DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from Application PCT/US2020/027534 filed 04/09/2020 and from Provisional Application nos. 62/831,604 filed 04/09/2019, 62/889,217 filed 08/20/2019, 62/944,913 filed 12/06/2019 and 62/980,900 filed 02/24/2020, is hereby acknowledged.
Application Status
This application is a Continuation of PCT/US2020/027534 filed 04/09/2020.
Claim amendments filed 10/09/2025 are hereby acknowledged. Claims 1-155, 157 and 162 are cancelled. Claims 156, 163, and 166 are currently amended. Claims 156-175 are currently pending. Claims 168-175 are withdrawn from consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Election was made without traverse in the reply filed on 05/28/2025, in which Invention Group I and Species Group A(2) were elected (claims 156-167).
Therefore, claims 156, 158-161, and 163-167 are under examination in this office action.
Any objection or rejection not reiterated herein has been overcome by Applicant’s amendments and is therefore withdrawn.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 10/09/2025 is hereby acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Drawings
Higher resolution for Drawings can be found in Supplementary files dated 10/09/2025. Replacement sheets filed 10/09/2025 are hereby acknowledged and are acceptable.
Specification
Replacement and amended copy filed 10/09/2025 for the disclosure is hereby acknowledged and is acceptable
New Rejections necessitated by Applicant’s amendments:
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 158 is rejected under 35 U.S.C. §112(b) or 35 U.S.C. §112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 158, it depends on cancelled claim 157. MPEP 608.01(n) states "If the base claim has been canceled, a claim which is directly or indirectly dependent thereon should be rejected as incomplete."
Since elements of cancelled claim 157 are not known, claim 158 is drawn to sequences and/or structures that are indefinite.
The following rejections are maintained from Office Action dated 07/10/2025, but are modified to reflect Applicant’s amendments:
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 156, 158-161, 163-167 are rejected under 35 U.S.C. §112(a) or 35 U.S.C. §112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant
was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description
requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Nature of the Invention and Specification content
Claim 156 recites “[A]n antisense oligonucleotide comprising a sequence
complementary to a sequence selected from the group consisting of:
5'-GTGGGTTTCAGGGATTCTGA-3' (SEQ ID NO: 1),
5'-CCCTGATTCAGACAGCAGGG-3' (SEQ ID NO: 2),
5'-GCTGGCTTTGTCTGGATAGG-3' (SEQ ID NO: 3),
5'-TCTCACGTCACCTGCCTTAC-3' (SEQ ID NO: 4), and
5'-AGCGCTGCCACAGCAGTGGG-3' (SEQ ID NO: 5),
Wherein the antisense oligonucleotide comprises one or more chemical modifications, and wherein the antisense oligonucleotide is capable of modulating splicing of a NEDD4L pre-mRNA in an MDA-MB-231 cell.”
Below is shown the sequence of Human Chromosome 18 (see pdf, published March 26, 2018), from region 58 335 332 to region 58 335 431 (about 100 nucleotides retrieved directly from the sequence):
PNG
media_image1.png
122
512
media_image1.png
Greyscale
1 gctggctttg tctggatagg gtgggtttca gggattctga tctcacgtca cctgccttac 60
61 agcgctgcca cagcagtggg ccctgattca gacagcaggg 100
Alignments of this sequence to SEQ ID NOs 1-5 are shown below (Qy, Query= region of chromosome 18; Db, Database= SEQ ID from instant application,Table 13):
SEQ ID NO: 1 (Table 13, page 121):
Qy 21 GTGGGTTTCAGGGATTCTGA 40
||||||||||||||||||||
Db 1 GTGGGTTTCAGGGATTCTGA 20
SEQ ID NO: 2 (Table 13, page 124):
Qy 81 CCCTGATTCAGACAGCAGGG 100
||||||||||||||||||||
Db 1 CCCTGATTCAGACAGCAGGG 20
SEQ ID NO: 3 (Table 13, page120):
Qy 1 GCTGGCTTTGTCTGGATAGG 20
||||||||||||||||||||
Db 1 GCTGGCTTTGTCTGGATAGG 20
SEQ ID NO: 4 (Table 13, page 122):
Qy 41 TCTCACGTCACCTGCCTTAC 60
||||||||||||||||||||
Db 1 TCTCACGTCACCTGCCTTAC 20
SEQ ID NO: 5 (Table 13, page 123):
Qy 61 AGCGCTGCCACAGCAGTGGG 80
||||||||||||||||||||
Db 1 AGCGCTGCCACAGCAGTGGG 20
The alignments show that SEQ ID NOs: 1 to 5 are actual contiguous sequences taken from Human chromosome 18, arranged successively over 100 nucleotides in the region starting at 58 335 332 (position 1) to region 58 335 431 (position 100):
1 GCTGGCTTTGTCTGGATAGG GTGGGTTTCAGGGATTCTGA TCTCACGTCACCTGCCTTAC
|||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||
GCTGGCTTTGTCTGGATAGG GTGGGTTTCAGGGATTCTGA TCTCACGTCACCTGCCTTAC
Seq id no.3 Seq id no.1 Seq id no.4
AGCGCTGCCACAGCAGTGGG CCCTGATTCAGACAGCAGGG 100
|||||||||||||||||||| ||||||||||||||||||||
AGCGCTGCCACAGCAGTGGG CCCTGATTCAGACAGCAGGG
Seq id no. 5 Seq id no.2
While the sequences in claim 156 present possible species of 20 nucleotides, if
exact complementary sequences are involved, for each with additional chemical modifications, the claim does not recites specific structures and modification patterns to obtain an oligonucleotide capable of modulating splicing of a NEDD4L pre-mRNA. However, the terms “comprising a sequence complementary to a sequence selected” encompass oligonucleotides varying in sizes, with non-complementary extra nucleotides.
Claim 158 recites: “[T]he antisense oligonucleotide of claim 157, wherein the modulation of splicing comprises promoting a splicing switch.”
The specification does not describe specific sequences with multiple sequence IDs enumerating complementary sequences and structure specific of promoting splicing switch.
Claim 159 and 160 recites different lengths for the oligonucleotides, without further specifying whether the sequences are complementary or non-complementary to NEDD4L pre-mRNA. The claims do not recite specific enumeration in residues to account for the function claimed in claim 156.
Claim 161 recites oligonucleotides comprising DNA, RNA, PNA or combination or hybrid. The Specification does not describe corresponding to species of the broad genus encompassing these variations of sequences corresponding to species derived from SEQ ID NOs 1 to 5.
Claims 163 to 166 recites modifications to each of the oligonucleotides claimed in claim 156. However, the Specification does not describe such modification or patterns of modification on each oligonucleotide. The specification does not describe specific structure in common to all the species described in this genus, capable of providing the function that is recited in claim 156, wherein the oligonucleotide is capable of modulating splicing of NEDD4L mRNA in a cell” or “[T]he antisense oligonucleotide of claim 157, wherein the modulation of splicing comprises promoting a splicing switch”. This language suggests that all the species of the genus comprising variants comprising SEQ ID NOs: 1 to 5 possess the ability to function as “capable of modulating splicing of NEDD4L mRNA in a cell” or to “promote a splicing switch”. The specification does not describe essential and/or consensus sequences in common to all the species (DNA, RNA, PNA or combinations thereof) of SEQ ID NOs: 1-5 necessary to obtain a modulation of splicing of NEDD4L pre-mRNA or to promote a splicing switch.
In the Specification (page 6, [0012], lines 7-11), Applicant discloses that “[I]n some embodiments, the modulating comprises inducing or enhancing exon skipping. In some embodiments, the modulating comprises inducing or enhancing exon inclusion. In some embodiments, the modulating comprises promoting a splicing switch. In some embodiments, the modulating comprises down-regulation or up-regulation of splicing”. Therefore, the definition of “modulating” in claim 157 encompasses opposite results, retention versus exclusion of exon.
However, Applicant does not specify the structure needed for retention nor exclusion of an exon, while claiming the structures comprising SEQ ID NOs: 1 to 5 or their complementary sequences, and DNA, RNA or PNA hybrids thereof, are generally capable of producing both results.
Applicant does not give specifics on the resulting spliced variant obtained for NEDD4L in figures 9 and 10.
In Figure 9, Applicant presents results obtained with SSO2-1, SSO2-2, SSO2-3, SSO2-4 and SSO2-5. It seems that Applicant is describing variants of sequences comprising SEQ ID NO:2, however, there is no definition in the Specification about which structure these terms refer to; Applicant claims SEQ ID NO:2 and its complementary sequence, however, there is no indication whether these terms refer to the sense or antisense (complementary) sense of SEQ ID NO:2.
In Figure 9, there are clearly differences in results obtained with SSO2-2 and SSO2-5. However, there is no indication of the structure necessary for a positive result.
Further, the analysis of sequences presented in the same table (Table 13) presenting SEQ ID NOs: 1-5, shows that the sequences are tiling over the length of Human chromosome 18, over intron/exon 13 of NEDD4L gene. However, Applicant does not state which region of the gene specifically provides oligonucleotides capable of modulating, i.e. inducing an exon skipping and region provides oligonucleotides capable of inducing a retention/inclusion of an exon in NEDD4L pre-mRNA. Thus the identity of specific structures responsible for the function and the location of a consensus sequence or a consensus modification pattern, responsible for the function of being capable of modulating the splicing of NEDD4L pre-mRNA or to promote a splicing switch remain elusive.
State of the Art
Itani (Itani, O.A. et al “Alternate promoters and variable splicing lead to hNedd4-2 isoforms with a C2 domain and varying number of WW domains”. Am. J. Physiol. Renal Physiol., Vol. 285 (2003), pp: F916-F929; previously cited) teaches alternate splicing events in NEDD4L (also known as Nedd4-2) mRNA. Itani clearly shows in Fig.3 (page F920) that the NEDD4L has multiple isoforms. There are 5’ variants (see table 5) and 3’ WW domains variants (see Figure 8). Figure 8A shows that exon 13 is deleted in at least 3 isoforms.
Shen (Shen, X et al. “Chemistry, mechanism and clinical status of antisense oligonucleotides and duplex RNAs”. Nucleic Acids Research, Vol. 46 (2018), pp: 1584-1600; previously cited), teaches that when alternative splicing is wanted, the pre-mRNA is the target for oligonucleotides, therefore the cell nucleus should be the subcellular location to be targeted (see figure 4). Therefore, it would make sense that the structure of an oligonucleotide comprises complementary sequences to the pre-mRNA and a nuclear localization signal. On page 5, left column, “[R]egulating splicing with ASOs” section and Figure 5, Shen teaches how to allow “steric blocking” oligonucleotides. Shen also teaches that “[T]esting multiple ASOs [antisense oligonucleotides], is necessary because activities sometimes can differ dramatically, even when ASOs target closely related sequences” (page 5, left column, lines 15-17).
Shen also teaches that RNA-DNA hybrids can recruit RNAse H and act in a different manner then “steric blocking” (see page 5, left column, “[R]egulating translation with ASOs by recruiting RNAse H”). A RNA-DNA hybrid (gapmer) can induce degradation of target by recruiting RNAse H. Therefore, an ASO gapmer will act in a different manner, thus, for alternative splicing, an ASO designed to contain modified ribose or morpholino modifications on RNA-based sequence for “steric blocking” is preferred, the goal being to induce a modification in splicing, not to modify the content of the cell in target mRNA (see page 5, “[R]egulating splicing with ASOs”, left column).
Thus, Shen teaches that specific design is needed to obtain alternative splicing from ASOs, and some hybrids may have further needs for modification. Shen also teaches that those hybrids may not be equivalent, even though they may derived from the same sequences, and that multiple assays are needed because of variability (page 5, left column, lines 15-17).
On page 8, left column, Shen also teaches about “off-target effects”, about some concentrations achieving therapeutic benefit or resulting in toxicity.
Havens (Havens,M.A. et al. “Splice-switching antisense oligonucleotides as therapeutic drugs”. Nucleic Acids Res., Vol.44 (2016), 6549–6563; previously cited) teaches that splice-switching oligonucleotides (SSOs) are modified nucleic acids designed to base-pair with a pre-mRNA by blocking the RNA-RNA base pairing or protein-RNA binding interactions occurring during alternative splicing between components of splicing machinery and pre-mRNA (see abstract). Havens teaches that SSOs can either induce exon skipping or exon inclusion (see Figure 1). Havens teaches in Figure 1, that a SSO can be designed to base-pair to a splicing enhancer sequence and create a steric block to the binding of the stimulatory splicing factor and can lead to exon skipping. In contrast, a SSO designed to base-pair to a splicing silencer sequence element blocks the splicing silencer activity and can lead to exon inclusion.
Havens teaches that the splicing silencer and enhancer binding proteins bind in a sequence-specific manner. Havens also teaches that RNA secondary structures and chromatin structures can also act to influence alternative splicing (see page 6550, left column, lines 2-15). Havens also teaches that the length of SSO oligonucleotides can vary between 15 to 30 nucleotides, designed to base-pair to target RNA, and that the chemical modification are such that RNAse H is not recruited to degrade the pre-mRNA-SSO complex. In this sense, an SSO is different from other ASOs, since the modifications are crucial for its uptake and stability (see pages 6550-6551, “Splice-switching antisense oligonucleotides (SSOs)” section).
Conclusion
In summary, the specification describes single species within the claimed
genus - sequences comprising complementary sequences of SEQ ID NOs: 1-5, while claim 159 seems to indicate that oligonucleotides’ sizes range from about 20 to 50 bases to obtain alternative splicing; therefore the claim encompasses sequences that are complementary to pre-mRNA’s sequences and non-complementary sequences in lengthier oligonucleotides.
The Specification does not teach how the complementary sequences would perform the function claimed and how they should be modified to perform the function since unmodified oligonucleotides are targeted for degradation as well as their hybrid by RNAse H. The goal is not to destroy the mRNA but to provoke an alternative splicing, therefore further modifications to ensure stability of the complex are needed according to prior art. But, the specification does not provide a consensus, a predictable set of sequences, or modification pattern that would be responsible for the claimed function, that would be present in species claimed, i.e. DNA, RNA, PNA or combination hybrids. The Specification does not teach which combination of modification and which consensus sequences are required to obtain exon skipping or exon retention. Applicant discloses success of exon retention using SSOs; however, very little is known about the structures of these SSOs that were capable of inducing the exon retention.
While none of these elements are specifically required to demonstrate possession, in combination their absence means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of the invention, a composition that comprises a sequence complementary to SEQ ID NOs: 1-5, comprising DNA, RNA, PNA or combination thereof, with modifications capable of modifying splicing of NEDD4L pre-mRNA in a cell.
One skilled in the art at the time of filing would conclude that the inventors lacked possession of such an invention.
Enablement requirement
Claims 156, 158-161, and 163-167 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The specification does not reasonably provide enablement for the use of
sequences comprising complementary sequences to SEQ ID NOs: 1-5, to cause splicing modification of NEDD4L pre-mRNA in a MDA-MB-231 cell. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to use the invention commensurate in scope with the claims.
As stated in MPEP §2164.01(a), “there are many factors to consider when
determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any experimentation is ‘undue’.” These factors include, but are not limited to:
The nature of the invention;
The breadth of the claims;
The state of the prior art;
The level of skill in the art;
The level of predictability in the art;
The amount of direction provided by the inventor;
The presence or absence of working examples;
The quantity of experimentation necessarily needed to make or use the invention based on the disclosure.
See In re Wands USPQ 2d 1400 (CAFC 1988).
Further MPEP §2164.01(c) recites, “When a compound or composition claim is
limited by a particular use, enablement of that claim should be evaluated based on that limitation. See In re Vaeck, 947 F.2d 488, 495, 20 USPQ2d 1438, 1444 (Fed. Cir. 1991).”
The relevant Wands factors are applied to Claims 156, 158-161, and 163-167 are as follows:
Nature of the Invention and Breath of the Claims
With respect to claim breadth, the standard under 35 U.S.C. §112(a) entails
determining what the claims recite and what the claims mean as a whole. The nature of the invention indicates that the instant claims encompass sequences capable of modifying the splicing of NEDD4L pre-mRNA in a cell, and that these sequences comprise complementary sequences to SEQ ID NOs: 1-5.
The State of the Art
A review of the art and prior art shows that the following are challenges
associated with the design and the use of a ASO to modify the splicing of a pre-mRNA in a MDA-MB-231 cell:
The design of ASO: Shen also teaches that to provoke alternative splicing, one
has to target the pre-mRNA, in the cell nucleus (see Shen, page 5, Figure 4 and left column). Therefore, the use of complementary sequences to the pre-mRNA are logically required, as well as nuclear localization signal to favor subcellular compartment targeting. Shen also teaches that the oligonucleotides have to be modified in such a way that they do not trigger degradation of the targeted mRNA (page 5, left column);
Havens also teaches that chemical modifications are specifically required to avoid
RNAse H recruitment (see page 6550, right column, “[S]plice-switching antisense oligonucleotides (SSOs)” section and page 6551, left column “[C]ommon chemical modifications of splice-switching oligonucleotides” paragraph). Havens also teaches that a phosphorothioate internucleoside linkage is not enough to obtain the stability required for a steric blocking SSO. A fully modified at 2’ sugar position and a phosphorothioate are needed to obtain a stable SSO. Havens teaches that the binding at a specific splice site can induce either exon skipping or exon retention. Havens teaches that the sites for splicing for genetic diseases such as Duchenne Muscular Dystrophy are known and that specific SSOs targeting those sites in specific exons (exon 44, exon 45 , 51 and 53) are being used in clinical trials (see page 6555, left column, second paragraph, and Table 2).
Hua (Hua,Y. et al. “Enhancement of SMN2 exon 7 inclusion by antisense oligonucleotides targeting the exon”. PLoS Biol., Vol. 5, (2007), pp: 729–744; previously cited) teaches that for a specific disease, there are specific mutations in splice sites, which require specific SSOs. Hua provides specific consensus splicing sites (see page 731, figure 1A and page 0742, left column, line 12) for SMA (Spinal Muscular Atrophy) within the SMN2 pre-mRNA. Hua shows a “walk along exon 7 of SMN2 gene” and teaches multiple ASOs and their effects on splicing of exon 7 (see figures 1 and 2). Hua shows that the ASOs sequences are complementary to the target sequences (see Table 1).
The design of testing conditions: Hua teaches in vitro assay conditions for a ‘walk
along” of exon 7 in SMN2 pre-mRNA (see Figure 1). Hua also teaches cell culture conditions and transfection (see page 0742, left column). Hua teaches the use of an “unrelated” oligonucleotide as a negative control in both conditions (see Figures 1, 2 and Table 1).
Gagnon ( Gagnon, K.T. et al. “Guidelines for Experiments using antisense oligonucleotides and double-stranded RNAs”. Nucleic Acid Therapeutics, Vol. 29 (2019), pp: 116-122; previously cited) also teaches the use of controls for ASOs for alteration of splicing (see page 121, left column, “[S]pecial case: Alteration of Splicing”). Gagnon specifically states that a “mismatch-containing and scrambled ASO should be used to rule out an outcome in which the transfection is influencing splicing”, and that “at least one mismatch and one scrambled oligonucleotide should be used for cell culture experiments”.
The Level of Predictability in the Art
Gagnon teaches that control, scrambled SSOs are needed since transfection
itself seems to affect the alternative splicing event (see above).
Hua teaches that nuclear extract had a fluctuating effect on splicing in vitro. This
indicates that cell nucleus from different cells at different cell cycle period, a different developmental stage or under different environmental conditions, can modify the effect of a specific ASO. Hua also teaches that while evaluating the in vitro splicing in a cell nuclear extract, the precise extent of exon 7 inclusion varies between extracts or depending on the precise reaction conditions, and that the 9 different ASOs tested had different effects on splicing (see page 0731, left column, lines 3-11). Hua teaches that 4 ASOs had negative action and inhibited exon 7 inclusion, one had no effect like the control, and 2 had a positive effect on inclusion (lines 11-18).
Therefore, Hua teaches that even in the presence of a specific splice site, there is unpredictability and variation in oligonucleotides’ effects, depending on how much the target sequence deviates from the consensus sequence, and whether there is a possible stem-loop structure in the oligonucleotide. One SSO with positive effect seems to identify additional region in SMN2 exon 7 for exon inclusion. One SSO with positive effect on exon 7 inclusion appeared to encompass the sequence of a PNA antisense already known for positive effect (see lines 19-41).
The amount of direction provided by the inventor and the presence or absence of working examples
As Hua demonstrated, especially for SMA, that a specific genetic disease
requires specific sets of oligonucleotides based on specific splice sites and “surrounding region”. Hua also teaches that the cell nucleus has a fluctuating effect on splicing, therefore cell type, cell cycle, environmental conditions are likely to have an effect on the composition required as capable of modulating splicing.
The compositions comprising the SSOs claimed in the current application, in claim 156, are narrowly drawn to regions encompassing SEQ ID Nos: 1 to 5 of NEDD4L pre-mRNA and more, since using the term “comprising” does not limit the oligonucleotides to those having only and consisting only of complementary sequences to SEQ ID Nos: 1 to 5.
Applicant claims an oligonucleotide comprising complementary sequences to SEQ ID NOs: 1 to 5. However, the disclosure appears to focus of SEQ ID NOs: 1 and 2 in the working examples. It is not clear whether the ASOs mentioned in Figure 8 are actually representative of SEQ ID NOs: 1 to 5 or their complementary sequences. The SSOs mentioned in Figure 9 also seem to be representative of Species comprising SEQ ID NO: 2. However, there is no mention of the difference between those SSOs. It would be difficult for one of ordinary skills in the art to readily know which are the subspecies that have a positive effect on exon inclusion, and which are effective based on a specific structure. The compositions are not disclosed clearly. There are no recitation of specific residues and specific modification pattern. Instead, the Specification refers to artificial intelligence and databases for one with reasonable skill in the art to go and look for the sequences. It is merely an invitation to one with reasonable skill in the art, to go and search and adapt a method for exon walking and identifying splice sites of interest in a disease of interest ([0049]-[0055]).
One with ordinary skills in the art, willing to recreate the composition effective for modifying NEDD4L pre-mRNA, would not be able to use the working example provided either.
The quantity of experimentation necessary
Applicant’s disclosure does not provide specific examples of compositions
according to the different species encompassed by the larger genus, i.e. an oligonucleotide comprising DNA, RNA, PNA or hybrid thereof. Applicant does not specify whether the examples shown are related to sense or antisense sequences, and whether the differences observed in SSO2 in figure 9 are the result of chemical modifications on sugar residues and/or internucleoside linkage within the SSOs, or chemical structures comprising DNA, RNA or hybrids and/or PNA. Applicant does not disclose a pattern of modification for any SSO or ASO. Applicant does not disclose examples of different modifications affecting the retention/inclusion of exon. Applicant does not show any comparison with scrambled or mismatch oligonucleotide as controls.
One of ordinary skills in the art, motivated in creating a composition as claimed in claims 156, 158-161, and 163-167 would have to identify a region comprising a consensus sequence of splice sites within the NEDD4L gene and identify additional sequences surrounding SEQ ID NOs: 1 to 5, test multiple sequences combinations, with multiple type of chemical modifications (sugars, internucleoside linkage), search for oligonucleotides comprising DNA, RNA, PNA and hybrids that do not recruit RNAse H, with or without modifications with the best results, and test these species in the cell as claimed or in cells/tissue of their interest.
The claims as written and the disclosure with no specific instructions on the design of the SSOs, do not enable one with ordinary skills in the art to obtain an oligonucleotide comprising complementary sequences to SEQ ID NOs: 1 to 5, that is capable of modulating the splicing of NEDD4L pre-mRNA in a MDA-MB-231 cell.
Conclusion
The guidance present in the specification does not address the enablement issues raised in view of the state of art discussion presented above.
Therefore, in view of the quantity of experimentation necessary, the breadth of
the claims, lack of guidance in the specification, and the absence (or mislabeling) of working examples using complementary sequences and chemical modifications patterns in SSOs, for modifying splicing of a mRNA in a cell, it would require undue experimentation for one skilled in the art to practice the invention as broadly claimed.
In conclusion, Claims 156, 158-161, and 163-166 are rejected for lack of enablement under 35 U.S.C. 112(a). Claim 167 is rejected as well, since it depends upon claim 156, but does not remedy its deficiencies.
Response to Arguments
Applicant's arguments filed 10/09/2025 have been fully considered but they are not persuasive.
Applicant argues on page 13 of 25, that “To satisfy the written description
requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. As stated in MPEP § 2163 (11)(2), "[f]or some arts, there is an inverse correlation between the level of skill and knowledge in the art and the specificity of disclosure necessary to satisfy the written description requirement. Information which is well known in the art need not be described in detail in the specification. See, e.g., Hybritech, Inc. v. Monoclonal Antibodies, Inc., 802 F.2d 1367, 1379-80 (Fed. Cir. 1986)." It is well established that"[ e ]very species in a genus need not be described in order that a genus meet the written description requirement." And “Similarly, other courts have also ruled that disclosure of limited number or even one species can satisfy written description.”
In response, while Applicant names some oligonucleotides, Applicant did not disclose the enumeration in residues for each oligonucleotides named. Applicant refers to each oligonucleotide with their respective targets. See Specification, paragraph [0032]: “[0032] Figure 8 illustrate SpliceLearnTM scores and corresponding eCLIP peaks around the NEDD4L exon trio. The scores can be used for designing oligo sequences and the bottom panel shows the splice switching experimental results in which the high scoring ASOs (GTGGGTTTCAGGGA TTCTGA (SEQ ID NO: 1), CCCTGA TTCAGACAGCAGGG (SEQ ID NO:2) significantly switched to the inclusion isoform in MDA-MB-231cells.” Therefore, from the examples, it is not clear what the structure of each SSO really is. As claimed, the oligonucleotides comprise the complementary sequence of any SEQ ID Number disclosed, which does not limit to a size of 20 nucleotides. As claimed, each oligonucleotide can range in size from 20 nucleotides to 50 nucleotides.
Applicant also argues on pages 16-17 of 25: “The state of the art at the time the present application further supports the adequacy of the written description provided by the present specification. In making the rejection, the Office cites to Itani et al. as teaching that splicing patterns ofNEDD4L were known in the art; Shen et al. as
teaching targeting and modification strategies for ASOs based on various applications; and Havens et al. as teaching the function of SSOs and design strategies for achieving this function. Despite citing these references, the Office makes no conclusions on the state of the art for antisense oligonucleotides. Indeed, the art cited by the Office makes clear that the knowledge of the art was well developed to demonstrate that the inventors had possession of the full scope of the claimed invention.” Applicant further states “The Office is respectfully reminded that information which is well known in the art need not be described in detail in the specification”, and “The knowledge of the person of ordinary skill in the art at the time the present application was filed was sufficient to support that the amended claims had adequate written description in the specification”.
In response, the references were cited to demonstrate the different options in compositions used in the art and a certain level of unpredictability. Itani shows that there are multiple isoforms, therefore, SSOs’ structures need to be clearly identified not to disrupt other isoforms present in the cell. Shen teaches that testing multiple ASOs is necessary to obtain effective steric blocking, introducing the notion of uncertainty in the method. Shen also teaches that RNA-DNA hybrids can recruits RNAse H , which is counterproductive in designing an SSO, therefore, the structure, if hybrid, such as a gapmer, needs to be “protected” sufficiently via chemical modification. Shen teaches in Figure 6 examples of oligonucleotides that are either approved by FDA or in clinical trials. For each oligonucleotide presented, a clear structure is given, together with chemical modifications, so that the one with ordinary skills in the art can either reproduce the oligonucleotides or avoid using similar oligonucleotides. Havens teaches that certain SSOs can induce exon inclusion or exon skipping depending on design and RNA secondary structure. In other words, it all depends, and results may vary.
Applicant does not provide specification on nucleotide sequence, structure and chemical modification in any of the named SSOs.
Applicant also argues on page 22 of 25, section F “The amount of
direction provided by the inventor”: “Without agreeing with the Office's assertion, Applicant respectfully reminds the Office that enablement only needs to be established across the scope of the claims. Amended claim 156 recites an ASO comprising a sequence complementary to a sequence selected from the group consisting of SEQ ID NOs: 1-5, wherein the antisense oligonucleotide comprises one or more chemical modifications and wherein the antisense oligonucleotide is capable of modulating splicing ofNEDD4L mRNA in an MDA-MB-231 cell.” And “Furthermore, without agreeing with the Office's remaining comments, the need for experimentation envisioned by the Office's remaining comments (i.e., the alleged need to test different chemical modifications and different cell types) amount to nothing more than routine experimentation using methods and compositions well known to the person of ordinary skill in the art.”
In response, the current state of the art shows that mutagenesis using SSOs is unpredictable even using routine experimentation. The amount of experimentation needed, creating an undue burden, is the basis for the rejection under 35 U.S.C. 112(a)- Lack of Enablement.
In conclusion, Applicant claims a composition without revealing any structure in said composition, only the intended targeted gene sequence. One with ordinary skills in the art, given the claim’s language, would not be able to replicate the invention without “guess work” and an unreasonable amount of experimentation.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636