DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Applications, Amendments and/or Claims
The art unit designation for correspondence to this Office Action has changed to 1681.
This action is written in response to applicant's correspondence(s) submitted on 01/15/2025. In the paper of 01/15/2025, Applicant amended claim 48 and canceled claims 49-51 leaving claims 48 and 52-57 pending and under review.
Response to Arguments
Withdrawn and/or Moot Rejections
The rejection of claims 48 and 54 under 35 U.S.C. 101 because the claimed inventions are directed to a judicial exception without significantly more, is withdrawn based on amendments made to claim 48.
The rejection of claims 49-51 under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception without significantly more is moot based on the cancellations of these claims.
The rejection of claims 48 and 54 under 35 U.S.C. 102(a)(1) as being anticipated by Turner et al. (2009, The Journal of infectious diseases, 200(4), pp.555-563) is withdrawn based on amendments made to claim 48.
The rejection of claims 49-50 under 35 U.S.C. 102(a)(1) as being anticipated by Turner et al. (2009, The Journal of infectious diseases, 200(4), pp.555-563) is moot based on the cancellations of these claims.
The rejection of claim 51 under 35 U.S.C. 103 as being unpatentable over Turner et al. (2009, The Journal of infectious diseases, 200(4), pp.555-563) in view of Cohen et al. (Epub May 13, 2015, J Clin Microbiol. 53(7):2258-61), Zhang et al. (US2013/0330777, pub. Dec 12, 2013) and Maples et al. (US2009/0017453) is moot based on the cancellation of this claim.
The rejection of claims 52-53 and 57 under 35 U.S.C. 103 as being unpatentable over Turner et al. (2009, The Journal of infectious diseases, 200(4), pp.555-563) in view of Cohen et al. (Epub May 13, 2015, J Clin Microbiol. 53(7):2258-61), Zhang et al. (US2013/0330777, pub. Dec 12, 2013) and Maples et al. (US2009/0017453) is withdrawn based on amendments made to claim 48.
The rejection of claims 55-56 under 35 U.S.C. 103 as being unpatentable over Turner et al. (2009, The Journal of infectious diseases, 200(4), pp.555-563) in view of Cohen et al. (Epub May 13, 2015, J Clin Microbiol. 53(7):2258-61), Zhang et al. (US2013/0330777, pub. Dec 12, 2013) and Maples et al. (US2009/0017453) as applied to claims 48-51, 54 and 57 above, further in view of Schroeder et al. (US2003/0211483) and/or Becker et al. (2000, U.S. 6,130,038) is withdrawn based on amendments made to claim 48.
The rejections of claims 49-51 on the ground of nonstatutory double patenting as being unpatentable over claims 1-42 of U.S. Patent No. 10,329,601 are moot based on the cancellation of these claims.
The rejections of claims 49-51 on the ground of nonstatutory double patenting as being unpatentable over claims 1-25 of U.S. Patent No. 11,186,864 are moot based on the cancellation of these claims.
The rejection of claims 48 and 52-57 on the ground of nonstatutory double patenting as being unpatentable over claims 1-25 of U.S. Patent No. 11,186,864 is withdrawn in view of the amendments made to claim 48.
The rejection of claim 48 and 52-57 on the ground of nonstatutory double patenting as being unpatentable over claims 1-42 of U.S. Patent No. 10,329,601 is withdrawn in view of the amendments made to claim 48. A new rejection was necessitated by claim amendments. To address the rejection, Applicant remarks simply states that Applicant will consider amending claims or filing a terminal disclaimer should claims in this Application be deemed allowable (Remarks of 01/15/2025, pg 9, section 1.4).
Arguments
Applicant's arguments filed 01/15/2025 have been fully considered but they are not persuasive as follows.
Applicant argues that the amended claim 48 newly recites the sequences from Table 1 below.
Table 1:
PNG
media_image1.png
205
543
media_image1.png
Greyscale
Applicant argues that the primers of Table 1 function together to amplify a specific target sequence in a detection assay and the function of a pair of primers in combination with a labeled probe that detects in the detection assay are not observed in nature.
Applicant further argues that “while these nucleic acids (i.e. recited sequences) may exploit the same properties of a naturally-occurring sequence, their different utility certainly represents a new "application" of the naturally- occurring sequences that qualify as an "invention" under § 101”.
These arguments were considered and not found to be persuasive since combinations/compositions comprising various nucleic acids, where each nucleic acid in the composition resemble a naturally occurring nucleic acid/nucleotide sequence, without being significantly more, are not patent eligible under 35 U.S.C § 101.
However, because of the recitation of sequences (SEQ ID NOS: 1,2,3 8,9) in claim 48, the rejection of claims 48 and 54 under 35 U.S.C § 101 is hereby withdrawn as the Office did not find any naturally occurring nucleotide sequence that is at least 80%, 85% or 95% identical to the full length SEQ ID NO: 1, or any naturally occurring nucleotide sequence that is at least 80%, 85% or 95% identical to the full length SEQ ID NO: 8; or any naturally occurring nucleotide sequence that is at least 80%, 85% or 95% identical to the full length SEQ ID NO: 2, or any naturally occurring nucleotide sequence that is at least 80%, 85% or 95% identical to the full length SEQ ID NO: 9.
Specifically, the 33 bp instant SEQ ID NO: 1 comprises at nucleotides 18-33 comprise a nucleotide sequence that is 100% identical to nucleotides 2611-2626 of GenBank Accession No. EU730694.1.
The 33 bp instant SEQ ID NO: 8 comprises at nucleotides 18-33 comprise a nucleotide sequence that is 100% identical to nucleotides 2611-2626 of GenBank Accession No. EU730694.1.
The nucleotides at nucleotides 18-33 of SEQ ID NO: 1, or 8 are construed as the template recognition sequence(s) of the instant SEQ ID NO: 1, and 8.
The 33 bp instant SEQ ID NO: 2 comprises at nucleotides 21-33 comprise a nucleotide sequence that is 100% identical to nucleotides 2650-2638 of GenBank Accession No. EU730694.1.
The 33 bp instant SEQ ID NO: 9 comprises at nucleotides 18-33 comprise a nucleotide sequence that is 100% identical to nucleotides 2654-2639 of GenBank Accession No. EU730694.1.
The nucleotides at nucleotides 21-33 of SEQ ID NO: 2, or at nucleotides 21-33 of the SEQ ID NO: 9 are construed as the template recognition sequence(s) of the instant SEQ ID NO: 2, and 9.
The 29 bp instant SEQ ID NO: 3 comprises at nucleotides 10-29 comprise a nucleotide sequence that is 100% identical to nucleotides 2643-2624 of GenBank Accession No. EU730694.1.
SEQ ID NOS: 1, 2, 8 and 9 each comprise a 5’ sequence that comprises a nicking enzyme binding site and a nicking site upstream of the template recognition region and a stabilizing region upstream of the nicking site (see also the illustration within the section entitled “Claim Interpretation” below). The nicking enzymes are selected from Nt.BspQI, Nb.BbvCi, Nb.BsmI, Nb.BsrDI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BstNBI, Nt.CviPII, Nb.Bpu10I, Nt.Bpu10I, and N.SBspD61.
The rejection under 35 U.S.C. 103 citing one or more of Turner et al. (2009, The Journal of infectious diseases, 200(4), pp.555-563), Cohen et al. (Epub May 13, 2015, J Clin Microbiol. 53(7):2258-61), Zhang et al. (US2013/0330777, pub. Dec 12, 2013), Maples et al. (US2009/0017453), Schroeder et al. (US2003/0211483) and/or Becker et al. (2000, U.S. 6,130,038) is withdrawn since Applicant arguments that claim 48 is unobvious over the teachings of these references was found to be persuasive.
The Office agrees that one or more of these reference(s) do not teach/make obvious the instant composition comprising a sequence that is at least 80%, 85% or 95% identical to one of SEQ ID NO: 1 or 8; and a sequence that is at least 80%, 85% or 95% identical to one of SEQ ID NO: 2, or 9; and a labeled probe comprising a sequence that is at least 80%, 85% or 95% identical to SEQ ID NO: 3).
The Office further notes that the instant composition of claim 48 is not different in structure/scope from the composition of claim 3 or claim 23 of U.S. Patent No. 10,329,601.
Claim Interpretation
Prior to analysis of the art, the claims must be construed. As noted in MPEP 2111, citing Phillips v. AWH Corp., 415 F.3d l303, 75 USPQ2d l321 (Fed. Cir. 2005), "During patent examination, the pending claims must be 'given their broadest reasonable interpretation consistent with the specification.' ".
Claims 49 and 50 are directed to a forward template and a reverse template respectively, each of the template(s) comprises a nicking enzyme binding site and a nicking site upstream of the template recognition region; and comprises a stabilizing region upstream of the nicking site.
PNG
media_image2.png
563
964
media_image2.png
Greyscale
The illustration directly above shows a double strand comprising a top target strand, i.e. a Streptococcus pyogenes (S. pyogenes) cell envelope proteinase A (cepA) target gene hybridized thereto a forward template as the bottom strand, said forward template having template recognition region at its 3’ end and a nicking enzyme recognition site, said forward template further comprising at its 5’ end, an stabilizing tail region, said stabilizing tail region being upstream of the nicking site.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on pages 25 and 27. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 48 and 52-57 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 3, 23 and 36 of U.S. Patent No. 10,329,601 and further in view of Maples et al. (US2009/0017453: previously cited), Schroeder et al. (US2003/0211483: previously cited) and/or Becker et al. (2000, U.S. 6,130,038: previously cited).
Although the claims are not identical, they are not patentably distinct from each other.
Both the instant claim 48 and the claims 3, 23 and 36 of U.S. Patent 10,329,601 require a composition(s) comprising:
(i) a forward template comprising a nucleic acid sequence comprising a recognition region at the 3' end that is complementary to the 3' end of the Streptococcus pyogenes (S. pyogenes) cell envelope proteinase A (cepA) gene antisense strand, a nicking enzyme binding site and a nicking site upstream of said recognition region and a stabilizing region upstream of said nicking site, the forward template comprising a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO: 1 (AGACTCCATATGGAGTCTAGCCAAACAGGAACA), or a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO: 8 (AGACTCCACACGGAGTCTAGCCAAACAGGAACA);
(ii) a reverse template comprising a nucleic acid sequence comprising a recognition region at the 3' end that is complementary to the 3' end of the Streptococcus pyogenes (S. pyogenes) cell envelope proteinase A (cepA) gene sense strand, a nicking enzyme binding site and a nicking site upstream of said recognition region and a stabilizing region upstream of said nicking site, the reverse template comprising a nucleotide sequence having at least 80, 85 or 95% identity to SEQ ID NO: 2 (CGACTCCATATGGAGTCGAAAGCAATCTGAGGA), or a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO: 9 (GGACTCCACACGGAGTCCGCCAGCAATCUGAGG);
the composition further comprising a probe oligonucleotide comprising a nucleotide sequence having at least 80, 85, or 95% identity to SEQ ID NO: 3.
While claims 3, 23 or 36 of U.S. Patent 10,329,601 do not recite the probe oligonucleotide comprising SEQ ID NO: 3 as a labeled probe, any one or more nucleotides of SEQ ID NO: 3, or any element comprised within the probe oligonucleotide may provide a label function. Accordingly, the compositions of claims 3, 23, or 36 of U.S. Patent 10,329,601 appear to resemble the instant claim 48.
It is noted herein that the compositions of claims 3 and 23 of U.S. Patent 10,329,601 ANTICIPATE the composition(s) of the instant claim 48 as the patented claims 3 and 23 recite a composition that has the same scope/structure as claim 48.
The compositions of claims 3, 23 and 36 of U.S. Patent No. 10,329,601 are not distinguishable over the composition of claim 48.
Maples et al. (US2009/0017453), claims 52-54, 57
Regarding claim 52, Maples et al. teach a composition comprising one or more of a DNA polymerase, one or more nicking enzymes, dNTPs or a mixture of dNTPs and ddNTPs (para [0109], [0114], table 3, para [0140]).
Maples et al. teach the DNA polymerase of the composition is selected from the group consisting of Geobacillus bogazici DNA polymerase, Bst (large fragment), exo- DNA Polymerase, Manta 1.0 DNA Polymerase (para [0016]).
Maples et al. teach one or more nicking enzymes of the composition are selected from the group consisting of Nt.BspQl, Nb.BbvCi, Nb.BsmI, Nb.BsrDI, Nb.BtsI, Nt.AlwI, Nt.BbvCI, Nt.BstNB1, Nt.CviPll, Nb.Bpu 101, Nt.Bpul0I and N.BspD61 (para [0017], para [0104] and claim 74).
Regarding claim 53, Maples et al. teach a composition wherein the composition is lyophilized (para [0139]-[0140]).
Regarding claim 54, Maples et al. teach a composition wherein the forward template and/or the reverse template comprises one or more modified nucleotides, spacers, or blocking groups (para [0023], [0029], para [0106], [0140]).
Regarding claim 57, Maples et al. teach the forward template and/or the reverse template comprises a phosphorothioate (para [0023], [0106]).
Schroeder et al. (US2003/0211483: previously cited) and/or Becker et al. (2000, US 6,130,038: previously cited); claims 55-56
Schroeder et al. (claims 55-56)
Regarding claims 55-56, Schroeder et al. particularly teach 2’-O-methyl modified nucleotide (para [0066], [0189], [0254]) are enzymatically non-extendable nucleobases (para [0008], [0044], [0066]).
Becker et al. (claims 55-56)
Regarding claims 55-56, Becker et al. teach an advantage of 2'-O-methyl modified oligonucleotides relates to their ability for preferential hybridization to RNA over DNA. This ability makes 2' –O-methyl modified oligonucleotides useful as RNA probes for specific detection of RNA target sequences (col 11, In 28-46). Becker et al. teach including 2'-O-methyl substitutions, result in the oligonucleotide having an increased affinity and increased hybridization rate to RNA targets but little effect on DNA affinity or rate of formation of probe:DNA hybrids.
It would have been obvious to a person of ordinary skill in the art before the effective filing date of the invention to further modify the S. pyogenes detection composition of claims 3, 23 or 36 of U.S. Patent 10,329,601 by providing the additional reagents taught by Maples et al., (such as DNA polymerase, a nicking enzyme, and dNTPs, or a mixture of dNTPs and ddNTP) so as to make the composition suitable for use in a nicking enzyme amplification (NEAR) method.
The ordinary skilled artisan would have been motivated to lyophilize the S. pyogenes detection composition of claims 3, 23 or 36 of U.S. Patent 10,329,601 in a manner as taught by Maples et al. as lyophilization was already used to increase shelf-life of nucleic acids, and/or allows for short or long-term storage of the nucleic acids.
The ordinary skilled artisan would have been further motivated to modify the instant forward and reverse templates to comprise a modified nucleotide such as a 2'-O- methyl modification, or a phosphorothioate in view of the teachings of Maples et al. and/or Becker et al. and/or Schoreder et al.
Maples et al. teach use of phosphorothioate modification as a blocking group to protect a modified template from cleavage by a restriction enzyme, thereby Maples et al. teaches use of blocking group to encourage nicking rather than double strand cleavage (para [0106], US2009/0017453).
Becker et al. and/or Schoreder et al. particularly teach that a 2’O-methyl modification provides nucleobase that is enzymatically non-extendable or having a preferential hybridization to RNA over DNA.
In view of the combined teachings and suggestions of all of the cited prior art references, the instant claims 48 and 52-57 are prima facie obvious.
Conclusion
No claims are currently allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to OLAYINKA A OYEYEMI whose telephone number is (571)270-5956. The examiner can normally be reached Monday -Thursday: 9:00 am - 5:00 pm, EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, GARY Benzion can be reached on 571-272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
OLAYINKA A. OYEYEMI
Examiner
Art Unit 1681
/OLAYINKA A OYEYEMI/Examiner, Art Unit 1681
/STEPHANIE K MUMMERT/Primary Examiner, Art Unit 1681