DETAILED ACTION
Non-Final Rejection
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
2. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 05/20/2026 has been entered.
Status of Claims
3. Claims 11, 13-14, 16-20, and 24-25 as filed on 05/20/2026 are pending.
4. Claims 11, 13-14, 16-20, and 24-25 as filed on 05/20/2026 are under examination in this office action.
Priority
5. Applicant’s claim for the benefit of instant application 17/486823 from a prior-filed application CON of PCT/US2020/025494, filed March 27, 2020, which claims priority to and benefit from US Provisional Application No. 62/825,662, filed on March 28, 2019, under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Information Disclosure Statement
6. The information disclosure statements (IDSs) submitted on 10/25/2021 and 01/23/2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 103 (First Rejection)
7. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
8. Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and further in view of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198).
Claim 11: Liu et al 2009 is in the art and teaches recombinant Myxoma virus (MYXV), wherein the recombinant MYXV comprises a heterologous immunomodulatory gene, wherein the heterologous immunomodulatory gene is inserted in the intergenic region between ORF 135 and 136 under the control of p11 late promoter and wherein the heterologous immunomodulatory gene comprises a nucleic acid encoding IL-15. The recombinant MYXV is not lethal to rabbits and showed Rabbit RK-13 (ATCC CCL-37) and murine melanoma
B16F10 (CRL-6475) cells in vitro replication kinetics similar to that of wild-type MYXV. Wild type MYXV is a poxvirus pathogenic only for European rabbits, however, MYXV permissiveness in human cancer cells gives it potential as an oncolytic virus. (see, abstract, page 5933 col 2 para 2). MYXV belongs to the Leporipoxvirus genus of the Poxviridae family. MYXV has a restricted host range and is only pathogenic for European rabbits. Recent studies indicated that MYXV permissively infects a wide spectrum of cancer cells and is a promising oncolytic agent in various preclinical models of cancer (See, page 5937, col 1 para 1). MYXV productively replicates in many human cancer and murine cancer cells that feature abnormalities in their Akt activation levels. Therefore, a late-stage infection of a heterologous gene IL-15 secretion would be predicted to occur only among cell populations with similar Akt abnormalities in vivo. This would provide an additional safety control for a heterologous gene IL-15 expression outside of tumor tissues (see, page 5937 col 1 para 2). Thus, Liu et al 2009 teaches a recombinant MYXV with a functional and expressible IL-15 heterologous immunomodulatory gene inserted in intergenic region between ORF 135 and 136 and cancer.
However, Liu et al 2009 does not teach (i) MYXV with insertion of nucleic acid encoding p14 FAST; and (ii) drug-resistant multiple myeloma or breast cancer.
Bell 2011 is directed to Oncolytic viruses that have been selected or engineered to productively infect tumor cells including vesicular stomatitis virus (VSV) and myxoma virus (MYXV), a VSV expressing p14 FAST protein (see, para [0003], para [0119], claim 32, claims 22-23). Bell 2011 teaches a method of treating a cancer in a human patient comprising administering to the patient an effective amount of a VSV expressing a reovirus Fusion Associated Small Transmembrane (FAST) protein (p14 FAST) (see, claim 32, claims 22-23) for treating cancers, and related conditions such as treatment of benign, inoperable mass (e.g. solid tumors, including both primary and metastatic solid tumors, breast carcinoma or breast cancer) (see, para [0072]). Bell 2011 teaches that the p14 FAST protein is a small integral membrane protein originally isolated from a reptilian reovirus that spontaneously initiates cell membrane fusion (see, para [0119]). Bell 2011 renders obvious the nucleic acid sequence of p14 FAST gene as the claimed recombinant oncolytic virus (e.g. VSV-p14-FAST virus or MYXV as exemplified by express teachings and motivation to use MYXV comprising p14 FAST (MYXV-p14-FAST virus) as an oncolytic virus) expresses functional protein p14 FAST.
Bell 2011 does not teach treatment of drug-resistant multiple myeloma by administration of the oncolytic recombinant VSV-p14-FAST virus or MYXV-p14-FAST virus.
Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198).
Dunlap et al 2015 is in the art and teaches treatment of drug-resistant multiple myeloma by disclosing myxoma-based oncolytic therapy as an attractive option for myeloma patients whose disease is refractory to chemotherapeutic proteasome inhibitors (PI) (See, abstract). Dunlap et al 2015 taught that myxoma virus treatment caused equal losses of viability from both PI-sensitive and resistant Dox40 multiple myeloma (MM) cells (Figure 1), suggesting that myxoma virus treatment can overcome the resistance to proteasome inhibitor (PI) based chemotherapy developed by some MM cells (See, Dunlap et al 2015, p.3, results, col 2, p.4, Figure 1, entire research article).
Calton et al 2018 additionally teaches that although it cannot infect normal human cells, MYXV has been shown to productively infect a variety of cancer types. In MM cell lines, MYXV induces efficient cell killing that is dependent upon caspase-8 mediated apoptosis and by inhibiting ATF4 expression during the unfolded protein response. Thus, killing occurs in both bortezomib-sensitive and bortezomib-resistant MM cells, in MM cell lines, MYXV induces efficient cell killing that is dependent upon caspase-8 mediated apoptosis and by inhibiting ATF4 expression during the unfolded protein response (See, Calton et al 2018, page 7 para 4).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the prior art teachings of Liu et al 2009 by incorporating additional teachings of Bell 2011, Dunlap et al 2015 and Calton et al 2018 to arrive at the invention of claim 11 as recited supra for treatment of drug-resistant multiple myeloma or a breast cancer. One of the ordinary skills in the art would have been motivated to develop oncolytic recombinant MYXV expressing p14 FAST protein and expression suggestion and teaching of Dunlap et al 2015 on effectiveness of oncolytic myxoma virus for treatment of drug-resistant multiple myeloma. The oncolytic myxoma virus comprising the heterologous immunomodulatory gene p14 FAST due to the fusogenic property of p14 FAST protein would be expected to be efficacious and effective against drug-resistant multiple myeloma with a motivation of commercial success. One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claim 11. Thus, the invention of claim 11 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestions, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 11. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
9. Claims 13-14 and 17-19 are rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938), Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198) as applied to claim 11 above and further in view of Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017) and Champion et al 2018 (CA3063652A1, 12/06/2018).
Claims 13-14: The combined teachings of Liu et al 2009, Bell 2011, Dunlap et al 2015, and Calton et al 2018 taught claim 11 as recited supra. However, do not teach added imitation of claim 13, wherein the cancer is a HER2 negative cancer; and wherein the heterologous immunomodulatory gene further comprises anti-PD-L1, BiKE, LIGHT and/or Decorin.
Song 2018 is in the oncolytic virus art and teaches oncolytic viruses including myxoma virus (see, claim 15, para [0015], [0104], [0124], [0131], [0440]) and the added limitation of instant claim 13, wherein the cancer is a HER2 negative cancer by disclosing in some embodiments, the method described herein is suitable for treating the breast cancer that is HER2 positive or HER2 negative (See, para [0267]). In some embodiments, breast cancer is a triple negative breast cancer. (See, para [0010], [0145], [0150], [0267], para [0426] Embodiment 7, and claim 7).
Song 2018 further teaches an oncolytic myxoma virus (See, para [0015], [0104], [0125], [0440], and claim 15; para [0066], [0078], [0131], [0132] ), and the oncolytic myxoma virus further comprise a heterologous immunomodulatory gene PD-L1 inhibitor (See, para [0015] and [0016]; [0109], [0110]-[0113], [0180], [0182], [0184], [0185]-[0186], [0213], [0237], claims 15, 18-24).
Song (WO2018049248A1) also discloses the invention, an oncolytic virus comprising a nucleic acid encoding a bispecific engager molecule comprising a first antigen-binding domain specifically recognizing a tumor antigen and a second antigen-binding domain specifically recognizing a cell surface molecule on an effector immune cell (See, claims 1, 26, 40, para [0004], [0008]), in some embodiments the oncolytic virus encodes/comprises a second antigen binding domain specifically recognizing a cell surface molecule NPp46 on an effector cell- a natural killer (NK) cell, the first and/or second antigen-binding domain of a bispecific engager molecule is a single chain variable fragment (scFv) (See, para [0011]- [0013], claim 41, 43) and such NK cell targeting bi-specific engager molecule is known as Bi-specific Killer cell Engager (BiKE).
Song 2018 does not teach LIGHT and/or Decorin.
Liu et al 2017 (CN106755103A, 05/31/2017) is in the art and teaches oncolytic adenovirus recombinant vector that carry decorin gene expression frame for treatment of cancer (see, claims 1-2).
Champion et al 2018 (CA3063652A1, 12/06/2018) is in the art and teaches an oncolytic virus adenovirus including vaccinia virus (a poxvirus) expressing therapeutic proteins include an antibody or binding fragment specific to expressing anti-LIGHT, anti-PD-L1 (See, PDF printout page 3).
Claims 17-19 (dependent on claim 11): Bell 2011 further teaches added limitations of claims 17-19 by disclosing administration of oncolytic virus via intravenous injection (see, para [0027], [0076], [0081], [0091], [0107]-[0108]); the administering is via intratumoral injection ([0081]-[0082]); and the composition induces cancer cell death/apoptosis ([0047], [0060], [0124]).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Liu et al 2009, Bell 2011, Dunlap et al 2015 and Calton et al 2018 as applied to claim 11 by incorporating additional teachings of Song 2018 on treatment of HER-2 negative cancer, anti-PD-L1, BiKE, Liu et al 2017 on decorin and Champion et al 2018 on anti-LIGHT, anti-PD-L1 to arrive at the invention of claims 13-14 and 17-19 as recited supra for treatment of HER2 negative breast cancer. One of the ordinary skills in the art would have been motivated to develop oncolytic recombinant MYXV expressing p14 FAST protein and expression suggestion and teaching of Dunlap et al 2015 on effectiveness of oncolytic myxoma virus for treatment of drug-resistant cancer for administration by intratumoral injection for solid tumor of breast cancer) or intravenous injection for multiple myeloma. The oncolytic myxoma virus comprising the heterologous immunomodulatory gene p14 FAST due to the fusogenic property of p14 FAST protein would be expected to be efficacious and effective against drug-resistant multiple myeloma with a motivation of commercial success. One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claims 13-14 and 17-19. Thus, the invention of claims 13-14 and 17-19 was clearly prima facie obvious to one of ordinary skill in the art in view of added teachings of Song 2018 before the effective filing date of the claimed invention. It is similar to some teaching, suggestions, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claims 13-14 and 17-19. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
10. Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938), Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198) as applied to claim 11 above and further in view Duncan 2010 (US7851595B2, 12/14/2010).
Claim 16: The combined teachings of Liu et al 2009, Bell 2011, Dunlap et al 2015, and Calton et al 2018 taught claim 11 including p14 FAST protein expression in an oncolytic virus as recited supra. However, do not teach added imitation of claim 16, wherein the nucleic acid encoding p14 FAST comprises SEQ ID NO: 1.
Duncan 2010 disclosed a nucleic acid encoding p14 FAST SEQ ID NO: 1 (Db) that has 100% identity with instant SEQ ID NO: 1
Query Match 100.0%; Score 378; Length 1501;
Best Local Similarity 100.0%;
Matches 378; Conservative 0; Mismatches 0;Indels 0; Gaps 0;
Qy 1 ATGGGGAGTGGACCCTCTAATTTCGTCAATCACGCACCTGGAGAAGCAATTGTAACCGGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 25 ATGGGGAGTGGACCCTCTAATTTCGTCAATCACGCACCTGGAGAAGCAATTGTAACCGGT 84
Qy 61 TTGGAGAAAGGGGCAGATAAAGTAGCTGGAACGATATCACATACGATTTGGGAAGTGATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 85 TTGGAGAAAGGGGCAGATAAAGTAGCTGGAACGATATCACATACGATTTGGGAAGTGATC 144
Qy 121 GCCGGATTAGTAGCCTTGCTGACATTCTTAGCGTTTGGCTTCTGGTTGTTCAAGTATCTC 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 145 GCCGGATTAGTAGCCTTGCTGACATTCTTAGCGTTTGGCTTCTGGTTGTTCAAGTATCTC 204
Qy 181 CAAAAGAGAAGAGAAAGAAGGAGACAACTCACTGAGTTCCAAAAACGGTATCTACGGAAT 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 205 CAAAAGAGAAGAGAAAGAAGGAGACAACTCACTGAGTTCCAAAAACGGTATCTACGGAAT 264
Qy 241 AGCTACAGGTTGAGTGAGATCCAGAGACCTATATCACAGCACGAATACGAAGACCCATAC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 265 AGCTACAGGTTGAGTGAGATCCAGAGACCTATATCACAGCACGAATACGAAGACCCATAC 324
Qy 301 GAGCCACCAAGTCGTAGGAAACCACCCCCTCCTCCTTATAGCACATACGTCAACATCGAT 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 325 GAGCCACCAAGTCGTAGGAAACCACCCCCTCCTCCTTATAGCACATACGTCAACATCGAT 384
Qy 361 AATGTCTCAGCCATTTAG 378
||||||||||||||||||
Db 385 AATGTCTCAGCCATTTAG 402
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Liu et al 2009, Bell 2011, Dunlap et al 2015 and Calton et al 2018 as applied to claim 11 by incorporating additional teachings of Duncan 2010 on nucleotide sequence of p14FAST to arrive at the invention of claim 16. One of the ordinary skills in the art would have been motivated to develop oncolytic recombinant MYXV expressing p14 FAST protein using the known and working nucleotide sequence of p14FAST and express suggestion and teaching of Dunlap et al 2015 on effectiveness of oncolytic myxoma virus for treatment of drug-resistant cancer for administration by intratumoral injection or intravenous injection for multiple myeloma. The oncolytic myxoma virus comprising the heterologous immunomodulatory gene p14 FAST due to the fusogenic property of p14 FAST protein would be expected to be efficacious and effective against drug-resistant multiple myeloma with a motivation of commercial success. One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claim 16. Thus, the invention of claim 16 was clearly prima facie obvious to one of ordinary skill in the art in view of added teachings of Duncan 2010 before the effective filing date of the claimed invention. It is similar to some teaching, suggestions, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 16. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
11. Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over combined teachings of
Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938), Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198) as applied to claim 11 as recited supra and further in view of McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden) and Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan).
Claim 20: The combined teachings of Liu et al 2009, Bell 2011, Dunlap et al 2015, and Calton et al 2018 taught claim 11 as recited supra, and the prior art teachings that render obvious claims 11 comprising the method of treatment administering recombinant myxoma virus encoding p14 FAST protein is incorporated here in its entirety.
However, the combined prior art as applied to claim 11 above do not teach added limitation of claim 20 comprising the mononuclear peripheral blood cells and/or bone marrow cells comprise the recombinant myxoma virus-p14 FAST for administration in a subject.
McFadden et al 2017 (US9730960B2) is in the oncolytic myxoma virus treatment of cancer art and discloses treatable hematopoietic malignancies/cancers including breast cancer and multiple myeloma by using PBMCs and bone marrow cells adsorbed with myxoma virus under good tissue practice clinical conditions (See, abstract, col 12, lines 33-40, col 6, lines 55-67; see claims 5-7) in an approach of Graft-versus-host disease (GVHD) treatment of cancers; human bone marrow cells and peripheral blood mononuclear cells were infected by incubation with vMyx-GFP, a MYXV at a multiplicity of infection (MOI) of 10 for 3 hours in PBS+10% FBS in a humidified chamber at 37° C and 5% CO2 (See, Example 1, col 7-8). Mice injected with healthy bone marrow cells that had been pretreated ex vivo with the myxoma virus universally survived without evidence for wasting; post-mortem histology revealed that mice injected with MYXV-treated bone marrow (BM) displayed virtually no infiltration of human CD3+T lymphocytes into any major organ, e.g., spleen, lung, liver, kidney; the novel observation that ex vivo treatment of allogeneic human hematopoietic cell grafts with MYXV can prevent GVHD and permit efficient engraftment of normal human HSPC (See, Example 1, col 7-8, col 10 lines 25-36, entire US9730960B2).
Chan et al 2014 teaches ex vivo MYXV infection of human patient bone marrow cells or peripheral blood mononuclear cell samples selectively eliminates contaminating acute myeloid leukemia or multiple 4+myeloma cells from the specimen without affecting the ability of the resident normal CD3 stem and progenitor cells to engraft immunodeficient NOD/scid/IL2R.-knockout (NSG) mice. The myxoma virus infection of cells downregulates MHC-I and enhances NK cell activity and thus, MYXV infection not only leads to the direct killing of cancer cells but also promotes early immune cell–mediated antitumor responses (See, abstract, page 199-table 3, pages 202-204).
It would have been obvious to one of the ordinary skills in the art before the effective filing date of the claimed invention to modify the combined prior art teachings of Liu et al 2009, Bell 2011, Dunlap et al 2015, and Calton et al 2018 as applied to method of claim 11 and incorporate the additional teachings of McFadden and Chan to arrive at the method of claim 20 comprising mononuclear peripheral blood cells and/or bone marrow cells comprising/infected with the recombinant myxoma virus expressing p14 FAST thereby treating and/or inhibiting the hematological cancer in the subject in need thereof. One would have been motivated to do so given the suggestion and teaching of McFadden et al 2017 on successful treatment of hematopoietic malignancies/cancers, multiple myeloma, leukemia by using the myxoma virus comprising/infected PMBCs/stem cells approach. One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claim 20. Thus, the invention of claim 20 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 20. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
12. Claims 24-25 are rejected under 35 U.S.C. 103 as being unpatentable over combined prior art teachings of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938), Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198) as applied to claim 11 as recited supra and further in view of McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden) and Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan) as applied to claim 20 and further in view of Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Claims 24-25: The combined teachings of Liu et al 2009, Bell 2011, Dunlap et al 2015, Calton et al 2018, McFadden and Chan teach the method of claim 20 as recited supra, however, do not teach added limitation of instant claims 24-25, further comprising adsorbing the recombinant myxoma virus ex vivo onto the surface of the mononuclear peripheral blood cells and/or the bone marrow cells (instant claim 24); wherein the adsorbing the recombinant myxoma virus comprises exposing the mononuclear peripheral blood cells and/or the bone marrow cells to the virus under conditions permitting binding/adsorption of the virus to the surface of the mononuclear peripheral blood cells and/or bone marrow cells (instant claim 25).
Villa et al 2016 is in the art and teaches ex vivo treatment or adsorption of oncolytic myxoma virus on Bone marrow (BM) cells and mobilized peripheral blood stem cells (mPBSCs) obtained from patients with hematologic malignancies at various time, temperature and incubation media conditions. Myxoma virus does not impair hematopoietic stem and progenitor cells. An oncolytic myxoma virus selectively targets human leukemia, myeloma and lymphoma cells while sparing normal hematopoietic stem and progenitor cells (HSPCs). Bone marrow cells or mPBSCs were suspended in plain Iscove’s Modified Dulbecco’s (IMDM) medium or Plasma-lyte A supplemented with ACDA were incubated with vMyx-GFP at MOI of 10 for 1 h at room temperature to allow virus adsorption. An MOI of 10 was selected to ensure that hematopoietic cells would be exposed to an abundance of virus for infection. After this, cells were incubated for either 2 or 24 h at 37°C 5% CO2 to allow for virus infection. For both time points, cells were suspended in either complete IMDM (supplemented with 10% fetal bovine serum [FBS], 2 mmol/L L-glucosamine and 100 U/mL penicillin-streptomycin) or Plasma-lyte A + 10% ACDA for 2 h. Myxoma virus infection of BM cells and mPBSC cells was determined by flow cytometry. Peripheral blood mononuclear cells (PBMCs) were obtained from healthy donors. PBMCs from three healthy individuals were incubated with vMyx-GFP/tomato red fluorescent protein (TrFP) at an MOI of 10 at 4°C for 1 h and after washing to remove unbound virions, cells were further incubated at 37°C for 24 h and PBMCs with adsorbed myxoma virus were harvested (See, abstract, introduction, results, discussion, figures 1-3).
Chan et al 2014 reviewed and thus disclosed ex vivo treatment of samples with oncolytic MYXV prior to implantation or engraftment (See, page 4253, Table 1) Acute myeloid leukemia (AML) and Multiple myeloma (MM). The studies summarized above clearly show that MYXV has the ability to discriminate cancerous myeloid cells from the normal CD34+ HSPCs found within complex bone marrow transplant samples and is thus an attractive candidate to be exploited as an ex vivo purging agent for AML and MM from autologous stem cell transplant specimens (See, Chan et al 2014, page 4254, col 1, para 4).
Bartee et al 2012 teaches selective purging of human multiple myeloma cells from autologous stem cell transplantation grafts using oncolytic myxoma virus. Bartee et al 2012 teaches ex vivo treatment with an oncolytic poxvirus called myxoma virus results in specific elimination of human myeloma cells by inducing rapid cellular apoptosis while sparing normal hematopoietic stem and progenitor cells. The specificity of this elimination is based on strong binding of the virus to myeloma cells coupled with an inability of the virus to bind or infect CD34(+) hematopoietic stem and progenitor cells. These 2 features allow myxoma to readily identify and distinguish even low levels of myeloma cells in complex mixtures. This ex vivo rabbit-specific oncolytic poxvirus called myxoma virus treatment also effectively inhibits systemic in vivo engraftment of human myeloma cells into immunodeficient mice and results in efficient elimination of primary CD138(+) myeloma cells contaminating patient hematopoietic cell products. We conclude that ex vivo myxoma treatment represents a safe and effective method to selectively eliminate myeloma cells from hematopoietic autografts before reinfusion, MYXV specifically eliminates MM Cells while sparing normal hematopoietic stem cells, MYXV elimination of human MM cells requires direct virion binding by adsorption, and conditions for ex vivo adsorption (See, Bartee et al 2012, abstract, page 1541, col 2 methods, Fig 1-6, Results page 1542-550, page 1544, col 1 last para, col 2, and entire article).
Chan et al 2014 teaches ex vivo MYXV infection of human patient bone marrow cells or peripheral blood mononuclear cell samples selectively eliminates contaminating acute myeloid leukemia or multiple 4+myeloma cells from the specimen without affecting the ability of the resident normal CD3 stem and progenitor cells to engraft immunodeficient NOD/scid/IL2R.-knockout (NSG) mice. The myxoma virus infection of cells downregulates MHC-I and enhances NK cell activity and thus, MYXV infection not only leads to the direct killing of cancer cells but also promotes early immune cell-mediated antitumor responses (See, abstract, page 199-table 3, pages 202-204).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to modify the combined prior art teachings that are applied to claim 20 as recited supra and to incorporate the teachings of Villa et al 2016, Chan et al 2013, Chan et al 2014, and Bartee et al 2012 to arrive at the invention of claims 24 and 25 methods. One of the ordinary skills would have been motivated to do so given the suggestion and teaching of Villa et al 2016, Chan et al 2013, Chan et al 2014, and Bartee et al 2012 selective purging of human multiple myeloma cancerous cells by successful adsorption of oncolytic myxoma virus as recited supra. The motivation would be an oncolytic myxoma virus-based purging or cleansing of contaminating cancerous cells in autologous bone marrow cells or PBMCs or PBSCs used in treatment of hematopoietic cancers; with the teachings that myxoma virus cannot infect normal human cells productively; however, the oncolytic myxoma virus infect a variety of cancer types (See, Chan et al 2013, Chan et al 2014, Villa et al 2016, Bartee et al 2012). One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claims 24-25. Thus, the invention of claims 24-25 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestions, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claims 24-25. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
Claim Rejections - 35 USC § 103 (Second Rejection)
13. Claims 11 are rejected under 35 U.S.C. 103 as being unpatentable over Duncan and Pan 2018 (WO2018232523A1, 12/27/2018, with an earlier priority of 06/23/2017 to application no. 2971832 filed in Canada, hereafter referred as Duncan 2018), and further in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198).
Claims 11: Duncan 2018 is in the art and teaches a method comprising recombinant oncolytic virus (e.g. a DNA pox virus member vaccina virus, RNA virus, a vesicular stomatitis virus) that expresses one or more reovirus fusion-associated small transmembrane (FAST) proteins for treatment of metastatic cancers. The oncolytic activity of the recombinant oncolytic viruses expressing p14 FAST proteins can be used to treat primary and metastatic cancers, especially from breast cancer and colon cancers (see, abstract, claims 1-33).
Duncan 2018 teaches that many different species of viruses e.g. herpesvirus, adenovirus, reovirus, measles virus, Newcastle disease virus, vaccina virus and vesicular stomatitis virus (see, claim 9) are candidates for modification into a recombinant oncolytic virus that expresses p14 FAST protein (see, claim 16).
Duncan 2018 although teaches a recombinant oncolytic vaccinia virus (a pox virus) (see, claim 16) do not teach a recombinant oncolytic myxoma virus (a pox virus).
The prior art teachings and motivation of Liu et al 2009, Bell and Boeuf 2011, Dunlap et al 2015 and Calton et al 2018 that rendered the method comprising a recombinant myxoma virus that expresses p14FAST in the intergenic region of ORF 135-136 obvious as recited supra are incorporated here in entirety to combine with teachings of Duncan 2018.
It would have been obvious to modify the prior art teachings of Duncan 2018 on Vaccinia virus with teachings, as recited supra , and substitute vaccinia virus with a myxoma virus based on teachings of Liu et al 2009 on myxoma virus p14 FAST insertion in intergenic region of ORF 135 and 166 , Bell and Boeuf 2011 on VSV expressing p14FAST , Dunlap et al 2015 on treatment of resistant Dox40 multiple myeloma by administering myxoma virus, Calton et al 2018 on killing bortezomib-resistant multiple myeloma cells by myxoma virus to arrive at the invention of claim 11. One of the ordinary skills in the art would have been motivated to develop oncolytic recombinant MYXV expressing p14 FAST protein and expression suggestion and teaching of Dunlap et al 2015 on effectiveness of oncolytic myxoma virus for treatment of drug-resistant multiple myeloma. The oncolytic myxoma virus comprising the heterologous immunomodulatory gene p14 FAST due to the fusogenic property of p14 FAST protein would be expected to be efficacious and effective against drug-resistant multiple myeloma with a motivation of commercial success. One of the ordinary skills in the art would have a reasonable expectation of success given the combined prior teachings as applied to claim 11. Thus, the invention of claim 11 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestions, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claim 11. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
14. Claims 13-14, 16-20, and 24-25 are rejected under 35 U.S.C. 103 as being unpatentable over combined prior art teachings of Duncan and Pan 2018 (WO2018232523A1, 12/27/2018, with an earlier priority of 06/23/2017 to application no. 2971832 filed in Canada, hereafter referred as Duncan 2018), Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11) and Calton et al 2018, Cancers 2018, 10, 198) as applied to claim 11 above and further in view of Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017), Champion et al 2018 (CA3063652A1, 12/06/2018), Duncan 2010 (US7851595B2, 12/14/2010), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), and Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Claims 13-14, 16-20, and 24-25: The combined prior art teachings of Duncan 2018, Liu et al 2009, Bell and Boeuf 2011, Dunlap et al 2015 and Calton et al 2018 rendered obvious claim 11 as recited supra.
The prior art teachings of Song 2018, Liu et al 2017, Champion et al 2018, Duncan 2010, McFadden et al 2017, Chan 2014, Villa et al 2016, Chan et al 2013, Bartee et al 2012as applied to render obvious claims 13-14, 16-20, and 24-25 as recited above in 35 USC 103 (first rejection) are incorporated here in entirety to render obvious instant claims. It would have been obvious to one of the ordinary skills to arrive at the invention of claims 13-14, 16-20, and 24-25 with a reasonable expectation for motivation for commercial success. Thus, the invention of claims 13-14, 16-20, and 24-25 was clearly prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention. It is similar to some teaching, suggestions, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed inventions in claims13-14, 16-20, and 24-25. See, KSR Int'l Co. v. Teleflex Inc., 550 U.S. 398, 415-421, 82 USPQ2d 1385, 1395-97 (2007), MPEP 2143, Examples of Rationales, A-G.
Double Patenting (Amended)
15. The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
16. Claims 11, 13-14, 16-20, and 24-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-119 of U.S. Patent No. US12569526B2 (03/10/2026) in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and further in view of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Calton et al 2018, Cancers 2018, 10, 198), Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017), Champion et al 2018 (CA3063652A1, 12/06/2018), Duncan 2010 (US7851595B2, 12/14/2010), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), and Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims and the patented claims are drawn to an oncolytic virus, an oncolytic myxoma virus comprising one or more immunomodulatory genes for treating hematological cancer multiple myeloma in a subject by administering the recombinant myxoma virus.
The differences between the instant claims and reference patented claims are:
The instant claims comprise added limitations that a recombinant myxoma virus, comprising a heterologous immunomodulatory gene comprises a nucleic acid encoding p14 FAST whereas, the myxoma virus of the patented reference claims does not comprise p14 FAST encoding nucleic acid. Therefore, the instant claims 11, 13-14, 16-20, and 24-25 would be an obvious variant of the patented reference claims 1-119 in view of the teachings of the prior arts as recited supra incorporating here in entirety the applied obviousness analysis, motivation and reasonable success in this office action.
17. Claims 11, 13-14, 16-20, and 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 6-7, 10-14, 17-18, 30, and 35 of co-pending application no. 17767856 in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and further in view of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Calton et al 2018, Cancers 2018, 10, 198), Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017), Champion et al 2018 (CA3063652A1, 12/06/2018), Duncan 2010 (US7851595B2, 12/14/2010), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), and Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims 11, 13-14, 16-20, and 24-25 and the copending reference claims 1, 6-7, 10-14, 17-18, 30, and 35 are drawn to an oncolytic virus, an oncolytic recombinant myxoma virus comprising immunomodulatory genes for treating hematological cancer in a subject by administering the recombinant oncolytic myxoma virus.
The differences between the instant claims and reference patented claims are:
The instant claims 11, 13-14, 16-20, and 24-25 comprise added limitations that a recombinant myxoma virus, comprises a heterologous immunomodulatory gene p14 FAST encoding nucleic acid sequence.
The co-pending reference claims 1, 6-7, 10-14, 17-18, 30, and 35 of co-pending application no. US17767856 does not comprise an added limitation a heterologous immunomodulatory gene p14 FAST encoding oncolytic myxoma virus; however, comprise a limitation on multi-specific immune cell engager comprising BiKE, BiTE or MiTE.
Therefore, the instant claims 11, 13-14, 16-20, and 24-25 would be an obvious variant of the co-pending reference claims 1, 6-7, 10-14, 17-18, 30, and 35 in view of the teachings of the prior arts as recited supra incorporating here in entirety the applied obviousness analysis, motivation and reasonable success in this office action.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct co-pending claims have not yet been patented on the date of issue of this office action.
18. Claims 11, 13-14, 16-20, and 24-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 10, 14-24, 27-31, , 38-44, and 48 of U.S. Patent No. US12257278B2 (03/25/2025) in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and further in view of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Calton et al 2018, Cancers 2018, 10, 198), Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017), Champion et al 2018 (CA3063652A1, 12/06/2018), Duncan 2010 (US7851595B2, 12/14/2010), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), and Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims 11, 13-14, 16-20, and 24-25 and the patented reference claims 1, 10, 14-24, 27-31, , 38-44, and 48 are drawn to an oncolytic recombinant myxoma virus comprising immunomodulatory genes for treating cancer in a subject by administering the recombinant oncolytic myxoma virus. The limitations of instant claims 11, 13-14, 16-20, and 24-25 are taught by reference claims 1, 10, 14-24, 27-31, , 38-44, and 48 by disclosing, a pharmaceutical composition, comprising, an oncolytic myxoma virus engineered to express immunomodulatory gene, a TNF gene inserted between M135R gene and M136R gene within the myxoma virus genome; and by disclosing a method of inhibiting or treating a cancer in a subject in need by administering a pharmaceutical composition comprising the engineered myxoma virus.
Therefore, it would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to do an obvious modification to the patented reference claims and replace a TNF gene with p14FAST in view of the applied combined prior art teachings as recited supra to arrive at the claimed inventions by incorporating in entirety the prior art teachings and obviousness analysis, motivation and reasonable expectation of success recited supra.
19. Claims 11, 13-14, 16-20, and 24-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 8, 10, 16, 19-20 and 23 of U.S. Patent No. US11117934B2 in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and further in view of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Calton et al 2018, Cancers 2018, 10, 198), Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017), Champion et al 2018 (CA3063652A1, 12/06/2018), Duncan 2010 (US7851595B2, 12/14/2010), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), and Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because both instant claims 11, 13-14, 16-20, and 24-25 and the patented reference claims 1, 8, 9-10, 16, 19-20 and 23 are drawn to an oncolytic recombinant myxoma virus (MYXV) comprising immunomodulatory genes, comprising decorin for treating cancer in a subject by administering the recombinant oncolytic myxoma virus; a composition comprising a plurality of cells treated ex vivo by a MYXV, wherein the MYXV is genetically engineered to attenuate an activity ……, and to express a non-viral molecule, wherein the non-viral molecule is a cytokine; the plurality of cells comprises peripheral blood mononuclear cells (PBMCs), bone marrow (BM) cells, or a combination thereof; a method of inhibiting or alleviating a cancer in a subject in need thereof, comprising administering to the subject a MYXV or a plurality of cells treated with the genetically engineered MYXV expressing/encoding decorin.
The differences between the instant claims and reference patented claims are:
The instant claims 11, 13-14, 16-20, and 24-25 comprise an added limitation that the engineered / recombinant oncolytic myxoma virus comprise p14 FAST encoding nucleic acid sequence.
The patented claims 1, 8, 9-10, 16, 19-20 and 23 comprise a limitation that MYXV is genetically engineered to express a non-viral molecule (e.g. TNFα, IL-12α, IL-12β, and decorin) to attenuate an activity or expression level of its M153 protein.
It would have been obvious to one of ordinary skill in the art, before the effective filing date of the claimed invention, to do an obvious modification to the patented reference claims 1, 8, 9-10, 16, 19-20 and 23 (US11117934B2) to incorporate p14FAST in view of the applied combined prior art teachings, applied obviousness analysis, motivation and reasonable expectation of success as recited supra to arrive at the instant pending claims.
20. Claims 11, 13-14, 16-20, and 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2, 5-6, and 12 of copending Application No. 17/767857 (reference application filed on 03/21/2024) in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and further in view of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Calton et al 2018, Cancers 2018, 10, 198), Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017), Champion et al 2018 (CA3063652A1, 12/06/2018), Duncan 2010 (US7851595B2, 12/14/2010), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), and Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending reference claims that teaches instant application claims as recited below are similar.
Both the instant claims and co-pending reference claims are directed to a recombinant/engineered myxoma virus comprising a transgene, a heterologous immunomodulatory gene encoding immunomodulatory proteins. A transgene, encoding a heterologous immunomodulatory gene comprises fusion associated small transmembrane (FAST), PD-L1 binding molecule, anti-PD-L1 antibody. The transgene is located between the M135R and M136R genes of the genome of the myxoma virus.
There are no substantial differences in the co-pending reference claims and instant application claims.
The invention defined in the copending claims 1-2, 5-6, and 12 would have been an obvious variation of the invention defined in the in the instant claims 11, 13-14, 16-20, and 24-25 in view of the applied prior art teachings as recited supra that are incorporated here in entirety obviousness analysis, motivation and reasonable expectation of success as recited supra.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
21. Claims 11, 13-14, 16-20, and 24-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 17, 19, and 23 of copending Application No. 18/852540 (reference application) in view of Liu et al 2009 (published in Journal of Virology, June 2009, p. 5933–5938) and further in view of Bell and Boeuf 2011 (US20110206640A1, published 25 August 2011) (hereafter referred as Bell 2011), Dunlap et al 2015 (Oncolytic Virotherapy 2015, 4, p.1-11), Calton et al 2018, Cancers 2018, 10, 198), Song 2018 (WO2018049248A1, published 15 March 2018), Liu et al 2017 (CN106755103A, 05/31/2017), Champion et al 2018 (CA3063652A1, 12/06/2018), Duncan 2010 (US7851595B2, 12/14/2010), McFadden et al 2017 (US9730960B2, published 15 August 2017) (hereafter referred as McFadden), Chan 2014 (published in Annu. Rev. Virol. 2014. 1:191–214) (hereafter referred as Chan), Villa et al 2016 (published in Cytotherapy, 2016, (18): 465–480) (hereafter referred as Villa), Chan et al 2013 (Vaccine 31 (2013) 4252– 4258), and Bartee et al 2012 (Biol Blood Marrow Transplant. 2012 Oct;18(10):1540-51).
Although the claims at issue are not identical, they are not patentably distinct from each other because the co-pending reference claims that teaches instant application claims as recited below are similar.
Both the instant claims and co-pending reference claims are directed to the method comprising treatment of a cancer solid tumor a hematological cancer in a subject comprising administration of a recombinant or engineered myxoma virus comprising a transgene encoding PD1-L1 inhibitor (antibody), LIGHT, Decroin, BiKE, and p14 FAST.
The invention defined in the instant claims11, 13-14, 16-20, and 24-25 would have been an obvious modification and variation of the invention defined in the in the copending claims 17, 19, and 23 in view of the combined teachings of in view of the applied prior art teachings as recited supra that are incorporated here in entirety obviousness analysis, motivation and reasonable expectation of success as recited supra.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Arguments
22. Applicant’s arguments filed on 05/20/2026 with respect to rejection of claims in final rejection office action 01/20/2026 have been considered but are moot because the new ground of rejection does not rely on only reference applied in the prior rejection of record for all the teaching or matter specifically challenged in the argument. Additional teachings from the prior art of record and new prior arts are applied in this non-final rejection office action in view of applicant’s amendment of claims (by cancelling the rejected claims) that changed the scope of instant amended claims and required to consider additional teachings and additional prior arts.
Applicants’ arguments filed on 05/20/2026 are responded with following responses:
Applicant’s arguments 35 USC 103 rejection: The applicant disagree rejection claims over the applied prior art in final rejection action 01/20/2026.
In Response: The combined teachings of the applied prior arts rendered obvious the claims that were examined in the final action 01/20/2026 and the examiner reiterates that the rejection was proper under 35 USC 103 with the provided obviousness analysis, reasonable success and motivation.
In response to applicant's argument that the examiner has combined an excessive number of references, reliance on a large number of references in a rejection does not, without more, weigh against the obviousness of the claimed invention. See In re Gorman, 933 F.2d 982, 18 USPQ2d 1885 (Fed. Cir. 1991).
In response to applicant's argument that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971).
In response to applicant’s argument that there is no teaching, suggestion, or motivation to combine the references, the examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, Liu et al 2009 is directed to a recombinant myxoma virus that expresses IL-15 an immunomodulatory protein in the intergenic region of ORF 135 and ORF 136. The secondary references Bell 2011 and Duncan 2018 teaches the oncolytic recombinant viruses expressing p14 FAST proteins. Liu et al 2009 has express teachings to to use the recombinant myxoma virus for cancer treatment. Therefore there is a express teaching and motivation to incorporate p14FAST in myxoma virus (see, office action). Even if Bell 2011 is kept as a primary reference, Liu et al 2009 provides express motivation to incorporate p14FAST of Bell 2011 or Duncan 2008 to incorporate in myxoma virus of Liu et al 2009 by substituting IL-15.
Applicant’s argument on unexpected or superior results and secondary considerations:
In Response: The combined teachings of the applied prior arts rendered obvious the claims that were examined in the final action 01/20/2026 and therefore the results that the applicant argues as unexpected are reasonably expected results. In addition, in view of the applicant’s specification and the prior art of record, the claimed oncolytic recombinant myxoma virus that express p14FAST is expected to be equally effective in a method of treatment against both drug sensitive and drug-resistant cancer (e.g. breast cancer, multiple myeloma) because the claimed myxoma virus do not have a different specificities or viral ligand that distinguish drug sensitive and drug-resistant cancer.
Rebuttal evidence and arguments can be presented in the specification, In re Soni, 54 F.3d 746, 750, 34 USPQ2d 1684, 1687 (Fed. Cir. 1995), by way of an affidavit or declaration under 37 CFR 1.132, e.g., Soni, 54 F.3d at 750, 34 USPQ2d at 1687; In re Piasecki, 745 F.2d 1468, 1474, 223 USPQ 785, 789-90 (Fed. Cir. 1984). However, arguments presented by applicants cannot take the place of factually supported objective evidence. See, e.g., In re Schulze, 346 F.2d 600, 602, 145 USPQ 716, 718 (CCPA 1965); In re De Blauwe, 736 F.2d 699, 705, 222 USPQ 191, 196 (Fed. Cir. 1984).
A mere attorney argument or statement made by an applicant’s representative cannot take the place of evidence in the record.
Not Evidence: Arguments presented in a response or brief do not count as factual evidence of non-obviousness, unexpected results, or technical features unless they qualify as an admission.
Requirement for Support: When traversing a rejection (such as an obviousness rejection under 35 U.S.C. 103), an attorney's assertions about technical capabilities or "design choice" must be backed by the record, specification evidence, or an affidavit/declaration under 37 CFR 1.132.
See, MPEP 2145.
Double Patenting Rejections
23. Applicant’s Arguments details can be referred to as filed on 05/20/2026 as it pertains to different double patenting rejections. In view of the applicant’s amendment of claims and status of copending applications, the rejections have been modified in this non-final rejection office action as recited supra.
The Applicant argues that MPEP § 804(II)(B)(2) states that a non-statutory double patenting rejection is "analogous to [a failure to meet] the nonobviousness requirement of 35 U.S.C. § 103" In re Braithwaite, 379 F.2d 594, 154 USPQ 29 (CCPA 1967). Thus, Applicants submit that the inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966) are equally applicable to allegations of non-statutory obviousness-type double patenting rejections.
With regards to all the separate double patenting rejections as listed by the applicant in arguments filed on 05/20/2026 as stated above the applicant argues that the rejections are improper. Applicants submit that the present claims are not obvious over the distinct co-pending applications and the applied prior arts to render obvious the double patenting rejections.
In Response: The claims 11, 13-14, 16-20, and 24-25 as amended on 05/20/2026 are rejected under 35 USC 103 as recited in the office action and thus meet the requirements recited in MPEP § 804(II)(B)(2).
Applicant’s arguments were considered but are not persuasive and the double patenting rejection of the claims as recited in this non-final office action have been modified as recited supra.
24. Relevant Prior Arts:
Lauterbach et al. RU2830601C2 (11/22/2024 with an earlier priority to of 11/20/2018 to EP18207238.9). Therapy for treating cancer by intratumoral and/or intravenous administration of a recombinant modified vaccinia virus (MVA) coding 4-1bbl (cd137l) and/or cd40l. Para [0192] Preferably, the nucleic acids of the present invention can be inserted into one or more intergenic regions (IGRs) of the MVA virus. The term "intergenic region" refers preferably to regions of the viral genome located between two adjacent open reading frames (ORFs) of the MVA virus genome, preferably between two significant ORFs of the MVA virus genome. In the case of MVA, in certain embodiments, the ORF is selected from ORF 07/08, ORF 44/45, ORF 64/65, ORF 88/89, ORF 136/137, and ORF 148/149.
McFadden et al 2013. WO2012171007A2 (12/13/2012) and McFadden et al 2014 US20140328804A1 (11/06/2014). Methods for treating or preventing graft versus host disease. A method for treating cancer in a subject comprising: contacting a graft comprising a plurality of hematopoietic cells with an amount of a Myxoma Virus ex vivo effective to inhibit proliferation of T lymphocytes in the graft; administering at least one of chemo transplanting the virus-treated graft into the subject. The cancer is a hematologic malignancy.
Wong, C., Nash, L., Del Papa, J. et al. Expression of the fusogenic p14 FAST protein from a replication-defective adenovirus vector does not provide a therapeutic benefit in an immunocompetent mouse model of cancer. Cancer Gene Ther 23, 355–364 (2016).
Del Papa J, Petryk J, Bell JC, Parks RJ. An Oncolytic Adenovirus Vector Expressing p14 FAST Protein Induces Widespread Syncytium Formation and Reduces Tumor Growth Rate In Vivo. Mol Ther Oncolytics. 2019 May 15;14:107-120.
Conclusion
25. No claim is allowed.
26. Any inquiry concerning this communication or earlier communications from the examiner should be directed to SAMADHAN J JADHAO whose telephone number is (703)756-1223. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas J Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SAMADHAN JAISING JADHAO/Examiner, Art Unit 1672
/BENNETT M CELSA/Primary Examiner, Art Unit 1600
Prosecution Insights