon with the nanogap sensors device of the claims. The artisan would be motivated to detect SARS virus to monitor disease. The artisan would have a reasonable expectation of success as the artisan is merely using known nucleic acids with known devices.
With regards to claim 12, Yoon teaches SEQ ID NO 4 which is instant SEQ ID NO 235.
Therefore it would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the claims to use the Sars-CoV sequences of Yoon with the nanogap sensors device of claims. The artisan would be motivated to detect SARS virus to monitor disease. The artisan would have a reasonable expectation of success as the artisan is merely using known nucleic acids with known devices.
Dependent claims are rejected as they are coextensive in scope.
Summary
No claims are allowed.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEVEN C POHNERT PhD whose telephone number is (571)272-3803. The examiner can normally be reached Monday- Friday about 6:00 AM-5:00 PM, every second Friday off.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anne Gussow can be reached at (571)272-6047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/Steven Pohnert/Primary Examiner, Art Unit 1683
