DETAILED ACTION
Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of Claims
2. Claims 1-2, 5, 7-14, 16-20, 24-25, and 33-34 as amended on 10/10/2025 are pending.
3. Applicant cancelled claim 3 without disclaimer or prejudice on 10/10/2025.
4. Claims 1-2, 5, 7-14, 16-20, 24-25, and 33-34 as amended on 10/10/2025 are under examination.
Priority
5. Applicant’s claim for the benefit of instant application 17/486823 from a prior-filed application CON of PCT/US2020/025494, filed March 27, 2020, which claims priority to and benefit from US Provisional Application No. 62/825,662, filed on March 28, 2019, under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
The requirement for certified copies of priority documents is withdrawn in view of the instant application US17486823 being filed as CON of PCT/US2020/025494, filed on March 27, 2020.
Information Disclosure Statement
6. The information disclosure statements (IDSs) submitted on 10/25/2021 and 01/23/2025 is acknowledged. The submission is in-compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Withdrawn Claim Rejections
7. Withdrawn rejection of claims 1, 7-8, 10-12, and 16-19 under 35 U.S.C. 102“(a)(1)” or “(a)(2)”in view of applicant’s amendment of claims 1, 8 and, 11 that incorporated a limitation, wherein the heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136.
Claim Rejections - 35 USC § 103 (Amended)
On 10/10/2025, the applicant amended claims 1, 8 and 11 by incorporating cancelled claim 3 limitation that changed the scope of the claimed inventions of the independent claims 1, 8 and 11 and the claims dependent thereof. Applicant’s amendment resulted in the modification of the below prior art rejections. No new prior art was cited.
8. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
9. Claims 1, 5, 7-8, 10-12 and 17-19 are rejected under 35 U.S.C. 103 as being unpatentable over Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89).
Claims 1, 5, 7-8, 10: Bell 2011 (US20110206640A1) is in the art and discloses oncolytic viruses or oncolytic virus expression vectors are selected or engineered to productively infect tumor cells that includes myxoma virus (See, paragraphs [0003], [0042], claims 1, 21-23). Bell (US20110206640A1) discloses that in alternative embodiments, one or more strains of an oncolytic virus may be used in methods of the invention, simultaneously or successively. A virus may for example be selected from the group, inter alia, consisting of myxoma virus (dsDNA genome Poxviridae). Bell (US20110206640A1) further discloses that an oncolytic virus comprises immunomodulatory virulence factors (See, para [0013-0014]), in some embodiments, the virulence factor may be a membrane fusion protein, such as a reovirus Fusion Associated Small Transmembrane (FAST) protein sequence; the p14 protein of a reptilian reovirus (See, [0058]). In alternative embodiments of the invention involves, the membrane fusion proteins may have an amino acid sequence which is homologous to, or has a degree of identity to, at least regions the membrane fusion proteins encoded by Reoviridae, including functional fragments of those proteins, ……. amino acid sequences of four members of the FAST protein family, named according to their molecular masses: the p10 proteins of avian reovirus ……; the p14 protein of reptilian reovirus (GenBank accession locus AAP03134) (See, [0058]). Thus, the prior art teachings of Bell (US20110206640A1) disclose an oncolytic myxoma virus expressing heterologous nucleic acid encoding p14 FAST.
Duncan et al 2003 and Duncan et al 2004 discloses the nucleic acid sequence encoding p14 FAST that has GenBank Accession No. AY238887 which corresponds to the p14 protein of reptilian reovirus (Genbank Accession Number AAP03134) recited in Bell 2011 (US20110206640A1, para [0058]).
Bell 2011 (US20110206640A1) recites, Example 5, of an oncolytic VSVΔ51 recombinant that expresses p14 FAST protein that spontaneously initiates / induces cell membrane fusion (See, [0117], [0118], [0119], claims 1, 21-24).
Bell 2011 discloses that in alternative embodiments, one or more strains of an oncolytic virus may be used in methods of the invention ….. …. myxoma virus, a dsDNA Poxviridae (para [0042]).
Bell 2011 (US20110206640A1) does not disclose the instant claim 1 limitation, wherein the heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136.
Liu et al 2009 is in the oncolytic myxoma virus art, and discloses an oncolytic myxoma virus comprising and expressing IL-15 a heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136 (See, abstract, page 5933, col 2 para 2, page 5934 fig 1); and also teaches the added limitation of instant claim 5, wherein the heterologous immunomodulatory gene is under control of a synthetic early/late promoter by disclosing the recombinant myxoma virus heterologous immunomodulatory gene is under control of a synthetic early/late promoter (See, page 5934 figure 1 and associated legends).
Wolfe et al 2018 teaches that insertion of heterologous gene into intergenic region of the myxoma virus between the M135 and M136 ORFs is not known to alter the viral replication cycle (See, Wolfe et al 2018, page 13, section on Virus and Infections, lines 5-7).
Tosic et al 2014 teaches that myxoma virus is a strict rabbit specific pathogen, and is thought to be safe as a therapeutic agent in all non-rabbit hosts tested including mice and humans and teaches an oncolytic myxoma virus that expresses an IL-15 and an IL-15 receptor alpha has an enhanced antitumor activity against tumor cell lines and subcutaneous tumors (See, Tosic et al 2014: page 1, abstract, introduction, figures 1-8).
Boeuf et al 2017 is in the art of oncolytic viruses and teaches that p14 FAST protein enhances Vesicular Stomatitis Virus (VSV) oncolytic virotherapy in primary and metastatic tumor models, efficiently induce cell-cell fusion and syncytium formation in multiple cell types, syncytium formation enhances cell-cell virus transmission and may also induce immunogenic cell death, a form of apoptosis that stimulates immune recognition of tumor cells, VSVp14 FAST prolonged survival in both primary and metastatic 4T1 breast cancer models, and in a CT26 metastatic colon cancer model. VSV-p14 FAST preferentially replicated in vivo in tumors and was cleared rapidly from other sites. Furthermore, VSV-p14 increased the numbers of activated splenic CD4, CD8, natural killer (NK), and natural killer T (NKT) cells, and increased the number of activated CD4 and CD8 cells in tumors. P14 FAST proteins may therefore provide a multi-pronged approach to improving oncolytic virotherapy via syncytium formation and enhanced immune stimulation (See, page 80, abstract).
Thus, the combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches all limitations of instant claim 1 recited supra.
Claim 5 (dependent on claim 1): Liu et al 2009 teaches, as recited supra teaches added limitation of claim 5, wherein the heterologous immunomodulatory gene is under control of a synthetic early/late promoter (See, page 5934 figure 1 and associated legends).
Claim 7 (dependent on claim 1): Bell 2011 (US20110206640A1) discloses p14 FAST protein amino acid sequence with a GenBank accession number AAP03134; however, does not explicitly disclose the nucleic acid sequence encoding p14 FAST.
Duncan 2003 further discloses the instant claim 7 added limitations by disclosing 100% homology/identity of the nucleic acid sequence encoding p14 FAST with both GenBank Accession No. AY238887 and SEQ ID NO: 1 (claim 7 limitation).
Qy: Nucleic acid sequence with recited GenBank Accession No. AY238887 (SEQ ID NO:1 of instant claim 7).
Db: p14FAST protein amino acid sequence GenBank ID: AAP03134 of Bell US20110206640A1 encoded by the nucleic acid sequence GenBank ID: AY238887 as taught Duncan 2003.
Query Match 100.0%; Score 378; DB 1; Length 378;
Best Local Similarity 100.0%;
Matches 378; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGGGGAGTGGACCCTCTAATTTCGTCAATCACGCACCTGGAGAAGCAATTGTAACCGGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGGGAGTGGACCCTCTAATTTCGTCAATCACGCACCTGGAGAAGCAATTGTAACCGGT 60
Qy 61 TTGGAGAAAGGGGCAGATAAAGTAGCTGGAACGATATCACATACGATTTGGGAAGTGATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TTGGAGAAAGGGGCAGATAAAGTAGCTGGAACGATATCACATACGATTTGGGAAGTGATC 120
Qy 121 GCCGGATTAGTAGCCTTGCTGACATTCTTAGCGTTTGGCTTCTGGTTGTTCAAGTATCTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GCCGGATTAGTAGCCTTGCTGACATTCTTAGCGTTTGGCTTCTGGTTGTTCAAGTATCTC 180
Qy 181 CAAAAGAGAAGAGAAAGAAGGAGACAACTCACTGAGTTCCAAAAACGGTATCTACGGAAT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CAAAAGAGAAGAGAAAGAAGGAGACAACTCACTGAGTTCCAAAAACGGTATCTACGGAAT 240
Qy 241 AGCTACAGGTTGAGTGAGATCCAGAGACCTATATCACAGCACGAATACGAAGACCCATAC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AGCTACAGGTTGAGTGAGATCCAGAGACCTATATCACAGCACGAATACGAAGACCCATAC 300
Qy 301 GAGCCACCAAGTCGTAGGAAACCACCCCCTCCTCCTTATAGCACATACGTCAACATCGAT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GAGCCACCAAGTCGTAGGAAACCACCCCCTCCTCCTTATAGCACATACGTCAACATCGAT 360
Qy 361 AATGTCTCAGCCATTTAG 378
||||||||||||||||||
Db 361 AATGTCTCAGCCATTTAG 378
Claim 8: The combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches all limitations of instant claim 8, a recombinant myxoma virus expression vector comprising a recombinant nucleic acid, wherein the recombinant nucleic acid comprises a heterologous immunomodulatory gene, wherein the heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136,and wherein the heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST. Bell 2011 (US20110206640A1) disclosed a recombinant myxoma virus expression vector (administering to the host an effective amount of at least two recombinant viruses (See, para. [00241]); one or more strains of an oncolytic virus may be used in methods of the invention, simultaneously or successively. A virus may for example be selected from the group consisting of ...myxoma virus (See, para [00421]); recombinant DNA contained in a vector (See, para [0068]), The term nucleic acid includes, e.g., a genome; a recombinant nucleic acid incorporated into a vector, such as a virus ([0067]), comprising a recombinant nucleic acid, wherein the recombinant nucleic acid comprises a heterologous immunomodulatory gene, and wherein the heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST (heterologous protein includes, for example, a protein expressed from a heterologous coding sequence, Para. (0070]); recombinant virus was developed that expresses a fusion-associated Small transmembrane (p14 FAST) protein that locally induces cell fusion, (See, para [01191]).
Claim 10 (dependent on claim 1): Bell 2011 (US20110206640A1) further teach the added limitation of the instant claim 10 (dependent on claim 1), a pharmaceutical composition comprising the recombinant myxoma virus by disclosing discloses pharmaceutically acceptable “carrier” or “excipient” that can be used to formulate a pharmaceutical composition comprising recombinant myxoma virus of claim 1 (See, Bell, para [0076]). Formulation of an oncolytic virus in the form of a pharmaceutical composition for treatment of tumors or cancers is a routine practice in the art. One of the ordinary skills would have been motivated to do combine the prior art teachings of Bell, Tosic, and Boeuf to arrive at the instant claim 10 therapeutic intervention and for commercial success. One of the ordinary skills in the art would have been apprised of a reasonable expectation of success over combined teachings of Bell, Tosic, and Boeuf as recited supra to arrive at the invention of claim 10.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Bell (US20110206640A1) on oncolytic myxoma virus on p14 FAST as recited in alternative embodiments (para [0042]) and as taught the amino acid/nucleotide sequence of p14 FAST gene by Duncan et al 2003 and Duncan et al 2004 and oncolytic myxoma virus intergenic region between ORF 135 and 136 taught by Liu et al 2009 to obtain a recombinant myxoma virus that expresses the recited fusion-associated small transmembrane (p14 FAST) protein that spontaneously initiates / induces cell membrane fusion to arrive at the inventions of instant claims 1, 5, 7-8, and 10. One of the ordinary skills would have been motivated to do so given: (i) Bell 2011 teaches that Myxoma virus can be used as an oncolytic virus expressing p14 FAST (See, para [0042], [0058], para [0003], [0014]); (ii) to use known amino acid sequences for p14 FAST taught by the p14 FAST nucleotide sequence taught by Duncan 2003 and Duncan 2004 (See, Duncan 2003 GenBank ID: AY238887, Duncan 2004, abstract, results, pages 134-135-figure 4-5) and the results obtained would be predictable, expression of p14 FAST in the construct of Bell; (iii) another motivation would be to use the functionally proven intergenic genome location of myxoma virus, without adversely affecting the virus replication, as taught by Liu et al that in vitro replication kinetics of wild type Myxoma virus and recombinant myxoma virus expressing were similar (Liu et al 2019, abstract, page 5933, lines 3-4); (iv) Wolfe et al 2018 teaching that insertion of heterologous gene into intergenic region of the myxoma virus between the M135 and M136 ORFs is not known to alter the viral replication cycle (See, Wolfe et al 2018, page 13, section on Virus and Infections, lines 5-7), (v) use of synthetic early/late promoter would allow sustained expression of heterologous immunomodulatory gene during the infection cycle as observed for IL-15 of Liu et al 2009 (See, Fig. 2 C and D) and would be expected to exert efficient oncolytic activity, (iv) given the teaching of Tosic et al 2014 regarding myxoma virus specifically, myxoma virus, a rabbit poxvirus, can efficiently infect various types of mouse and human cancer cells. Myxoma virus is a strict rabbit specific pathogen and is thought to be safe as a therapeutic agent in all non-rabbit hosts tested including mice and humans. Despite its lack of broad pathogenicity other than the rabbit, myxoma virus can replicate in diverse cultured cells from many species that includes most human cancer cells, which are particularly permissive for the virus. It has recently been shown that myxoma virus can discriminate cancerous human myeloid cells from normal CD34+ stem cells, which makes it a potential ex vivo purging agent for hematological malignancies (See, Tosic et al 2014: page 1, abstract, introduction). Boeuf et al 2017 disclosed oncolytic viruses VSV expressing reovirus p14 FAST protein enhanced VSV oncolytic virotherapy in primary and metastatic tumor models, efficiently induced cell-cell fusion and syncytium formation in multiple cell types, syncytium formation enhances cell-cell virus transmission and may also induce immunogenic cell death, a form of apoptosis that stimulates immune recognition of tumor cells (similar scope regarding oncolytic virus). Therefore, one of the ordinary skills in the art would have a reasonable expectation of success to arrive the oncolytic myxoma virus of claims 1, 5, 7-8, and 10 with enhanced oncolytic properties by incorporating reovirus p14 FAST protein that confer enhanced fusion properties with the incorporation of combined prior teachings applied to the claims as recited supra. Thus, the invention was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention in view of the combined prior teachings of Bell, Duncan et al 2003, Duncan et al 2004, Liu et al 2009, Wolfe et al 2018, Tosic, and Boeuf as applied to the claims 1, 5, 7-8, and 10 as recited supra. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the inventions of claims 1, 5, 7-8, and 10. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
Claims 11-12 and 17-19: The combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches the oncolytic myxoma virus as required for the method of instant claim 11 and the prior art teachings as recited supra are incorporated here in its entirety.
Claims 11-12 and 17-19: The instant claims 11-12 and 17-19 is directed to a method of inhibiting and/or treating a cancer in a subject in need thereof, comprising: administering to the subject a composition comprising a recombinant myxoma virus, wherein the recombinant myxoma virus comprises a heterologous immunomodulatory gene, wherein the heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136, and wherein the heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST (instant claim 11); the method of claim 11, wherein the cancer is a hematological cancer or a breast cancer (instant claim 12); the method of claim 11, wherein the administering is via intravenous injection (instant claim 17); the method of claim 11, wherein the administering is via intra-tumoral injection (instant claim 18); the method of claim 11, wherein the composition induces cancer cell death (instant claim 19).
Claim 11: The combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches the oncolytic myxoma virus as required for the method of instant claim 11. The prior art US20110206640A1 by Bell teaches assed limitation of claim 11 as the prior art is directed to treatment of cancer in a subject using oncolytic viruses (para [001], [002], [0042], claims 26, 35, example 5, para [0117]- [0119]).
Claim 12: The combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches the method of instant claim 11. Bell 2011 further teaches added limitation of the claim 12 method, wherein the cancer is a hematological cancer or a breast cancer by disclosing methods and compositions disclosed and applicable from disclosures of Bell 2011 for treating cancers may also be useful in treating solid tumors arising from hematopoietic malignancies such as leukemias including both primary and metastatic solid tumors, including carcinomas of breast and hematopoietic malignancies such as leukemias (See, Bell para [0072].
Claims 17-19 (dependent on claim 11): The combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches the method of instant claim 11. Bell 2011 further teaches added limitations of claims 17-19 by disclosing the limitation of claim 17, the method wherein the administering is via intravenous injection (See, Bell 2011, para [0027], [0076], [0081], [0091], [0107], [0108]); the limitation of claim 18, the method wherein the administering is via intra-tumoral injection (See, Bell 2011, para [0081], [0082]; the limitation of claim 19, the method wherein the composition induces cancer cell death (See, Bell 2011, para [0002], [0029], [0032], [0047], [0060], [0097], [0119]).
It would have been obvious to one of the ordinary skills in the art to use the above recited oncolytic myxoma virus for fusion properties of the p14 FAST protein taught by the combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 to treat cancer in a subject in need thereof as claimed in the methods claims 11-12 and 17-19. One of the ordinary skills in the art would have been motivated to do so for better efficacy of the oncolytic virus expressing the p14 FAST fusion protein for efficacious treatment of a hematological cancer or a breast cancer and oncolysis of the cancer cells. One of ordinary skill in the art would also be motivated to do so for effective delivery of the oncolytic myxoma virus to the target cancers by administering via intravenous or intratumoral injections to lead to oncolysis and cancer cell death (claims 17-19). One of ordinary skills in the art would have been motivated to do so better efficacy of the oncolytic virus for better efficacy of treatment using recombinant myxoma virus expressing p14 FAST and for commercial success. One of the ordinary skills in the art would have a reasonable expectation of success to arrive at the inventions of claims 11-12 and 17-19 given the combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017, and regarding the types of cancer that can be treated as disclosed by Boeuf et al 2017 as recited in the applied prior art. The inventions of the claims 11-12 and 17-19 were clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the inventions of claims 11-12 and 17-19. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
10. Claims 2, 9 and 14 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89) as applied to claims 1, 5, 7-8, 10, 11-12 and 17-19 above, and further in view of Song et al 2018 (WO2018049248A1, published 15 March 2018).
Claims 2, 9 and 14: The combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches the recombinant oncolytic myxoma virus of claim 1 required for claim 2, a recombinant oncolytic myxoma virus vector of claim 8 required for claim 9, and a method of claim 11 required for claim 14 as recited supra, however, do not teach the added limitations of claims 2 and 9 and 14, wherein the recombinant oncolytic myxoma virus or a recombinant oncolytic myxoma virus vector further comprise heterologous immunomodulatory genes a PD-L1 inhibitor, BiKE, LIGHT and/or Decorin.
Song (WO2018049248A1) is in the oncolytic virus art and provides teaching to the claimed invention, an oncolytic myxoma virus (See, para [0015], [0104], [0125], [0440], and claim 15; para [0066], [0078], [0131], [0132] ), and the oncolytic myxoma virus further comprise a heterologous immunomodulatory gene PD-L1 inhibitor (See, para [0015] and [0016]; [0109], [0110]-[0113], [0180], [0182], [0184], [0185]-[0186], [0213], [0237], claims 15, 18-24).
Song (WO2018049248A1) also discloses the invention, an oncolytic virus comprising a nucleic acid encoding a bispecific engager molecule comprising a first antigen-binding domain specifically recognizing a tumor antigen and a second antigen-binding domain specifically recognizing a cell surface molecule on an effector immune cell (See, claims 1, 26, 40, para [0004], [0008]), in some embodiments the oncolytic virus encodes/comprises a second antigen binding domain specifically recognizing a cell surface molecule NPp46 on an effector cell- a natural killer (NK) cell, the first and/or second antigen-binding domain of a bispecific engager molecule is a single chain variable fragment (scFv) (See, para [0011]- [0013], claim 41, 43) and such NK cell targeting bi-specific engager molecule is known as BiKE, Bi-specific Killer cell Engager.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of a recombinant myxoma virus of claims 1 or a recombinant myxoma virus expression vector of claim 8 as taught by combined teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 with the teachings of Song et al on PD-L1 inhibitor and BiKE to comprise a recombinant oncolytic myxoma virus comprising heterologous immunomodulatory genes further comprise a PD-L1 inhibitor, or BiKE to arrive at the invention of instant claims 2, and 9. Similarly, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings applied to the method of claim 11 with the teachings of Song et al on PD-L1 inhibitor and BiKE to arrive at the method of claim 14. One of the ordinary skills would have been motivated to do so given the suggestion and teaching of Song on anti-tumor effect of the heterologous immunomodulatory genes PD-L1 inhibitor, BiKE, as recited supra. The motivation to comprise PD-L1 inhibitor and BiKE in the oncolytic myxoma virus or the vector and the method of claim 14 would have been the teachings that incorporation of more than one immunomodulatory gene expressing PD-L1 inhibitor, BiKE would prove highly effective in treatment of breast cancer and hematological cancer due to different and more than one cancer targets and different tumor killing mechanisms as taught and recited, supra, by Song, PD-L1 inhibitor, BiKE. Increased PD-1 expression correlates with reduced survival in cancer patients, and the engagement of the PD-1/PD-L1 pathway results in inhibition of T-cell effector function, cytokine secretion and proliferation (See, Song [0185]). An oncolytic virus expressing BiKE (bispecific engager-armed oncolytic virus) (i) facilitate T-cell tumor infiltration and T-cell activation at tumor sites, (ii) effectively lyse tumor cells that are infected or not infected by the bispecific engager-armed oncolytic virus (iii) minimize on-target toxicity against normal tissues expressing low amounts of targeted tumor-associated antigens; and (iv) minimize systemic adverse events (See, para [0088]). The motivation to combine the prior art teachings as recited supra would also be for a commercial success. One of the ordinary skills in the art would have a reasonable expectation of success given the teachings of Bell regarding the types of cancer that can be treated and recited and combined prior art teachings applied to claims 2, 9 and 14. Thus, the invention was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claims 2, 9 and 14. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
11. Claim 13 (dependent on claim 11) is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89) as applied to claims 1, 5, 7-8, 10, 11-12 and 17-19 above, and further in view of Song 2018 (WO2018049248A1, published 15 March 2018).
Claim 13: The combined teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra, however, does not teach treatment of HER2 negative cancer.
Song (WO2018049248A1) is in the oncolytic virus art and teaches the added limitation of instant claim 13, wherein the cancer is a HER2 negative cancer by disclosing in some embodiments, the method described herein is suitable for treating the breast cancer that is HER2 positive or HER2 negative (See, para [0267]). In some embodiments, the breast cancer is a triple negative breast cancer. (See, para [0010], [0145], [0150], [0267], para [0426] Embodiment 7, and claim 7).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as applied to the method of instant claim 11 to incorporate teachings of Song (WO2018049248A1) on inhibiting/treating a HER2 negative breast cancer. The motivation would be the teachings of Boeuf et al 2017 that Reovirus p14 FAST protein enhances oncolytic virotherapy in primary and metastatic tumor models by efficiently inducing cell-cell fusion and syncytium formation, syncytium formation enhances cell-cell virus transmission and may also induce immunogenic cell death, a form of apoptosis that stimulates immune recognition of tumor cells. The reoviral p14 FAST proteins may therefore provide a multi-pronged approach to improving oncolytic virotherapy via syncytium formation and enhanced immune stimulation (See, page 80, abstract) as recited supra. Another motivation would be that Myxoma virus is a strict rabbit specific pathogen and is thought to be safe as a therapeutic agent in all non-rabbit hosts tested including mice and humans and was found safe in subcutaneous tumor treatment in the subjects (See, Tosic et al 2014: page 1, abstract, introduction, figures 1-8). The motivation to combine the prior art teachings as recited supra would also be for a commercial success. One of the ordinary skills in the art would have expected a reasonable expectation of success given the combined prior teachings as applied to claim 13. Thus, the invention of claim 13 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 13. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
12. Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89) as applied to claims 1, 5, 7-8, 10, 11-12 and 17-19 above, and further in view of Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140).
Claims 16. The instant claim 16 is directed to the method of claim 11, wherein the nucleic acid encoding p14 FAST is at least 80% identical to SEQ ID NO: 1.
The combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches the method of claim 11.
Bell 2011 (US20110206640A1) discloses p14 FAST protein amino acid sequence with a GenBank accession number AAP03134. The AAP03134 amino acid sequence is a p14 FAST GenBank Locus, alternatively recited in GenBank as accession AY238887.1 as a nucleotide sequence).
Duncan 2003 discloses the added limitation of instant claim 16 by disclosing 100% homology/identity of the nucleic acid sequence encoding p14 FAST with both GenBank Accession No. AY238887 and SEQ ID NO: 1 of instant claim 16, as recited supra.
Qy: Nucleic acid sequence with recited GenBank Accession No. AY238887 SEQ ID NO:1 of instant claim 16.
Db: p14FAST protein amino acid sequence GenBank ID: AAP03134 of Bell US20110206640A1 encoded by the nucleic acid sequence GenBank ID: AY238887 as taught Duncan.
Query Match 100.0%; Score 378; DB 1; Length 378;
Best Local Similarity 100.0%;
Matches 378; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGGGGAGTGGACCCTCTAATTTCGTCAATCACGCACCTGGAGAAGCAATTGTAACCGGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGGGAGTGGACCCTCTAATTTCGTCAATCACGCACCTGGAGAAGCAATTGTAACCGGT 60
Qy 61 TTGGAGAAAGGGGCAGATAAAGTAGCTGGAACGATATCACATACGATTTGGGAAGTGATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 TTGGAGAAAGGGGCAGATAAAGTAGCTGGAACGATATCACATACGATTTGGGAAGTGATC 120
Qy 121 GCCGGATTAGTAGCCTTGCTGACATTCTTAGCGTTTGGCTTCTGGTTGTTCAAGTATCTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GCCGGATTAGTAGCCTTGCTGACATTCTTAGCGTTTGGCTTCTGGTTGTTCAAGTATCTC 180
Qy 181 CAAAAGAGAAGAGAAAGAAGGAGACAACTCACTGAGTTCCAAAAACGGTATCTACGGAAT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CAAAAGAGAAGAGAAAGAAGGAGACAACTCACTGAGTTCCAAAAACGGTATCTACGGAAT 240
Qy 241 AGCTACAGGTTGAGTGAGATCCAGAGACCTATATCACAGCACGAATACGAAGACCCATAC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 AGCTACAGGTTGAGTGAGATCCAGAGACCTATATCACAGCACGAATACGAAGACCCATAC 300
Qy 301 GAGCCACCAAGTCGTAGGAAACCACCCCCTCCTCCTTATAGCACATACGTCAACATCGAT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 GAGCCACCAAGTCGTAGGAAACCACCCCCTCCTCCTTATAGCACATACGTCAACATCGAT 360
Qy 361 AATGTCTCAGCCATTTAG 378
||||||||||||||||||
Db 361 AATGTCTCAGCCATTTAG 378
Thus, the instant claim 16 method and added limitation wherein the nucleic acid encoding p14 FAST is at least 80% identical to SEQ ID NO: 1 is rendered obvious over combined teachings of Bell 2011, Tosic, Boeuf, Duncan 2003 and Duncan 2004. The prior art US20110206640A1 by Bell is directed to treatment of cancer in a subject using oncolytic viruses (para [001], [002], [0042], claims 26, 35, example 5, para [0117]- [0119]). As recited, supra, the combined teachings of Bell, Duncan, Tosic and Boeuf renders obvious a recombinant oncolytic myxoma virus encoding the heterologous immunomodulatory gene comprising a nucleic acid encoding p14 FAST (instant claim 1).
It would have been obvious to one of the ordinary skills in the art to use the oncolytic myxoma virus and method taught by the combined prior art teachings applied to claim 11 to to further incorporate the nucleic acid encoding p14 FAST is at least 80% identical to SEQ ID NO: 1 in the myxoma virus to develop a method of claim 16 to treat cancer in a subject in need thereof. One of ordinary skill in the art would been motivated to do so for using fusogenic properties of p14 FAST oncolytic myxoma virus and for commercial success. One of the ordinary skills in the art would have a reasonable expectation of success to arrive at the inventions of claim 16 given the combined teachings of the prior arts applied to the claim as recited supra. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 16. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
13. Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell), Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938), Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission), Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89) as applied to claims 1, 5, 7-8, 10, 11-12 and 17-19 above, and further in view of McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden) and Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan).
Claim 20: The combined teachings of the prior arts by Bell, Duncan et al 2003, Duncan et al 2004, Liu et al 2009, Wolfe et al 2018, Tosic, and Boeuf as recited, supra, teaches the recombinant myxoma virus of claim 1 and the prior art teachings that render obvious claims 1 obvious are incorporated here in its entirety.
The combined teachings of the prior teachings by Bell, Duncan et al 2003, Duncan et al 2004, Liu et al 2009, Wolfe et al 2018, Tosic, and Boeuf do not teach added limitation of the instant claim 20, a method of inhibiting and/or treating a hematological cancer in a subject in need thereof, comprising administering to the subject mononuclear peripheral blood cells and/or bone marrow cells comprising the recombinant myxoma virus of claim 1 comprising a heterologous immunomodulatory gene p14 FAST encoding nucleic acid sequence (instant claim 20 limitation).
McFadden et al 2017 (US9730960B2) is in the oncolytic myxoma virus treatment of cancer art and discloses treatable hematopoietic malignancies/cancers including breast cancer and multiple myeloma by using PBMCs and bone marrow cells adsorbed with myxoma virus under good tissue practice clinical conditions (See, abstract, col 12, lines 33-40, col 6, lines 55-67; see claims 5-7) in an approach of Graft-versus-host disease (GVHD) treatment of cancers; human bone marrow cells and peripheral blood mononuclear cells were infected by incubation with vMyx-GFP, a MYXV at a multiplicity of infection (MOI) of 10 for 3 hours in PBS+10% FBS in a humidified chamber at 37° C and 5% CO2 (See, Example 1, col 7-8). Mice injected with healthy bone marrow cells that had been pretreated ex vivo with the myxoma virus universally survived without evidence for wasting; post-mortem histology revealed that mice injected with MYXV-treated bone marrow (BM) displayed virtually no infiltration of human CD3+T lymphocytes into any major organ, e.g., spleen, lung, liver, kidney; the novel observation that ex vivo treatment of allogeneic human hematopoietic cell grafts with MYXV can prevent GVHD and permit efficient engraftment of normal human HSPC (See, Example 1, col 7-8, col 10 lines 25-36, entire US9730960B2).
Chan et al 2014 teaches that ex vivo MYXV infection of human patient bone marrow cells or peripheral blood mononuclear cell samples selectively eliminates contaminating acute myeloid leukemia or multiple 4+myeloma cells from the specimen without affecting the ability of the resident normal CD3 stem and progenitor cells to engraft immunodeficient NOD/scid/IL2R.-knockout (NSG) mice. The myxoma virus infection of cells downregulates MHC-I and enhances NK cell activity and thus, MYXV infection not only leads to the direct killing of cancer cells but also promotes early immune cell–mediated antitumor responses (See, abstract, page 199-table 3, pages 202-204).
It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Bell, Duncan et al 2003, Duncan et al 2004, Liu et al 2009, Wolfe et al 2018, Tosic, and Boeuf as applied to method of claims 1 to incorporate the teachings of McFadden et al 2017 and Chan to arrive at the method of claim 20 comprising mononuclear peripheral blood cells and/or bone marrow cells comprising/infected with the recombinant myxoma virus expressing p14 FAST thereby treating and/or inhibiting the hematological cancer in the subject in need thereof. One would have been motivated to do so given the suggestion and teaching of McFadden et al 2017 on successful treatment of hematopoietic malignancies/cancers, multiple myeloma, leukemia by using the myxoma virus comprising/infected PMBCs/stem cells approach. One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claim 20. Thus, the invention of claim 20 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 20. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
14. Claims 24-25 are rejected under 35 U.S.C. 103 as being unpatentable over combined prior art teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89) as applied to claims 1, 5, 7-8, 10, 11-12 and 17-19 above, and further in view of McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden) and Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), as applied to claim 20 above and further in view of Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Claims 24-25: The combined teachings of Bell, Duncan et al 2003, Duncan et al 2004, Liu et al 2009, Wolfe et al 2018, Tosic, Boeuf, McFadden et al 2017, and Chan 2014 teaches the method of claim 20 as recited supra, however, do not teach added limitation, further comprising adsorbing the recombinant myxoma virus ex vivo onto the surface of the mononuclear peripheral blood cells and/or the bone marrow cells (instant claim 24); wherein the adsorbing the recombinant myxoma virus comprises exposing the mononuclear peripheral blood cells and/or the bone marrow cells to the virus under conditions permitting binding/adsorption of the virus to the surface of the mononuclear peripheral blood cells and/or bone marrow cells (instant claim 25).
Villa et al 2016 is in the art and teaches ex vivo treatment or adsorption of oncolytic myxoma virus on Bone marrow (BM) cells and mobilized peripheral blood stem cells (mPBSCs) obtained from patients with hematologic malignancies at various time, temperature and incubation media conditions. Myxoma virus does not impair hematopoietic stem and progenitor cells. An oncolytic myxoma virus selectively targets human leukemia, myeloma and lymphoma cells while sparing normal hematopoietic stem and progenitor cells (HSPCs). Bone marrow cells or mPBSCs were suspended in plain Iscove’s Modified Dulbecco’s (IMDM) medium or Plasma-lyte A supplemented with ACDA were incubated with vMyx-GFP at MOI of 10 for 1 h at room temperature to allow virus adsorption. An MOI of 10 was selected to ensure that hematopoietic cells would be exposed to an abundance of virus for infection. After this, cells were incubated for either 2 or 24 h at 37°C 5% CO2 to allow for virus infection. For both time points, cells were suspended in either complete IMDM (supplemented with 10% fetal bovine serum [FBS], 2 mmol/L L-glucosamine and 100 U/mL penicillin-streptomycin) or Plasma-lyte A + 10% ACDA for 2 h. Myxoma virus infection of BM cells and mPBSC cells was determined by flow cytometry. Peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors. PBMCs from three healthy individuals were incubated with vMyx-GFP/tomato red fluorescent protein (TrFP) at an MOI of 10 at 4°C for 1 h and after washing to remove unbound virions, cells were further incubated at 37°C for 24 h and PBMCs with adsorbed myxoma virus were harvested (See, abstract, introduction, results, discussion, figures 1-3).
Chan et al 2014 reviewed and thus disclosed ex vivo treatment of samples with oncolytic MYXV prior to implantation or engraftment (See, page 4253, Table 1) Acute myeloid leukemia (AML) and Multiple myeloma (MM). The studies summarized above clearly show that MYXV has the ability to discriminate cancerous myeloid cells from the normal CD34+ HSPCs found within complex bone marrow transplant samples and is thus an attractive candidate to be exploited as an ex vivo purging agent for AML and MM from autologous stem cell transplant specimens (See, Chan et al 2014, page 4254, col 1, para 4).
Bartee et al 2012 teaches selective purging of human multiple myeloma cells from autologous stem cell transplantation grafts using oncolytic myxoma virus. Bartee et al 2012 teaches ex vivo treatment with an oncolytic poxvirus called myxoma virus results in specific elimination of human myeloma cells by inducing rapid cellular apoptosis while fully sparing normal hematopoietic stem and progenitor cells. The specificity of this elimination is based on strong binding of the virus to myeloma cells coupled with an inability of the virus to bind or infect CD34(+) hematopoietic stem and progenitor cells. These 2 features allow myxoma to readily identify and distinguish even low levels of myeloma cells in complex mixtures. This ex vivo rabbit-specific oncolytic poxvirus called myxoma virus treatment also effectively inhibits systemic in vivo engraftment of human myeloma cells into immunodeficient mice and results in efficient elimination of primary CD138(+) myeloma cells contaminating patient hematopoietic cell products. We conclude that ex vivo myxoma treatment represents a safe and effective method to selectively eliminate myeloma cells from hematopoietic autografts before reinfusion, MYXV specifically eliminates MM Cells while sparing normal hematopoietic stem cells, MYXV elimination of human MM cells requires direct virion binding by adsorption, and conditions for ex vivo adsorption (See, Bartee et al 2012, abstract, page 1541, col 2 methods, Fig 1-6, Results page 1542-550, page 1544, col 1 last para, col 2, and entire article).
Chan et al 2014 teaches that ex vivo MYXV infection of human patient bone marrow cells or peripheral blood mononuclear cell samples selectively eliminates contaminating acute myeloid leukemia or multiple 4+myeloma cells from the specimen without affecting the ability of the resident normal CD3 stem and progenitor cells to engraft immunodeficient NOD/scid/IL2R.-knockout (NSG) mice. The myxoma virus infection of cells downregulates MHC-I and enhances NK cell activity and thus, MYXV infection not only leads to the direct killing of cancer cells but also promotes early immune cell–mediated antitumor responses (See, abstract, page 199-table 3, pages 202-204).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings that are applied to claim 20 as recited supra and to incorporate the teachings of Villa et al 2016, Chan et al 2013, Chan et al 2014, and Bartee et al 2012 to arrive at the invention of claims 24 and 25 methods. One of the ordinary skills would have been motivated to do so given the suggestion and teaching of Villa et al 2016, Chan et al 2013, Chan et al 2014, and Bartee et al 2012 selective purging of human multiple myeloma cancerous cells by successful adsorption of oncolytic myxoma virus as recited supra. The motivation would be an oncolytic myxoma virus-based purging or cleansing of contaminating cancerous cells in autologous bone marrow cells or PBMCs or PBSCs used in treatment of hematopoietic cancers; with the teachings that myxoma virus cannot infect normal human cells productively; however, the oncolytic myxoma virus infect a variety of cancer types (See, Chan et al 2013, Chan et al 2014, Villa et al 2016, Bartee et al 2012). One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claims 24-25. Thus, the invention of claims 24-25 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claims 24-25. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
15. Claim 33 is rejected under 35 U.S.C. 103 as being unpatentable over combined prior art teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89) as applied to claims 1, 5, 7-8, 10, 11-12 and 17-19 above and further in view of Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198).
Claim 33: The method of claim 12, wherein the hematological cancer is drug-resistant multiple myeloma.
The combined teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as recited supra teaches teaches the method of claim 12 as recited supra. However, do not teach added limitation of claim 33, wherein the hematological cancer is drug-resistant multiple myeloma.
Dunlap et al 2015 is in the art and teaches the added limitation of instant claim 33 wherein the hematological cancer is drug-resistant multiple myeloma by disclosing myxoma-based oncolytic therapy as an attractive option for myeloma patients whose disease is refractory to chemotherapeutic proteasome inhibitors (PI) (See, abstract). Dunlap et al 2015 teaches that myxoma virus treatment caused equal losses of viability from both PI-sensitive and resistant Dox40 multiple myeloma (MM) cells (Figure 1), suggesting that myxoma virus treatment can overcome the resistance to proteasome inhibitor (PI) based chemotherapy developed by some MM cells, thus killing occurs in both bortezomib-sensitive and bortezomib-resistant MM cells, in MM cell lines, MYXV induces efficient cell killing that is dependent upon caspase-8 mediated apoptosis and by inhibiting ATF4 expression during the unfolded protein response (See, Dunlap et al 2015, p.3, results, col 2, p.4, Figure 1, entire research article; See, page 7 para 4 of review by Calton et al 2018).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Bell 2011, Liu et al 2009, Duncan et al 2003, Duncan et al 2004, Wolfe et al 2018, Tosic et al 2014 and Boeuf et al 2017 as applied to the method of claim 12 and incorporate teachings of Dunlap et al 2015 and Calton et al 2018 to arrive at the method of claim 33 comprising treatment of a hematological cancer or a breast cancer and the hematological cancer is drug-resistant multiple myeloma. One of the ordinary skills in the art would have been motivated to do so given the suggestion and teaching of Dunlap et al 2015 on effectiveness of oncolytic myxoma virus for treatment of drug-resistant multiple myeloma. The oncolytic myxoma virus in the instant claim 33 comprising a recombinant myxoma virus comprising the heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST due to the fusogenic property of p14 FAST protein would be expected to be efficacious and effective as an oncolytic myxoma-p14 FAST recombinant virus against drug-resistant multiple myeloma and expected to be of commercial value and success. One of the ordinary skills in the art would have a reasonable expectation of success given the prior teachings in the oncolytic virus art as applied to claim 33. Thus, the invention of claim 33 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 33. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
16. Claim 34 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden) and Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan) as applied to claim 20 above and further in view of Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Bartee et al 2012 (Biol Blood Marrow Transplant 18:1540-1551, 2012), Calton et al 2018, Cancers 2018, 10, 198) and Bartee et al 2016 (Molecular Therapy-Oncolytics (2016) 3, 16032).
Claim 34: The method of claim 20, wherein the hematological cancer is drug-resistant multiple myeloma.
The combined prior art teachings of Bell, Duncan et al 2003, Duncan et al 2004, Liu et al 2009, Wolfe et al 2018, Tosic, Boeuf, McFadden et al 2017, and Chan 2014 teaches the method of claim 20 teaches the method of claim 20 as recited supra, however, do not teach added limitation of instant claim 34, wherein the hematological cancer is drug-resistant multiple myeloma.
Dunlap et al 2015 is in the art and teaches the added limitation of instant claim 33 wherein the hematological cancer is drug-resistant multiple myeloma by disclosing myxoma-based oncolytic therapy as an attractive option for myeloma patients whose disease is refractory to chemotherapeutic proteasome inhibitors (PI) (See, abstract). Dunlap et al 2015 that myxoma virus treatment caused equal losses of viability from both PI-sensitive and resistant Dox40 multiple myeloma (MM) cells (Figure 1), suggesting that myxoma virus treatment can overcome the resistance to proteasome inhibitor (PI) based chemotherapy developed by some multiple myeloma (MM) cells (See, p.3, results, col 2, p.4, Figure 1, entire research article).
Calton et al 2018 in a review on oncolytic viruses for multiple myeloma therapy discloses that oncolytic myxoma virus treatment results in killing occurs in both bortezomib-sensitive and bortezomib-resistant multiple myeloma (MM) cells, in MM cell lines, oncolytic myxoma virus induces efficient cell killing that is dependent upon caspase-8 mediated apoptosis and by inhibiting ATF4 expression during the unfolded protein response (See, Calton et al 2018, page 7 para 4 of the review).
Bartee et al 2012 teaches selective purging of human multiple myeloma cells from autologous stem cell transplantation grafts using oncolytic myxoma virus. Bartee et al 2012 teaches ex vivo treatment with an oncolytic poxvirus called myxoma virus results in specific elimination of human myeloma cells by inducing rapid cellular apoptosis while fully sparing normal hematopoietic stem and progenitor cells. The specificity of this elimination is based on strong binding of the virus to myeloma cells coupled with an inability of the virus to bind or infect CD34(+) hematopoietic stem and progenitor cells. These 2 features allow myxoma to readily identify and distinguish even low levels of myeloma cells in complex mixtures. This ex vivo rabbit-specific oncolytic poxvirus called myxoma virus treatment also effectively inhibits systemic in vivo engraftment of human myeloma cells into immunodeficient mice and results in efficient elimination of primary CD138(+) myeloma cells contaminating patient hematopoietic cell products. We conclude that ex vivo myxoma treatment represents a safe and effective method to selectively eliminate myeloma cells from hematopoietic autografts before reinfusion (See, abstract, figures, and entire article).
Bartee et al 2016 teaches systemic therapy with oncolytic myxoma virus cures established residual multiple myeloma in mice. Bartee et al 2016 discloses that intravenous administration of myxoma virus into mice bearing disseminated myeloma results in the elimination of 70–90% of malignant cells within 24 hours. This rapid debulking was dependent on direct contact of myxoma virus with residual myeloma and did not occur through destruction of the hematopoietic bone marrow niche. Importantly, systemic myxoma therapy also induced potent antimyeloma CD8+ T cell responses which localized to the bone marrow and were capable of completely eradicating established myeloma in some animals. These results demonstrate that oncolytic myxoma virus is not only effective at preventing relapse caused by reinfusion of tumor cells during stem cell transplant but is also potentially curative for patients bearing established minimal residual disease (See, abstract, figures, and entire article).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Bell, Duncan et al 2003, Duncan et al 2004, Liu et al 2009, Wolfe et al 2018, Tosic, Boeuf, McFadden et al 2017, and Chan 2014 on a method of inhibiting and/or treating a hematological cancer in a subject in need thereof, inter alia, comprising administering to the subject wherein the mononuclear peripheral blood cells and/or bone marrow cells comprise the recombinant myxoma virus encoding p14 FAST and incorporate the prior art teachings of Dunlap et al, Bartee et al 2012, Bartee et al 2016, Carlton et al 2018 to arrive at the invention of claim 34. One of the ordinary skills in the art would have been motivated to do so given the suggestion and teaching of Dunlap et al 2015 on effectiveness of oncolytic myxoma virus for treatment of drug-resistant multiple myeloma and teachings of Bartee et al 2012 on selective purging of human multiple myeloma cells from autologous stem cell transplantation grafts using oncolytic myxoma virus and teachings of Bartee et al 2016 on systemic therapy with oncolytic myxoma virus cures established residual multiple myeloma in mice as recited supra. The oncolytic myxoma virus in the instant claim 34 comprising a recombinant myxoma virus comprising the heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST due to the fusogenic property of p14 FAST protein would be expected to be effective as an oncolytic myxoma-p14 FAST recombinant virus against drug-resistant multiple myeloma and expected to be of commercial value and success. One of the ordinary skills in the art would have a reasonable expectation of success given the prior teachings in the oncolytic virus art as applied to claim 34. Thus, the invention of claim 34 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 34. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
Double Patenting (Amended)
17. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
18. Claims 1-2, 5, 9, 11-12 and 20, 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 120, 122, 124, 132, 138, and 139 of co-pending application no. 17274051 in view of combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims 1-2, 5, 9, 11-14 and 20, 24-25 and the co-pending reference claims 120, 122, 124, 132, 138, and 139 are drawn to an oncolytic virus, an oncolytic myxoma virus comprising one or more immunomodulatory genes for treating hematological cancer in a subject by administering the recombinant myxoma virus.
Copending reference claims 120, 122,124, teaches BiKE to instant claims 1, 2, 9.
Copending reference claims 132, teaches immunomodulator genes inserted in the intergenic region between ORF135 and ORF136 in instant claims 3, 5.
Copending reference claims 138, 139 teaches hematological cancer and BiKE in instant claims 11-14
Copending reference claim 139 teaches leucocytes comprising myxoma virus administration in instant claims 20, 24-25.
The differences between the instant claims and reference patented claims are:
The instant claims 1-2, 5, 9, 11-12 and 20, 24-25 comprise added limitations that a recombinant myxoma virus, comprising a heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST.
The co-pending reference claims 120, 122, 124, 132, 138, and 139 of co-pending application no. 17274051 does not comprise added limitation an oncolytic myxoma virus comprising a heterologous immunomodulatory gene p14 FAST encoding nucleic acid.
Bell (US20110206640A1) as recited, supra, discloses an oncolytic virus/oncolytic myxoma virus comprising a heterologous immunomodulatory gene p14 FAST encoding nucleic acid and a particular use in treating a hematopoietic malignancies/cancer such as leukemias and leukemia.
Villa teaches ex vivo treatment for adsorption of an oncolytic myxoma virus on surface of Bone marrow (BM) cells, mobilized peripheral blood stem cells (mPBSCs) and PBMCs.
McFadden (US9730960B2) as recited supra discloses treatable hematopoietic malignancies/cancers including breast cancer and multiple myeloma by using PBMCs and bone marrow cells adsorbed with myxoma virus under good tissue practice clinical conditions (See, col 12, lines 33-40, col 6, lines 55-67; see claims 5-7, Example 1, col 7-14, col 10 lines 25-36).
Bartee et al 2012 teaches selective purging of human multiple myeloma cells from autologous stem cell transplantation grafts using oncolytic myxoma virus. Bartee et al 2012 teaches ex vivo treatment with an oncolytic poxvirus called myxoma virus results in specific elimination of human myeloma cells by inducing rapid cellular apoptosis while fully sparing normal hematopoietic stem and progenitor cells. We conclude that ex vivo oncolytic myxoma virus treatment specifically eliminates MM Cells while sparing normal hematopoietic stem cells, MYXV elimination of human MM cells requires direct virion binding by adsorption, and conditions for ex vivo adsorption (See, Bartee et al 2012, abstract, page 1541, col 2 methods, Fig 1-6, Results page 1542-550, page 1544, col 1 last para, col 2, and entire article).
Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention to do an obvious modification to the co-pending claimed invention of claims 120, 122, 124, 132, 138, and 139 (application no. 17274051) given the teachings of Bell (US20110206640A1) on an oncolytic virus/oncolytic myxoma virus comprising a heterologous immunomodulatory gene p14 FAST encoding nucleic acid as recited, supra, and a particular use of the virus in treating a hematopoietic malignancies/cancer such as leukemias (See, claims 1, 21-24, para [0072]) and McFadden (US9730960B2) as recited supra disclosing treatable hematopoietic malignancies/cancers including breast cancer and multiple myeloma by using PBMCs and bone marrow cells adsorbed with myxoma virus and teachings of Villa and Bartee et al 2012 on ex vivo treatment for adsorption of an oncolytic myxoma virus on surface of Bone marrow (BM) cells, mobilized peripheral blood stem cells (mPBSCs) and PBMCs to arrive at the claimed inventions. The motivation to modify the invention of co-pending application no. 17274051 reference claims 120, 122, 124, 132, 138, and 139 with the teachings of Bell, McFadden and Villa to arrive at the claimed inventions of instant claims 1-2, 5, 9, 11-12 and 20, 24-25 would be that (i) the p14 FAST gene expressed by oncolytic myxoma virus functions as promiscuous cellular fusogens, the p14 FAST fusion protein- spontaneously initiates cell membrane fusion that could help destroy the cancer cells (See, Bell (US20110206640A1) para [0058], [0119]); and (ii) purging or cleansing of contaminating cancerous cells in autologous bone marrow cells or PBMCs or PBSCs used in treatment of hematopoietic cancers; and the teachings that myxoma virus cannot infect normal human cells productively; however, the oncolytic myxoma virus infect a variety of cancer types (See, Calton et al 2018, page 7, para 3; Chan et al 2014, page 202-204; Villa et al 2016, page 464, introduction); (iii) another motivation would be to evade the neutralizing antibody response against the recombinant myxoma virus due to the virus specific immune response from prior treatment and a novel strategy for delivery of the myxoma virus through carrier cells to tumor targets directly (See, Calton et al 2018, page 8, para 3 on Carrier Cells). Therefore, the instant claims 1-2, 5, 9, 11-12 and 20, 24-25 would be an obvious variant of the co-pending reference claims 120, 122, 124, 132, 138, and 139 (Application No. US17274051) in view of the teachings of the prior arts as recited supra incorporating here in entirety the applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct co-pending claims have not yet been patented on the date of issue of this office action.
19. Claims 1-2, 9, 14, 20, and 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 2, 5, 8-9, 16, 30 and 35 of co-pending application no. 17767856 in view of combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims 1-2, 9, 14, 20, and 24-25 and the copending reference claims 2, 5, 8-9, 16, 30 and 35 are drawn to an oncolytic virus, an oncolytic recombinant myxoma virus comprising immunomodulatory genes for treating hematological cancer in a subject by administering the recombinant oncolytic myxoma virus. The instant claims 1, 9, and 14 limitations are taught by reference claims 2, 5, 8-9, 16, 30 by disclosing an oncolytic myxoma virus comprising a Bi-specific Natural Killer and Neutrophil engager, BiKE.
The instant claims 20, and 24-25 are taught by a reference claim 35 by disclosing a method of treating a hematological cancer in a subject in need thereof, comprising administering to the subject a leucocyte, wherein the leucocyte comprises or is associated with myxoma virus (MYXV).
The differences between the instant claims and reference patented claims are:
The instant claims 1, 9, 14, 20, and 24-25 comprise added limitations that a recombinant myxoma virus, comprises a heterologous immunomodulatory gene p14 FAST encoding nucleic acid sequence.
The co-pending reference claims 2, 5, 8-9, 16, 30 and 35 of co-pending application no. US17767856 does not comprise an added limitation a heterologous immunomodulatory gene p14 FAST encoding oncolytic myxoma virus; however, comprise a limitation on multi-specific immune cell engager comprising BiKE, BiTE or MiTE.
Bell (US20110206640A1) as recited, supra, discloses an oncolytic virus/oncolytic myxoma virus comprising a heterologous immunomodulatory gene p14 FAST encoding nucleic acid,inter alia, BiKE, and a particular use in treating a hematopoietic malignancies/cancer such as leukemias and leukemia.
Villa teaches ex vivo treatment for adsorption of an oncolytic myxoma virus on surface of Bone marrow (BM) cells, mobilized peripheral blood stem cells (mPBSCs) and PBMCs.
McFadden (US9730960B2) as recited supra discloses treatable hematopoietic malignancies/cancers including breast cancer and multiple myeloma by using PBMCs and bone marrow cells adsorbed with myxoma virus under good tissue practice clinical conditions (See, col 12, lines 33-40, col 6, lines 55-67; see claims 5-7, Example 1, col 7-14, col 10 lines 25-36).
Bartee et al 2012 teaches selective purging of human multiple myeloma cells from autologous stem cell transplantation grafts using oncolytic myxoma virus. Bartee et al 2012 teaches ex vivo treatment with an oncolytic poxvirus called myxoma virus results in specific elimination of human myeloma cells by inducing rapid cellular apoptosis while fully sparing normal hematopoietic stem and progenitor cells. We conclude that ex vivo oncolytic myxoma virus treatment specifically eliminates MM Cells while sparing normal hematopoietic stem cells, MYXV elimination of human MM cells requires direct virion binding by adsorption, and conditions for ex vivo adsorption (See, Bartee et al 2012, abstract, page 1541, col 2 methods, Fig 1-6, Results page 1542-550, page 1544, col 1 last para, col 2, and entire article).
Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to do an obvious modification to the co-pending claimed invention of claims 2, 5, 8-9, 16, 30 and 35 (application no. US17767856) given the teachings of Bell (US20110206640A1) on an oncolytic virus/oncolytic myxoma virus comprising a heterologous immunomodulatory gene p14 FAST encoding nucleic acid as recited, supra, and teachings on use of the virus in treating a hematopoietic malignancies/cancer such as leukemias (See, claims 1, 21-24, para [0072]) and McFadden (US9730960B2) as recited supra disclosing treatable hematopoietic malignancies/cancers including breast cancer and multiple myeloma by using PBMCs and bone marrow cells adsorbed with myxoma virus and teachings of Villa and Bartee et al on ex vivo treatment for adsorption of an oncolytic myxoma virus on surface of Bone marrow (BM) cells, mobilized peripheral blood stem cells (mPBSCs) and PBMCs to arrive at the claimed inventions. The motivation to modify the invention of co-pending application no. US17767856 reference claims 2, 5, 8-9, 16, 30 and 35 with the teachings of Bell, McFadden and Villa to arrive at the claimed inventions of instant claims 1-2, 9, 14, 20, and 24-25 would be that (i) the p14 FAST gene expressed by oncolytic myxoma virus functions as promiscuous cellular fusogens, the p14 FAST fusion protein- spontaneously initiates cell membrane fusion that could help destroy the cancer cells (See, Bell (US20110206640A1) para [0058], [0119]); and (ii) purging or cleansing of contaminating cancerous cells in autologous bone marrow cells or PBMCs or PBSCs used in treatment of hematopoietic cancers; and the teachings that myxoma virus cannot infect normal human cells productively; however, the oncolytic myxoma virus infect a variety of cancer types (See, Calton et al 2018, page 7, para 3; Chan et al 2014, page 202-204; Villa et al 2016, page 464, introduction); (iii) another motivation would be to evade the neutralizing antibody response against the recombinant myxoma virus due to the virus specific immune response from prior treatment and a novel strategy for delivery of the myxoma virus through carrier cells to tumor targets directly (See, Calton et al 2018, page 8, para 3 on Carrier Cells). Therefore, the instant claims 1-2, 9, 14, 20, and 24-25 would be an obvious variant of the co-pending reference claims 2, 5, 8-9, 16, 30 and 35 (Application No. US17767856) in view of the teachings of the prior arts applied as recited supra incorporating here in entirety applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct co-pending claims have not yet been patented on the date of issue of this office action.
20. Claims 1, 10, 11, 20 and 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 50, 57, 59, and 69 of co-pending application no. 17259849 in view of combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims 1, 10, 11, 20 and 24-25 and the copending reference claims 50, 57, 59, and 69 are drawn to an oncolytic virus, an oncolytic recombinant myxoma virus comprising immunomodulatory genes for treating cancer in a subject by administering the recombinant oncolytic myxoma virus. The limitations of instant claims 1, 10, 11, 20 and 24-25 are taught by reference claims 50, 57, 59, and 69 by disclosing, a pharmaceutical composition, comprising, an oncolytic myxoma virus engineered to express immunomodulatory gene, a TNF gene inserted between M135R gene and M136R gene within the myxoma virus genome; and by disclosing a method of inhibiting or treating a cancer in a subject in need by administering a pharmaceutical composition comprising the engineered myxoma virus.
Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to do an obvious modification to the co-pending claimed invention of reference claims 50, 57, 59, and 69 (application no. US17259849) given the teachings of Bell on an oncolytic virus/oncolytic VSV-p14FAST and oncolytic myxoma virus that can comprise a heterologous immunomodulatory gene p14 FAST encoding nucleic acid (See, para [0003], [0042], claim 15, [0128], [0013], [0014]), [0050]; [0058]), [0119], claims 1, 21-24) and teachings of Liu disclosing an oncolytic myxoma virus comprising and expressing IL-15 a heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136 (See, abstract, page 5933, col 2 para 2, page 5934 fig 1); and the recombinant myxoma virus heterologous immunomodulatory gene is under control of a synthetic early/late promoter (See, page 5934 figure 1 and associated legends) as recited, supra, and teachings on use of the virus in treating a hematopoietic malignancies/cancer such as leukemias (See, Bell claims 1, 21-24, para [0072]) and McFadden (US9730960B2) as recited supra disclosing treatable hematopoietic malignancies/cancers including breast cancer and multiple myeloma by using PBMCs and bone marrow cells adsorbed with myxoma virus and teachings of Villa, and Bartee et al on ex vivo treatment for adsorption of an oncolytic myxoma virus on surface of Bone marrow (BM) cells, mobilized peripheral blood stem cells (mPBSCs) and PBMCs to arrive at the claimed inventions. Bartee et al 2012 teaches ex vivo treatment using the oncolytic myxoma virus specifically eliminates multiple myeloma cells while sparing normal hematopoietic stem cells, the elimination of human MM cells requires direct oncolytic myxoma virus binding by adsorption, and conditions for ex vivo adsorption (See, Bartee et al 2012, abstract, page 1541, col 2 methods, Fig 1-6, Results page 1542-550, page 1544, col 1 last para, col 2, and entire article).
The motivation to modify the invention of co-pending application no. reference claims 50, 57, 59, and 69 with the teachings of Bell, Liu, McFadden, Villa, Bartee et al and Calton to arrive at the claimed inventions of instant claims 1, 10, 11, 20 and 24-25 would be that (i) the p14 FAST gene expressed by oncolytic myxoma virus functions as promiscuous cellular fusogens, the p14 FAST fusion protein- spontaneously initiates cell membrane fusion that could help destroy the cancer cells (See, Bell (US20110206640A1) para [0058], [0119]); and (ii) purging or cleansing of contaminating cancerous cells in autologous bone marrow cells or PBMCs or PBSCs used in treatment of hematopoietic cancers; and the teachings that myxoma virus cannot infect normal human cells productively; however, the oncolytic myxoma virus infect a variety of cancer types (See, Calton et al 2018, page 7, para 3; Chan et al 2014, page 202-204; Villa et al 2016, page 464, introduction); (iii) another motivation would be to evade the neutralizing antibody response against the recombinant myxoma virus due to the virus specific immune response from prior treatment and a novel strategy for delivery of the myxoma virus through carrier cells to tumor targets directly (See, Calton et al 2018, page 8, para 3 on Carrier Cells). Therefore, the instant claims 1, 10, 11, 20 and 24-25 would be an obvious variant of the co-pending reference claims 50, 57, 59, and 69 (Application No. US17259849) in view of the teachings of the prior arts applied as recited supra incorporating here in entirety applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct co-pending claims have not yet been patented on the date of issue of this office action.
21. Claims 1-2, 8-9, 11-14, 20 and 24-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 8, 10, 16, 19-20 and 23 of U.S. Patent No. US11117934B2 in view of teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims 1-2, 8-9, 11-14, 20 and 24-25 and the patented reference claims 1, 8, 9-10, 16, 19-20 and 23 are drawn to an oncolytic recombinant myxoma virus (MYXV) comprising immunomodulatory genes, comprising decorin for treating cancer in a subject by administering the recombinant oncolytic myxoma virus; a composition comprising a plurality of cells treated ex vivo by a MYXV, wherein the MYXV is genetically engineered to attenuate an activity ……, and to express a non-viral molecule, wherein the non-viral molecule is a cytokine; the plurality of cells comprises peripheral blood mononuclear cells (PBMCs), bone marrow (BM) cells, or a combination thereof; a method of inhibiting or alleviating a cancer in a subject in need thereof, comprising administering to the subject a MYXV or a plurality of cells treated with the genetically engineered MYXV expressing/encoding decorin.
The differences between the instant claims and reference patented claims are:
The instant claims 1-2, 8-9, 11-14, 20 and 24-25 comprise an added limitation that the engineered / recombinant oncolytic myxoma virus comprise p14 FAST encoding nucleic acid sequence.
The patented claims 1, 8, 9-10, 16, 19-20 and 23 comprise a limitation that MYXV is genetically engineered to attenuate an activity or expression level of its M153 protein.
It would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to do an obvious modification to the patented reference claims 1, 8, 9-10, 16, 19-20 and 23 (US11117934B2) given the teachings of Bell 2011, Duncan et al 2003, Duncan et al 2004, Song et al 2018, Villa et al, Bartee et al, Claton et al as recited supra (in this office action) on the oncolytic virus/oncolytic myxoma virus comprising a heterologous immunomodulatory gene p14 FAST encoding nucleic acid as recited, supra, and teachings on use of the virus in treating a cancer/hematopoietic malignancies/cancer such as leukemias (See, claims 1, 21-24, para [0072]). The motivation to modify the invention of the patented reference claims 1, 8, 9-10, 16, 19-20 and 23 (US11117934B2) with the teachings of Bell 2011, Duncan et al 2003, Duncan et al 2004, Song et al 2018, Villa et al, Bartee et al, Claton et al to arrive at the claimed inventions of instant claims 1-2, 8-9, 11-14, 20 and 24-25 would be that the p14 FAST gene expressed by oncolytic myxoma virus functions as promiscuous cellular fusogens, the p14 FAST fusion protein- spontaneously initiates cell membrane fusion that could help destroy the cancer cells (See, Bell (US20110206640A1) para [0058], [0119]). Therefore, the instant claims 1-2, 8-9, 11-14, 20 and 24-25 would be an obvious variant of the patented reference claims 1, 8, 9-10, 16, 19-20 and 23 (US11117934B2) in view of the teachings of the prior art applied as recited supra incorporating here in entirety applied obviousness analysis, motivation and reasonable success in this office action.
22. Claims 1-2, and 9 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 5-6, and 12 of copending Application No. 17/767857 (reference application filed on 03/21/2024) in view of the PG Pub US20220088096A1 (published 03/24/2022) of the instant application 17/486823, and teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending reference claims that teaches instant application claims as recited below are similar.
Both the instant claims and co-pending reference claims are directed to a recombinant/engineered myxoma virus comprising a transgene, a heterologous immunomodulatory gene encoding immunomodulatory proteins. A transgene, encoding a heterologous immunomodulatory gene comprises fusion associated small transmembrane (FAST), PD-L1 binding molecule, anti-PD-L1 antibody. The transgene is located between the M135R and M136R genes of the genome of the myxoma virus.
There are no substantial differences in the co-pending reference claims and instant application claims.
The instant claim 1 teaches co-pending claims 1-2.
The instant claim 2 teaches co-pending claims 5-6.
The instant claim 9 teaches co-pending claims 5-6.
The invention defined in the copending claims 1-2, 5-6, and 12 would have been an obvious variation of the invention defined in the in the instant claims 1-2 and 9 in view of the teachings of Bell (US20110206640A1, published 25 August 2011), Duncan et al 2003 (US NCBI Database sequence submission), Duncan et al 2004 (Virology, 2004, 319 (1), 131-140), and Song et al 2018 as recited supra incorporating here in entirety applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
22. Claims 1-2 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 120, 122 and 132 of copending Application No. 17274051 (reference application) in view of combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending reference claims that teaches instant application claims as recited below are similar.
Both the instant claims and co-pending reference claims are directed to a recombinant or engineered myxoma virus comprising a transgene, a heterologous immunomodulatory gene encoding immunomodulatory proteins. A transgene, encoding a heterologous immunomodulatory gene comprises PD-L1 binding molecule, anti-PD-L1 antibody. The transgene is located between the M135R and M136R genes of the genome of the myxoma virus.
The instant claims 1 is taught by co-pending claims 120 and 132 in view of claim 1-2 of Bell 2011 (US20110206640A1), Duncan et al 2003 and Duncan et al 2004 teaching Fusion-associated small transmembrane (FAST) as recited supra.
The instant claims 2 is taught by co-pending claims 120, 122 in view of Song et al 2018 (WO2018049248A1) teaches PD-L1 inhibitor / PD-L1 binding molecule as recited supra.
It would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to do an obvious modification to the copending reference claims 102, 122 and 132 in view of Bell and Boeuf 2011, Duncan et al 2003, Duncan et al 2004, Song et al 2018, and Liu et al 2009 as recited supra incorporating here in entirety applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
23. Claims 2 and 20 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 30 and 35 of copending Application No. 17/767856 (reference application) in view of combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending reference claims that teaches instant application claims as recited below are similar.
Both the instant claims and co-pending reference claims are directed to a recombinant or engineered myxoma virus comprising a transgene encoding BiKE and a method of treating a hematological cancer in a subject.
The instant claim 2 is taught by co-pending claim 1-2.
The instant claim 20 is taught by co-pending claims 30 and 35.
The invention defined in the instant claims 2 and 20 would have been an obvious modification and variation of the invention defined in the copending claims 1-2, 30, and 35 in view of Bell 2011, Duncan et al 2003, Duncan et al 2004, Song et al 2018, McFadden et al 2017 and Chan 2014 as recited supra incorporating here in entirety applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
24. Claims 1-2, 20, and 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 17-18, 23 and 43 of copending Application No. 18/852540 (reference application) in view of combined teachings of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell) and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and Wolfe et al 2018 (published in Journal of Virology, vol 92 (7): e02186-17, pages 1-15), Duncan et al 2003 (US NCBI Database sequence submission) and Duncan et al 2004 (published in Virology 319 (2004) 131-140), Tosic et al 2014 (published in PLoS ONE 2014: 9(10): e109801, pages 1-12) and Boeuf et al 2017 (published in Molecular Therapy: Oncolytics, vol. 6, September 2017, pages 80-89), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending reference claims that teaches instant application claims as recited below are similar.
Both the instant claims and co-pending reference claims are directed to a recombinant or engineered myxoma virus comprising a transgene encoding PD1-L1 inhibitor (antibody), LIGHT, Decroin, BiKE, FAST and a method of treating a hematological cancer in a subject.
The instant claims 1-2 are taught by co-pending claims 17-18.
The instant claims 20 and 24-25 are taught by co-pending claim 23 and 43.
The invention defined in the instant claims 1-2, 20, and 24-25 would have been an obvious modification and variation of the invention defined in the in the copending claims 17-18, 23 and 43 in view of the combined teachings of in view of Bell 2011, Duncan et al 2003, Duncan et al 2004, Song et al 2018, Villa et al 2016, Bartee et al 2012 and Calton et al 2018 as recited supra incorporating here in entirety applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Arguments
25. Applicant's arguments filed on 10/10/2025 have been fully considered but they are not persuasive.
On 10/10/2025, the applicant amended claims 1, 8 and 11 by incorporating cancelled claim 3 limitation that changed the scope of the claimed inventions of the independent claims 1, 8 and 11 and the claims dependent thereof. Because of the applicant’s claim amendments this action is reorganized to some extent, however, no new prior arts were applied for the rejection as recited supra.
35 U.S.C. § 102 Rejections
Applicant’s argument 1: Rejection of claims 1, 7, 8, 10-12, and 16-19 under 35 U.S.C. § 102 is improper. While not agreeing with the Examiner, but rather to advance prosecution, Applicant has amended claims 1, 8, and 11 to incorporate the subject matter of claim 3. Applicant submits Bell as evidenced by Duncan 1 and Duncan 2 does not teach the insertion of a transgene between ORF 135 and 136. Therefore, Bell as evidenced by Duncan 1 and Duncan 2 does not anticipate claims 1, 7, 8, 10-12, and 16-19. In view of the foregoing, Applicants respectfully request reconsideration and withdrawal of the rejection to the claims under 35 U.S.C. § 102(a)(l) and 102(a)(2).
In Response 1: Withdrawn Rejection of claims 1, 7, 8, 10-12, and 16-19 under 35 U.S.C. § 102 in view of applicant’s amendments of the claims 1, 8 and 11 incorporating an added limitation, wherein the heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136 as recited supra. Therefore, applicant’s arguments are moot.
35 U.S.C. § 103 Rejections
Applicant’s argument 2: Rejection of claims 1, 8, 10-12, and 17-19 under 35 U.S.C. § 103: Bell, Tosic, Boeuf, Duncan 1, and Duncan 2.
Applicants submit that Bell, Tosic, and Boeuf, individually and in combination, do not teach or suggest each and every element of claims 1, 8, and 11. Bell does not teach or suggest a recombinant myxoma virus, comprising a heterologous immunomodulatory gene, wherein the heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136, wherein the heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST.
Applicants submit that Bell does not teach or suggest the insertion of a transgene in an intergenic region between ORF 135 and 136, a region specific to myxoma viruses.
Applicants submit Bell, Tosic, Boeuf, Duncan 1, and Duncan 2 do not provide a skilled artisan with any predictability or expectation of success at arriving at the claimed myxoma virus. As Bell only demonstrates results using vaccinia viruses expressing p14 FAST, a skilled artisan could not reasonably predict that a myxoma virus or a myxoma virus expressing p14 FAST would have any similar effects. Applicants submit that a skilled artisan would thus not have any expectation of success that substituting myxoma virus for vaccinia viruses would have similar anti-cancer effects. Applicants submit Villa NY, et al. (Virology, 2010, 401:266-279; hereinafter "Exhibit A") teaches that myxoma viruses and vaccinia viruses exploit different mechanisms to infect human cancer cells and are not equally permissive in every cancer cell. Exhibit A demonstrates that while vaccinia viruses are able to infect pancreatic cancer cells, myxoma viruses are unable to (Figure 1). Exhibit A further teaches that vaccinia viruses and myxoma viruses exploit, and are dependent on, different pathways to infect cancer cells. For example, low pH inhibits myxoma virion entry (page 269, column 1, lines 15-18) whereas it is known in the art that brief, low pH treatment accelerates vaccinia virion entry (page 267, column 2, lines 30-37). Additionally, while genistein, a tyrosine kinase inhibitor, is able to prevent vaccinia virus infection, it has relatively no effect on myxoma virus infection. In sum, Exhibit A demonstrates that vaccinia viruses and myxoma viruses are not interchangeable - and thus a skilled artisan would readily recognize that the demonstration in Bell of the effects of a vaccinia virus are not applicable to myxoma viruses, as recited in the present claims.
Tosic, Boeuf, Duncan 1, and Duncan 2 do not remedy this deficiency. Tosic does not describe p14 FAST nor does Tosic suggest the insertion of any protein beyond a cytokine to a myxoma virus. Additionally, Applicants submit Boeuf merely describes a recombinant VSV expressing p14 FAST. Boeuf does not make any mention of a myxoma virus nor poxviruses/Leporipoxviruses, the family/genus to which myxoma viruses belong. Duncan 1 and Duncan 2 do not teach oncolytic viruses. Therefore, these additional references do not provide the predictability or expectation of success missing from Bell, and a skilled artisan would have no motivation to combine the teachings of Bell, Tosic, Boeuf, Duncan 1, and Duncan 2 without hindsight bias.
Secondary Considerations:
Importantly, "secondary considerations" may include evidence of commercial success, long-felt but unsolved needs, failure of others, and unexpected results. Rebuttal evidence may also include evidence that the claimed invention yields unexpectedly improved properties or properties not present in the cited reference. See MPEP § 2145.
In Crocs, Inc. v. U.S. Int'l Trade Commission, 598 F.3d 1294 (Fed. Cir. 2010), the Federal Circuit reaffirmed the requirements for a finding of non-obviousness in view of "unexpected results." Rejecting the proposition that a combination of cited reference elements is per se obvious, the Federal Circuit held that a claimed combination of cited reference elements is non-obvious when the combination yields "more than predictable results." In Crocs, testimony on record indicated that the combined elements in the shoe reduced wearer discomfort in ways that were not suggested or contemplated by the cited reference. The Federal Circuit pointed out that this combination "yielded more than predictable results" and was thus patentable. Id. at 1310. This ruling affirmed prior holdings that inventions that have new and unexpected properties are patentable (In re Papesch, 3159 F.2d. 381, 387 (C.C.P.A. 1963)). The determination that the result is "unexpected" depends upon what a person of ordinary skill in the art would have predicted based upon the cited reference (Procter & Gamble Co. v. Teva Pharms. USA, Inc., 566 F.3d 989, 997-98 (Fed. Cir. 2009); Pfizer, Inc. v. Apotex, Inc., 480 F.3d 1348, 1367 (Fed. Cir. 2007)).
Consistently, under MPEP § 2143 A(3), merely pointing to the presence of all claim elements in the cited reference is not a complete statement of a rejection for obviousness. In accordance with MPEP § 2143 A(3), a rejection based on the rationale that the claimed invention is a combination of cited reference elements is improper if it does not include a finding that results flowing from the combination would have been predictable to a person of ordinary skill in the art. MPEP § 2143 A(3). If results from the invention would not have been predictable, an obviousness rejection using the combination of cited reference elements rationale is improper.
Applicants submit that the present claims are non-obvious in view of unexpected results. Applicants submit that drug resistance is a prevailing problem in cancer therapies. As explained in the introduction on paragraph [0052] of the as-filed specification, there is a need in the art for novel therapies which can target therapy-resistant cells and target refractory and drug-resistant minimal residual disease (MRD). The recombinant myxoma viruses of the present invention are capable of treating advanced hematological cancers such as drug- resistant multiple myeloma (MM) cells and induce significantly higher cancer cell death compared to other treatment regimens comprising other recombinant myxoma viruses and cancer drugs. Example 1 evaluates the ability of ex vivo myxoma virus (MYXV)-treated multiple myeloma leukocytes to kill primary multiple myeloma cells derived from patients who have failed standard therapy regimen and have no further clinical options. Table 3 demonstrates that myxoma viruses expressing p14 FAST is able to induce cell death in multiple myeloma cells from a drug-refractory patient. Figures 9, 10, 12B, and 14 demonstrate that treatment with recombinant myxoma viruses expressing p14 FAST result in significantly increased killing of a triple negative breast cancer, acute myeloid leukemia, and multiple myeloma cell line compared to other recombinant myxoma viruses. Lastly, Figure 12C demonstrates that recombinant myxoma viruses expressing p14 FAST also result in significantly increased killing of a triple negative breast cancer compared to other recombinant myxoma viruses and drugs such as Gemcitabine, Paclitaxel, and Doxorubicin. A skilled artisan would not be able to predict the surprising and unexpected results of myxoma viruses expressing p14 FAST provided in the present application from the teachings of Bell, Tosic, Boeuf, Duncan 1, and Duncan 2.
Applicants submit Bell, Tosic, Boeuf, Duncan 1, and Duncan 2 do not provide a skilled artisan with any predictability or expectation of success at arriving at the claimed myxoma virus. In view of the foregoing, Applicants respectfully request reconsideration and withdrawal of the rejection to the claims under 35 U.S.C. § 103.
In Response 2: The combined prior art teachings as applied and recited supra renders obvious the claims 1, 5, 7-8, 10, 11-12 and 17-19 as recited supra. The rejection is amended in view of the applicant’s amendments to claims 1, 8 and 11.
Although Bell (US20110206640A1) only demonstrates results using vaccinia viruses expressing p14 FAST, as recited in the office action, Bell teaches oncolytic viruses that have been selected or engineered to productively infect tumor cells include myxoma virus (See para [0003]), in alternative embodiments, one or more strains of an oncolytic virus may be used in methods of the invention, simultaneously or successively. A virus may for example be selected from the group consisting of includes myxoma virus (See para [0042]). It is obvious and is within the ordinary skills to comprise an oncolytic myxoma virus with p14 FAST gene/protein and further make use of the virus for oncolytic therapy in a subject to treat tumors or cancers.
Secondary Considerations: In response to the secondary considerations involving unexpected results as argued by the applicant, The combined prior art teachings as applied to the claims 1, 5, 7-8, 10, 11-12 and 17-19 (includes amended claims 1, 8 and 11) as recited supra teaches that a myxoma virus is oncolytic virus and the claimed oncolytic myxoma virus of the instant claims 1, 5, 7-8, 10 and the methods of the claims 11-12 and 17-19 involving use of oncolytic myxoma virus of claims 1, 5, 7-8, 10 is rendered obvious by the combined teachings of prior art as recited supra.
The claims 1, 5, 7-8, 10, 11-12 and 17-19 are not directed to the methods of treatment of the hematological cancer that is drug-resistant multiple myeloma. The claims 1, 5, 7-8, 10, 11-12 and 17-19 do not recite a claim limitation on treatment of drug-resistant multiple myeloma. Accordingly, applicant’s arguments are not commensurate to the claim scope.
The claims 33 is directed to the methods of claim 12, wherein the treatment of the hematological cancer is drug-resistant multiple myeloma.
The claims 34 is directed to the methods of claim 20, wherein the treatment of the hematological cancer is drug-resistant multiple myeloma.
As recited in the office action supra, the prior arts applied to claims 33-34 render obvious the effeteness or treatment of the hematological cancer which is drug-resistant multiple myeloma is rendered obvious in claim 33 by Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198); and in claim 34 by Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Bartee et al 2012 (Biol Blood Marrow Transplant 18:1540-1551, 2012), Calton et al 2018, Cancers 2018, 10, 198) and Bartee et al 2016 (Molecular Therapy-Oncolytics (2016) 3, 16032).
The claimed recombinant oncolytic myxoma virus comprising p14 FAST protein gene expression does not have a special feature to specifically target binding or killing of drug-resistant multiple myeloma cancer cells.
The prior arts by Dunlap et al 2015; and Calton et al 2018 are applied to claims 33-34 by modification by incorporating p14 FAST of Duncan et al 2003; and Duncan et al 2004 to develop an oncolytic myxoma virus expressing p14 FAST protein.
The different prior arts by Dunlap et al 2015, Calton et al 2018, and Bartee et al 2012 teaches a myxoma virus is oncolytic for drug-resistant human multiple myeloma even without comprising p14 FAST gene for expression of p14 FAST protein.
Therefore, the instant claimed oncolytic myxoma virus or the treatment methods based on the claimed oncolytic myxoma virus does not have a special feature to provide unexpected results.
The combined prior art applied to render obvious the claims teach all elements or limitations of the claimed invention and therefore reasonably expected to yield the claimed oncolytic myxoma virus effectiveness for treatment of the claimed cancer or tumors, and thus renders the claims obvious under 35 U.S.C 103.
The rejection as recited supra meets the test for a reference or a combination of references to establish obviousness is satisfied, as recited in the obviousness for combining the prior art teachings, motivation and reasonable expectation of success to arrive at the claimed inventions as recited supra, according to the requirement of the U.S. Supreme Court ruling in Graham v. John Deere, 383 U.S. 1 (1960). The claim as rendered obvious by the applied prior arts and obviousness analysis including motivation, reasonable expectation of success has overcome the applicant’s argument regarding, inter alia, secondary consideration and unexpected results.
Applicant’s arguments were considered but are not persuasive and the rejection of the claims is maintained in this final rejection office action as recited supra.
Applicant’s argument 3: Rejection of Claims 2, 9, and 14 under 35 U.S.C. §103; Bell, Tosic, Boeuf, Duncan 1, Duncan 2, and Song.
In Response 3: The combined prior art teachings as applied and recited supra renders obvious the claims 2, 9, and 14 under 35 USC 103. The combined prior art applied to render obvious the claims teaches all elements or limitations of the claimed invention and therefore reasonably expected to yield the claimed oncolytic myxoma virus effectiveness for treatment of the claimed cancer or tumors, and thus renders the claims obvious under 35 U.S.C 103.
The rejection as recited supra meets the test for a reference or a combination of references to establish obviousness is satisfied, as recited in the obviousness for combining the prior art teachings, motivation and reasonable expectation of success to arrive at the claimed inventions as recited supra, according to the requirement of the U.S. Supreme Court ruling in Graham v. John Deere, 383 U.S. 1 (1960). The claim as rendered obvious by the applied prior arts and obviousness analysis including motivation, reasonable expectation of success has overcome the applicant’s argument regarding, inter alia, secondary consideration and unexpected results. Applicant’s arguments were considered but are not persuasive the rejection of the claims is maintained in this final rejection office action as recited supra.
Applicant’s arguments 4: Rejection of claims 3 and 5 under 35 U.S.C. § 103; Bell, Tosic, Boeuf, Liu, and Wolfe
In Response 4: Applicant cancelled claim 3 and therefore the argument is moot. The claim 5 is rejected under 35 USC 103 as recited in the office action. Applicant’s arguments were considered but are not persuasive and the rejection of the claim 5 is maintained in this final rejection office action as recited supra.
Applicant’s arguments 5: Rejection of claim 7 under 35 U.S.C. § 103; Bell, Tosic, Boeuf, Duncan 1, and Duncan 2
In Response 5: The claim 7 is rejected under 35 USC 103 as recited in the office action. Applicant’s arguments were considered but are not persuasive and the rejection of the claim 7 is maintained in this final rejection office action as recited supra.
Applicant’s arguments 6: Rejection of claims 13 under 35 U.S.C. § 103: Bell, Tosic, Boeuf, Duncan 1, Duncan 2, and Song
In Response 6: The claim 13 is rejected under 35 USC 103 as recited in the office action. Applicant’s arguments were considered but are not persuasive and the rejection of the claim 13 is maintained in this final rejection office action as recited supra.
Applicant’s arguments 7: Rejection of claim 16 under 35 U.S.C. § 103; Bell, Tosic, Boeuf, Duncan 1, and Duncan 2
In Response 7: The claim 16 is rejected under 35 USC 103 as recited in the office action. Applicant’s arguments were considered but are not persuasive and the rejection of the claim 16 is maintained in this final rejection office action as recited supra.
Applicant’s arguments 8: Rejection of claim 20 under 35 U.S.C. § 103: Bell, Tosic, Boeuf, McFadden, and Chan 1
In Response 8: The claim 20 is rejected under 35 USC 103 as recited in the office action. Applicant’s arguments were considered but are not persuasive and the rejection of the claim 20 is maintained in this final rejection office action as recited supra.
Applicant’s arguments 9: Rejection of claims 24 and 25 under 35 U.S.C. § 103; Bell, Tosic, Boeuf, McFadden, Villa, Chan 2, Bartee 1, and Chan 1
In Response 9: The claim 24 and 25 is rejected under 35 USC 103 as recited in the office action. Applicant’s arguments were considered but are not persuasive and the rejection of the claims 24 and 25 is maintained in this final rejection office action as recited supra.
Applicant’s arguments 10: Rejection of claim 33 under 35 U.S.C. § 103: Bell, Tosic, Boeuf, Dunlap, and Calton.
Applicant’s arguments 11: Rejection of claim 34 under 35 U.S.C. § 103; Bell, Tosic, Boeuf, McFadden, Villa, Calton, Chan 1, Dunlap, Bartee 1, Calton, and Bartee 2
In Response 10 and 11: The claims 33 is directed to the methods of claim 12, wherein the treatment of the hematological cancer is drug-resistant multiple myeloma.
The claims 34 is directed to the methods of claim 20, wherein the treatment of the hematological cancer is drug-resistant multiple myeloma.
As recited in the office action supra, the prior arts applied to claims 33-34 render obvious the effeteness or treatment of the hematological cancer which is drug-resistant multiple myeloma is rendered obvious in claim 33 by Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198); and in claim 34 by Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Bartee et al 2012 (Biol Blood Marrow Transplant 18:1540-1551, 2012), Calton et al 2018, Cancers 2018, 10, 198) and Bartee et al 2016 (Molecular Therapy-Oncolytics (2016) 3, 16032).
The claimed recombinant oncolytic myxoma virus comprising p14 FAST protein gene expression does not have a special feature to specifically target binding or killing of drug-resistant multiple myeloma cancer cells.
The prior arts by Dunlap et al 2015; and Calton et al 2018 are applied to claims 33-34 by modification by incorporating p14 FAST of Duncan et al 2003; and Duncan et al 2004 to develop an oncolytic myxoma virus expressing p14 FAST protein.
The different prior arts by Dunlap et al 2015, Calton et al 2018, and Bartee et al 2012 teaches a myxoma virus is oncolytic for drug-resistant human multiple myeloma even without comprising p14 FAST gene for expression of p14 FAST protein.
Therefore, the instant claimed oncolytic myxoma virus or the treatment methods based on the claimed oncolytic myxoma virus does not have a special feature to provide unexpected results.
Applicant’s arguments were considered but are not persuasive and the rejection of the claims 33 and 34 are maintained in this final rejection office action as recited supra.
Double Patenting Rejections
Applicant’s Arguments details can be referred in as filed on 10/10/2025:
(i) Double Patenting Rejection of Claims 1-3, 5, 9, 11, 12, 20, 24, and 25: The Examiner has provisionally rejected claims 1-3, 5, 9, 11, 12, 20, 24, and 25 on the ground of nonstatutory double patenting over claims 120, 122, 124, 132, 138, and 139 of co-pending Application No.: 17/274,051 in view of Bell, McFadden, Villa, Bartee 1, and Calton.
(ii) Double Patenting Rejection of Claims 1, 2, 9, 14, 20, 24 and 25: The Examiner has provisionally rejected claims 1, 2, 9, 14, 20, 24 and 25 on the ground of nonstatutory double patenting over claims 2, 5, 8, 9, 16, 30, and 35 of co-pending Application No.: 17/767,856 in view of Bell, McFadden, Villa, Bartee 1, and Calton.
(iii) Double Patenting Rejection of Claims 1, 3, 10, 11, 20, 24, and 25: The Examiner has provisionally rejected claims 1, 3, 10, 11, 20, 24, and 25 on the ground of nonstatutory double patenting over claims 50, 57, 59, and 69 of co-pending Application No.: 17/259,849 in view of Bell, Liu, McFadden, Villa, Bartee 1, and Calton.
(iv) Double Patenting Rejection of Claims 1, 2, 8, 9, 11-14, 20, 24, and 25: The Examiner has provisionally rejected claims 1, 2, 8, 9, 11-14, 20, 24, and 25 on the ground of nonstatutory double patenting over claims 1, 8, 10, 16, 19, 20, and 23 of U.S. Patent No.: 11,117,934 in view of Bell, Duncan 1, Duncan 2, Song, Villa, Bartee 1, and Calton.
(v) Double Patenting Rejection of Claims 1-3 and 9: The Examiner has provisionally rejected claims 1-3 and 9 on the ground of nonstatutory double patenting over claims 1, 2, 5, 6, and 12 of co-pending Application No.: 17/767,857 in view of Bell, Duncan 1, Duncan 2, and Song.
(v) Double Patenting Rejection of Claims 1-3: The Examiner has provisionally rejected claims 1-3 on the ground of nonstatutory double patenting over claims 120, 122, and 132 of co-pending Application No.: 17/274,051 in view of Bell, Duncan 1, Duncan 2, Song, and Liu.
(vi) Double Patenting Rejection of Claims 2 and 20: The Examiner has provisionally rejected claims 2 and 20 on the ground of nonstatutory double patenting over claims 1, 2, 30, and 35 of co-pending Application No.: 17/767,856 in view of Bell, Duncan 1, Duncan 2, Song, McFadden, and Chan 1.
Applicant argues that MPEP § 804(II)(B)(2) states that a non-statutory double patenting rejection is "analogous to [a failure to meet] the nonobviousness requirement of 35 U.S.C. § 103" In re Braithwaite, 379 F.2d 594, 154 USPQ 29 (CCPA 1967). Thus, Applicants submit that the inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966) are equally applicable to allegations of non-statutory obviousness-type double patenting rejections.
With regards to all the separate double patenting rejections as listed by the applicant in arguments filed on 10/10/2025 as stated above the applicant argues that the rejections are improper. Applicants submit that the present claims are not obvious over the distinct co-pending applications and the applied prior arts to render obvious the double patenting rejections.
In Response: The claims 1-2, 5, 7-14, 16-20, 24-25, and 33-34 as amended on 10/10/2025 are rejected under 35 USC 103 as recited in the office action and thus meet the requirements recited in MPEP § 804(II)(B)(2).
Applicant’s arguments were considered but are not persuasive and the non-statutory double patenting / double patenting rejection of the claims as recited in the office action are maintained in this final rejection office action as recited supra.
26. Relevant Prior Arts:
Lauterbach et al. RU2830601C2 (11/22/2024 with an earlier priority to of 11/20/2018 to EP18207238.9). Therapy for treating cancer by intratumoral and/or intravenous administration of a recombinant modified vaccinia virus (MVA) coding 4-1bbl (cd137l) and/or cd40l. Para [0192] Preferably, the nucleic acids of the present invention can be inserted into one or more intergenic regions (IGRs) of the MVA virus. The term "intergenic region" refers preferably to regions of the viral genome located between two adjacent open reading frames (ORFs) of the MVA virus genome, preferably between two significant ORFs of the MVA virus genome. In the case of MVA, in certain embodiments, the ORF is selected from ORF 07/08, ORF 44/45, ORF 64/65, ORF 88/89, ORF 136/137, and ORF 148/149.
McFadden et al 2013. WO2012171007A2 (12/13/2012) and McFadden et al 2014 US20140328804A1 (11/06/2014). Methods for treating or preventing graft versus host disease. A method for treating cancer in a subject comprising: contacting a graft comprising a plurality of hematopoietic cells with an amount of a Myxoma Virus ex vivo effective to inhibit proliferation of T lymphocytes in the graft; administering at least one of chemo transplanting the virus-treated graft into the subject. The cancer is a hematologic malignancy.
Wong, C., Nash, L., Del Papa, J. et al. Expression of the fusogenic p14 FAST protein from a replication-defective adenovirus vector does not provide a therapeutic benefit in an immunocompetent mouse model of cancer. Cancer Gene Ther 23, 355–364 (2016).
Del Papa J, Petryk J, Bell JC, Parks RJ. An Oncolytic Adenovirus Vector Expressing p14 FAST Protein Induces Widespread Syncytium Formation and Reduces Tumor Growth Rate In Vivo. Mol Ther Oncolytics. 2019 May 15;14:107-120.
Conclusion
27. No claim is allowed.
28. THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
29. A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672
/BENNETT M CELSA/Primary Examiner, Art Unit 1600