DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on December 19, 2025 has been entered.
Application Status and Withdrawn Rejections
Applicant’s amendments filed December 19, 2025, amending claims 1, 8, 11, 17, 21, 34-36 and 78-79, and canceling claim 175 is acknowledged. Claims 1, 7-11, 17, 21, 34-37, 67-68, 78-79, 82, 85, 174, and 176 are pending and under examination.
The amendment to claim 1 requiring a type V CRISPR-Cas effector and orientations of the extended guide RNA and cleaved target DNA overcomes all prior art rejections and nonstatutory double patenting rejections (NSDP) of record. None of the previously cited references teach a type V CRISPR effectors with the Brex27 protein. Additionally, the NSDP rejection over application 18/423378 is withdrawn in view of the examined claims limited to type V Cas effectors. The amendments overcome the §112(b) rejections.
Any other rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Terminal Disclaimer
The terminal disclaimers filed on December 19, 2025 disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of US Patents 11,926,834 has been approved.
Priority
As indicated in the previous office action, the disclosure of the prior-filed application, Application Nos. 63/110386 fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) for one or more claims of this application. The provisional application fails to provide support for the claims under examination, since there is no disclosure therein of the Brex27 protein or any ssDNA binding proteins fused to the Cas effector. The first evidence of support of Brex27 fused to a Cas protein is November 5, 2021, the date the examined application was filed. As such, the effective filing date for all claims November 5, 2021.
Response to Arguments - Priority
Applicant disagrees with Examiner’s evaluation of the Priority Date and attests that the 63/110386 provisional application provides support for the claimed invention (Remarks page 6, ¶4). This argument has been fully considered but is not persuasive because Applicant does not cite to any page or figure of the ‘386 provisional application to support their assertion. A thorough review of the ‘386 application found no recitation of Brex27 in the claims, specification or figures.
Claim Rejections - 35 USC § 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 174 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Claim 174 recites “The method of claim 1, wherein the method comprises contacting the target nucleic acid with the Type V CRISPR-Cas effector protein fused to theBrex27 peptide.” Claim 1 was amended to require “contacting the target nucleic acid with (a) a Type V CRISPR-Cas effector protein fused to a Brex27 peptide”. As such, it does not appear that claim 174 further limits claim 1.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 17 and 35 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 17 recites “The method of claim 1, wherein the extended guide nucleic acid further comprises… an extended portion comprising a primer binding site and a ….”. Claim 1 was amended to already require primer binding site. It is not clear then if claim 17 requires one or two primer binding sites.
If Applicant intends there to be at minimum one primer binding site, the following claim language is suggested: “The method of claim 1, wherein the PBS length is about 20 nucleotides to about 80 nucleotides, and wherein the extended guide nucleic acid further comprises (i)…” and then delete “a primer binding site” from element (ii).
Claim 35 recites “The method of claim 21, wherein the type V CRISPR-Cas fusion protein is fused at its N-terminus to an RT and a chromatin modulating peptide is fused to the N-terminus of the RT”. Claim 21 no longer recites “a fusion protein”, but claim 1 recites a type V CRISRP-Cas fused to a Brex27 peptide. The CRISPR-Cas-Brex27 fusion is interpreted as “the fusion protein”. Claim 21 requires that the RT is fused to a component that recruits the RT to the CRISPR Cas protein. Thus, claim 21 does not appear to encompass an RT fused to the Cas effector. However, claim 37 seems to require a CMP-RT-Cas fusion protein. It is confusing how the RT fusion could also comprise a Cas-recruitment domain when the RT is already physically fused to (i.e., already recruited to) the Cas effector.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 7, 9, 17, 78-79, 174 and 176 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021) in view of Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021, of record) and Xu (US 20210301272 A1, published September 30, 2021; of record). This is a new rejection.
The Scott reference claims priority to four provisional applications, three of which were filed before November 5, 2021, the effective filing date of presently examined claimed invention. The point citations below are fully supported in the three provisional applications filed before November 5, 2021.
Regarding claims 1, 174 and 176, Scott teaches methods for editing (i.e., modifying) a target nucleic acid using Cas12i2, a type V CRISPR polypeptide (Abstract; FIGs 12A-B and 13). Regarding (a) and (b), Scott teaches contacting mammalian cells with nucleic acids encoding Cas12i2 fused to a reverse transcriptase (RT) domain (FIGs 12-13; [0475]). Scott teaches Cas12i2 cleaves both strands of the target nucleic acid (FIG 12). Scott teaches the Cas12i2-RT fusion used in FIGs 12-13 was an “active nuclease” with SEQ ID NO 25 ([0475]), which comprises the Cas12i2 (H485A) variant fused to an MMLV RT domain (Table 7). Scott teaches the H485A substitution lacks crRNA processing activity ([0129]). Based on Scott’s description Cas12i2 as “active”, Scott’s teaching that the H485A substitution affects crRNA processing, and no evidence in Scott or the prior art that the H485A substitution affects DNA nuclease activity, Scott’s Cas12i2-RT fusion used in the mammalian editing methods ([0474]-[0480]) is interpreted as a Type V CRISPR-Cas effector fused to an RT domain, wherein CRISPR-Cas effector is a double stranded nuclease that cuts both strands of the target nucleic acid resulting in a double stranded break. Regarding (c), Scott teaches contacting the cells with an editing template RNA comprising 1) a 5’ hairpin and spacer sequence that hybridizes to the target DNA (i.e., a guide nucleic acid) and 2) an RT donor RNA (i.e., an extension sequence) that comprises an edit sequence and a primer binding site (PBS) (FIG 12A-B, Fig 19B, [0031], [0476]). Scott teaches that the DNA strand that the crRNA binds to (i.e., the target strand) is also the strand that hybridizes to the primer binding sequence after cleavage (FIG. 12; FIG 19B, [0059]).
Scott does not teach a Brex27 peptide.
Song teaches methods using prime editors (Abstract). Song teaches that the efficiency of the prime editor PE2 is often inefficient (Abstract). Song teaches a fusion protein comprising the type II CRISPR-Cas effector Cas9, the Rad51 DBD, and RT (Figure 1). Song teaches the Rad51 DBD is derived from human Rad51 (i.e., is hRad51) (page 6, ¶4). Song teaches Rad51 DBD fused to the N-terminus of Cas9 or to the C-terminus of Cas9 (Fig 1). Song teaches the editing efficiencies of the C-terminal Cas9-DBD fusion prime editor are improved over a Cas9 prime editor without the Rad51 DBD domain (Fig 1b). Song teaches the nucleic acid sequence encoding the Rad51 DBD domain is 339 base pairs in length (Supplemental note).
Xu teaches fusions between Cas9 and BE27 (i.e., Brex27, BRCA2 exon 27) ([0285]; Fig 13). Xu teaches that BE27 functions to recruit Rad51 to the site of Cas9 editing ([0283]). Xu teaches fusing BE27 to Cas9 increases the efficiency of target insertion and decreases indels ([0286]; Figs 8, 10A). Xu teaches BE27 can also be fused to Cpf1 (i.e., Cas12a) ([0167]). Xu teaches that BE27 is only 36 amino acids in length, requiring only 108 bp coding sequence ([0284]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included Xu’s Brex27 Rad51-recruiting domain fused to the C-terminus of Cas12i2 in the Type V Prime Editor of Scott. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Brex27 could be fused to Scott’s Cas12i2-RT fusion because Song demonstrates a Rad51 domain fusion to a Cas9-based prime editor and Xu teaches Brex27 can be fused to the Type V Cas, Cpf1. The skilled artisan would have been motivated to do so because Song teaches that recruiting Rad51 to the site of prime editing increases prime editing efficiency of most intended targets, which would predictably also result from fusing Brex27 since Brex27 recruits Rad51 to the site of genome editing. One would have been motivated to fuse Brex27 to Scott’s Cas12i2-RT prime editor instead of Rad51 because the Brex27 domain coding sequence is less than a third of the size of Rad51, which will facilitate cloning and downstream delivery to cells for genome target modification.
Regarding claims 7 and 9, Scott teaches the guide RNA with the RT donor RNA extension also comprises additional protection elements including hairpins and pseudoknots (i.e., a structured RNA motif) ([0203], FIG. 12A-B).
Regarding claim 17, Scott also teaches that the primer binding site of the RT donor DNA is about 30 nucleotides in length and about 80 nucleotides in length ([0185]). Scott teaches the edit sequence (i.e., the RTT sequence) is about 50 nucleotides ([0190]). Scott teaches that the Type V nuclease can be one that requires a tracrRNA ([0070]) and accordingly the editing template RNA can comprise a tracrRNA component ([0156]). Scott provides examples of Cas12b Type V Cas effectors, which are known in the art to require tracrRNAs ([0102]-[0103]). Scott does not teach in the working example a type V CRISPR Cas effector that requires a tracrRNA.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the Cas12i2 effector in the Cas12i2-RT-Brex27 fusion rendered obvious above for Cas12b and included the known required Cas12b tracrRNA element. It would have amounted to the simple substitution on one known Cas12 enzyme for another and incorporation of a known tracrRNA sequence by known means to yield predictable results. The skilled artisan would have been motivated to do so with a reasonable expectation of success because Scott suggests that other Type V Cas effectors, like Cas12b can be used, and that the necessary tracrRNA sequence can be included in the extended guide RNA.
Regarding claim 78, Xu teaches fusing Brex27 to the C-terminus of Cas9 (Fig 13A). Song teaches fusing Rad51 to the C-terminus of the prime editor.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have specifically fused the Brex27 peptide to the C-terminus of the Cas12i2-RT fusion because Song and Xu teach the C-terminus is an effective site of fusion for peptides that help stabilize/recruit ssDNA.
Regarding claim 79, Song teaches the N-terminal Cas9 fusion to Rad51 were lower for some targets, but higher for other targets compared to prime editors without the ssDNA binding domain (Fig 1C).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included Xu’s Brex27 fused to the N-terminus of Cas12i2 in Scott’s Cas12i2 prime editor. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Brex27 could be fused to the N-terminus because Song demonstrates fusion of a different small protein to a different prime editor. The skilled artisan would have been motivated to do so because Song teaches such a fusion increased prime editing efficiency of two of the target loci. Additionally, rearrangement of parts is prima facie obvious that the court has held normally require only ordinary skill in the art and hence are considered routine expedients. See MPEP 2144.04.VI.C.
Claims 8, 10, 21 and 67-68 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021; of record) and Xu (US 20210301272 A1, published September 30, 2021; of record), as applied to claims 1, 7, 9, 17, 78-79, 174 and 176 above, and further in view of Liu (US 20230357766 A1, effectively filed at least as early as September 24, 2021; of record). This is a new rejection.
The teachings of Scott, Song and Xu are recited above and applied as for claims 1, 7, 9, 17, 78-79, 174 and 176. Scott also teaches the structured region can comprise a sequence called “preQ” ([0203]). Scott also teaches the extended guide RNA can comprise the RNA bacteriophage MS2 sequence ([0203]). Scott teaches protein fusions can be at the N-terminus, the C-terminus or at an intramolecular position ([0144]).
Scott, Song and Xu do not teach a structure sequence with SEQ ID NO: 191. Scott, Song and Xu do not teach recruiting the RT domain to the site of the CRISPR nuclease using an additional component.
Regarding claims 8 and 10, Liu teaches methods of editing a genome using a prime editor complexed with modified prime editing guide RNAs (pegRNAs, i.e., extended guide nucleic acid) (Abstract). Liu teaches Cas9-RT fusions in a complex with pegRNAs (Fig 10). Liu also teaches hRad51-Cas9 fusions ([1655]). Liu teaches “Next-generation pegRNA modification for improving prime editing efficiency” (Example 3, [1364]-[1379]). Liu teaches pegRNAs comprising the evopreQ1 (i.e., a pseudoknot) at its 3’ end ([1370], FIG 106). Liu teaches the sequence of evoPreQ is SEQ ID NO 215 ([0017] and Table 6). Liu’s SEQ ID NO 215 is 100% identical to SEQ ID NO 191 of the current application as shown below:
Liu SEQ 215: TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA
App SEQ 191: TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACUAGAAA
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have specifically used Liu’s evoPreQ having a sequence that is 100% identical to SEQ ID NO 191 of present application as the structured RNA component in Scott’s extended guide RNA. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have been motivated to do so with a reasonable expectation of success because 1) Scott suggests that the structured region is a preQ sequence and 2) Liu demonstrates successfully appending the evoPreQ sequence onto a prime editing RNA.
Regarding claims 21 and 67-68, Liu also teaches pegRNAs comprising an MS2 hairpin at the 3’ end (FIG. 135, [1437]). Liu teaches the prime editor fused to the MS2 coat protein which binds to the MS2 RNA sequence (i.e., wherein the reverse transcriptase is fused to one or more ssRBDs; wherein the reverse transcriptase fusion protein and/or extended guide nucleic acid is fused to one or more components that recruit the reverse transcriptase to the CRISPR-Cas effector protein) (FIG. 135). Liu teaches the fusion protein may comprise any suitable structural configuration including 1) the fusion of the C-terminus of a Cas effector to the N-terminus or C-terminus of an RT ([0607]). Liu teaches that using the MS2-MCP system with the prime editor increases the recruitment of the RT with the pegRNA ([1437]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have additionally modified Scott’s prime editing method by including an MS2 sequence in Scott’s extended guide RNAs and fused the MS2-binding domain MCP to the reverse transcriptase instead of fusing the RT to Cas12i2. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have been predicted that the RT can be fused to MCP and the guide RNA could include an MS2 sequence with a reasonable expectation of success because 1) Scott suggests that the guide RNAs can include an MS2 sequence, which are well known to function in recruiting proteins to the Cas/guide RNA complex, and 2) Liu demonstrates the MS2-MCP-RT recruitment system in a different prime editing system. The skilled artisan would have been motivated to have done so because Liu teaches using the MS2-MCP recruitment system for the RT increases the recruitment without the need for producing a large Cas-RT fusion. Regarding the specific placement of the MCP in the MCP-RT fusion, the skilled artisan would have predicted that the ssRBD -RT fusion could be used because both Liu and Scott make clear that protein fusions can be in either orientation. Additionally, rearrangement of parts is prima facie obvious that the court has held normally require only ordinary skill in the art and hence are considered routine expedients. See MPEP 2144.04.VI.C.
Claims 34-37 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021, of record), Xu (US 20210301272 A1, published September 30, 2021; of record), and Liu (US 20230357766 A1, effectively filed at least as early as September 24, 2021; of record) as applied to claims 1, 7-10, 17, 21, 67-68, 78-79, 174 and 176 above, and further in view of Kim (US 20240218358 A1, priority to KR patent application 10-202-0123432, filed September 24, 2020; of record). This is a new rejection.
Claim 35 is indefinite for the reasons described above in paragraph 17. For the purpose of compact prosecution, claim 35 is interpreted as requiring a N-terminal CMP fusion to the Cas effector such that the RT still requires the recruitment domain and not directly fused to the Cas effector.
The teachings of Scott, Song, Xu and Liu are recited above and applied as for claims 1, 7-10, 17, 21, 67-68, 78-79, 174 and 176.
Scott, Song, Xu and Liu do not teach a chromatin modulating peptide (CMP) fused to the Cas12i2 protein.
Kim teaches prime editing-based gene editing composition with enhanced editing efficiency (Abstract). Kim teaches a Prime editor comprising a Cas9 protein fused to an RT and additionally fused to HN1 and H1G, which are chromatin modulating peptides (CMPs) (FIG 4A, [0045]). Kim teaches the HN1 fused to the N-terminus of the Cas9 protein (FIG. 4A). Kim teaches the sequence of the HN1 fused to the N-terminus of Cas9 (FIG 4B, underlined), which is 100% identical to SEQ ID NO 202 of the current application. Kim teaches that including the HN1 domain in the prime editor increased prime editing efficiency of the prime editor (FIG 4D, [0122]). Kim teaches the CRISPR Cas should be an enzyme which has the function of a nuclease ([0071]).
Regarding claims 34-37, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have further included the HN1 peptide fused to the N-terminus of the Cas12i2-Brex27 rendered obvious above to create an HN1-Cas12i2-Brex27. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that HN1 could be fused to the Cas12i2-Brex27 fusion protein because Kim demonstrates fusion of HN1 to a prime editor using a different CRISPR Cas nuclease. The skilled artisan would have been motivated to do so because Kim teaches it increased prime editing efficiency of the intended target.
Claims 82 and 85 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021; of record) and Xu (US 20210301272 A1, published September 30, 2021; of record), as applied to claims 1, 7, 9, 17, 78-79, 174 and 176 above, and further in view of Zhang (US 20230049737 A1, priority to December 30, 2019, of record). This is a new rejection.
The teachings of Scott, Song and Xu are recited above and applied as for claims 1, 7, 9, 17, 78-79, 174 and 176 above.
Scott, Song and Xu do not teach an NHEJ inhibitor polypeptide, such as Mu Gam fused to components of the prime editor.
Zhang teaches the mechanism of prime editing, including the role of Gam (FIGs. 1, 3-5). Zhang teaches a prime editor comprises RT and Gam fused to Cas9 (Fig 6). Zhang teaches the function of Gam is to protect the linear DNA from exonuclease activity ([0059]). Zhang teaches an exemplary Gam protein is Mu Gam ([0061]). Zhang teaches Cas enzyme in the Cas-Gam fusion can be a type V Cas12 effector ([0100]).
Regarding claims 82 and 85, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the Mu Gam peptide fused to the Cas12i2-Brex27 fusion protein rendered obvious above to create a Gam-Cas12i2-Brex27. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Gam could be fused to the obvious Cas12i2-Brex27 because Zhang teaches such a fusion to a prime editor using a different Cas effector and teaches that other Cas effectors like type V Cas12 enzymes can be used. The skilled artisan would have been motivated to do so because Zhang teaches that including Gam can protect the DNA that was cleaved during prime editing from degradation via exonucleases.
Response to Arguments - §103
Applicant’s arguments with respect to the obviousness rejections of claims 1, 7-10, 17, 21, 34-37, 67-68, 78-79, 82, 85, 174 and 176 have been considered but are moot because the new ground of rejection does not rely on any reference applied in the prior rejection of record for any teaching or matter specifically challenged in the argument.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 7-10, 17, 21, 34-37, 67-68, 78-79, 82, 85, 174 and 176 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-18 of copending Application No. 18423374 in view of Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8; published September 23, 2021) and Xu (US 20210301272 A1, published September 30, 2021). Claims 7-10 are rejected in further view of Liu (US 20230357766 A1, effectively filed September 24, 2020). Claims 34-37 are rejected in further view of Kim (US 20240218358 A1, priority to KR patent application 10-202-0123432, filed September 24, 2020). Claims 82 and 85 are rejected in further view of Zhang (US 20230049737 A1, priority to December 30, 2019). This is a new rejection necessitated by amendment.
Copending claim 1 recites (a) a Type V CRISPR-Cas effector protein and/or domain that is a double stranded nuclease that is configured to bind to a first strand of a target nucleic acid and cuts the first strand and a second strand of the target nucleic acid, which results in a double stranded break in the target nucleic acid; (b) a reverse transcriptase, and (c) an extended guide nucleic acid, wherein the extended guide nucleic acid comprises: (i) a Type V CRISPR nucleic acid; and (ii) an extended portion that comprises a primer binding site and a reverse transcriptase template (RT template), wherein the primer binding site is configured to bind to the first strand of the target nucleic acid, which is the same strand to which the Type V CRISPR-Cas effector protein and/or domain is bound, wherein the extended portion of the extended guide nucleic acid is fused to either the 5’ end or the 3’ end of the type V CRISPR nucleic acid. Copending claim 2 recites wherein the primer binding site is length of about eight nucleotides to about 100 nucleotides, optionally, wherein the primer binding site is at least 45 nucleotides in length, or about 45 nucleotides to about 100 nucleotides. Copending claim 3 recites wherein the RT template is a length of about seven to about 100 nucleotides, optionally, wherein the RT template is a length of about 40 nucleotides or less. Copending claim 4 recites wherein the extended portion of the extended guide nucleic acid is linked to the Type V CRISPR nucleic acid and/or a tracrRNA via a linker, optionally wherein the linker is 1 to 100 nucleotides in length. Copending claim 14 recites wherein the RT is a fusion protein comprising reverse transcriptase domain fused to an affinity polypeptide that is capable of binding an RNA recruiting motif, optionally wherein the affinity polypeptide is the affinity polypeptide MS2 Coat Protein (MCP) (i.e., a single stranded RNA binding domain)
The copending claims do not recite Brex27 fused to the type V CRISPR-Cas effector. The copending claims to not recites methods of modifying a target nucleic acid. The copending claims do not recite when strand of cleaved DNA binds to the primer-binding site. The copending claims do not recite specific sites fusion polypeptides on the CRISPR-Cas enzyme or RT. The copending claims do not recite a structured RNA motif that is on the 3’ of the extended guide RNA, or a specific sequence or structure. The copending claims do not recite the CRISPR-Cas or the RT is fused to a chromatin modulating peptide, an ssRNA binding domain, an ssDNA binding domain, or an NHEJ inhibiting polypeptide.
Scott teaches methods for editing (i.e., modifying) a target nucleic acid using Cas12i2, a type V CRISPR polypeptides (Abstract; FIGs 12A-B and 13). Scott teaches contacting mammalian cells with nucleic acids encoding Cas12i2 fused to an RT domain (FIGs 12-13; [0475]). Scott teaches the active Cas12i2 cleaves both strands of the target nucleic acid that cuts both strands of the target nucleic acid resulting in a double stranded break (FIG 12). Scott teaches contacting the cells with an editing template RNA comprising 1) a 5’ hairpin and spacer sequence that hybridizes to the target DNA (i.e., a guide nucleic acid) and 2) an RT donor RNA (i.e., an extension sequence) that comprises an edit sequence and a primer binding site (PBS) (FIG 12A-B, Fig 19B, [0031], [0476]). Scott teaches that the DNA strand that the crRNA binds to (i.e., the target strand) is also the strand that hybridizes to the primer binding sequence (FIG. 12; FIG 19B, [0059]).
Song teaches methods using prime editors (Abstract). Song teaches that efficiency of prime editor PE2 is often inefficient (Abstract). Song teaches a fusion protein comprising the CRISPR-Cas effector Cas9, Rad51 DBD, and RT (Figure 1). Song teaches the Rad51 DBD is derived from human Rad51 (i.e., is hRad51) (page 6, ¶4). Song teaches Rad51 DBD fused to the N-terminus of Cas9 or to the C-terminus of Cas9 (Fig 1). Song teaches the editing efficiencies of the C-terminal Cas9-DBD fusion PE are improved over PE2 (Fig 1b). Song teaches the nucleic acid sequence encoding the Rad51 DBD domain is 339 base pairs in length (Supplemental note).
Xu teaches fusions between Cas9 and BE27 (i.e., Brex29, BRCA2 exon 27) ([0285]; Fig 13). Xu teaches that BE27 functions to recruit Rad51 to the site of Cas9 editing ([0283]). Xu teaches fusing BE27 to Cas9 increases the efficiency of target insertion and decreases indels ([0286]; Figs 8, 10A). Xu teaches that BE27 is only 36 amino acids in length, requiring only 108 bp coding sequence ([0284]). Xu teaches Type V proteins can also be used in the invention fused to BE27.
Regarding claims 1, 17, 21, 67-68, 78-79, 174, 176, it would have been obvious to one skilled in the art to use the copending prime editing complexes in methods of modifying a targeted nucleic acid because both Song and Xu teach using Cas effectors in methods modifying target genomic sequences, including with reverse transcriptase. The obviousness of fusing the Brex27 peptide to the copending Type V Cas-effectors, which encompass Scott’s Cas12i2-RT fusion to be used in prime editing methods is recite above in paragraph 26. It also would have been obvious to have fused the ssRBD polypeptide in the copending claims to the N-terminus of the RT because in protein fusions because there are typically only two sites for protein fusions, the N-terminus and C-terminus. Because of the limited sites available for protein-protein fusions, the skilled artisan would immediately envisage the ssRBD-RT N-terminal fusion structure. See MPEP 2131.02.III.
Regarding claims 7-10, Liu teaches methods of editing a genome using a prime editor complexed with modified pegRNAs (Abstract). Liu teaches Cas9, a CRISPR-Cas effector protein) fused to a reverse transcriptase to form a Prime Editing enzyme (Fig 1D). Liu teaches the Cas9-RT fusion contacts the target nucleic acid via a PEgRNA (i.e., an extended guide nucleic acid) (Fig 1D). Liu teaches the PEgRNA structure which includes a 3’ extension arm with an optional hairpin, stemloop, or toeloop (i.e., a structured RNA motif at the 3’ end of the extended guide nucleic acid) (Fig 3D). Liu teaches upon Cas9-RT-pegRNA binding to the target DNA, the target DNA is modified (Fig 1D). Liu teaches “Next-generation pegRNA modification for improving prime editing efficiency” (Example 3, [1364]-[1379]). Liu teaches pegRNAs comprising the evopreQ1-1 (i.e., a pseudoknot) at its 3’ end ([1370], FIG 106). Liu teaches the sequence of evoPreQ1-1 is SEQ ID NO 215 ([0017] and Table 6). SEQ ID NO 215 is 100% identical (i.e., comprises) SEQ ID NO 191 of the current application. Liu also teaches the CRISPR-Cas and guide RNAs can include Type V CRIRPS-Cas enzymes and guide RNAs ([0263], [0361], [0392]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have appended the evoPreQ1 sequence onto the type V guide RNA in the method rendered obvious above. It would have amounted to a simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that tEvoPreQ1 sequence could have been appended, and been motivated to do so, because Liu teaches the invention of using stabilizing structured motifs can be applied to type V CRISPR-Cas systems.
Regarding claims 34-37, Kim teaches prime editing-based gene editing composition with enhanced editing efficiency (Abstract). Kim teaches a Prime editor comprising a CRIPSR-Cas protein fused to an RT and additionally fused to HN1 and H1G, which are chromatin modulating peptides (CMPs) (FIG 4A, [0045]). Kim teaches the HN1 fused to the N-terminus of the CRISPR-Cas protein (FIG. 4A). Kim teaches the sequence of the HN1 fused to the N-terminus of CRISPR-Cas protein (FIG 4B, underlined), which is 100% identical to SEQ ID NO 202 of the current application. Kim teaches that including the HN1 domain to the prime editor increased prime editing efficiency of the prime editor (FIG 4D, [0122]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the HN1 peptide fused to the N-terminus or the C-terminus of the Type V Prime Editor fused to Brex27 rendered obvious above. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that HN1 could be fused to the copending Type V prime editor because Kim demonstrates fusion of HN1 to a prime editor of the related Type II CRISPR-Cas. The skilled artisan would have been motivated to do so because Kim teaches it increased prime editing efficiency of the intended target. Regarding the placement of the fusion on the N- or C-terminus, rearrangement of parts is prima facie obvious that the court has held normally require only ordinary skill in the art and hence are considered routine expedients. See MPEP 2144.04.VI.C.
Regarding claims 82 and 85, Zhang teaches the mechanism of prime editing, including the role of Gam (FIGs. 1, 3-5). Zhang teaches a prime editor comprises RT and Gam fused to a CRISPR-Cas enzyme (Fig 6). Zhang teaches the function of Gam is to protect the linear DNA from exonuclease activity ([0059]). Zhang teaches an exemplary Gam protein is Mu Gam ([0061]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the Mu Gam peptide fused to the Type V CRISPR-Cas-Brex27 rendered obvious above the copending primed editing method. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Gam could be fused to the copending Type V CRISPR-Cas because Zhang teaches such a fusion to a prime editor of the related Type II CRISPR-Cas prime editor. The skilled artisan would have been motivated to do so because Zhang teaches including Gam can protect the DNA that was cleaved during prime editing from degradation via exonucleases.
This is a provisional nonstatutory double patenting rejection.
Claims 1, 7-11, 17, 21, 34-37, 67-68, 78-79, 82, 85, 174 and 176 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 6, 12, 21, 32, 42, 60, 76, 106-107, 114, 122, 124-125, 129 and 141 of copending Application No. 18989127 in view of Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8; published September 23, 2021) and Xu (US 20210301272 A1, published September 30, 2021). Claims 34-37 are rejected in view of Kim (US 20240218358 A1, priority to KR patent application 10-202-0123432, filed September 24, 2020). Claims 82 and 85 are further rejected in view of Zhang (US 20230049737 A1, priority to December 30, 2019). This is a new rejection necessitated by amendment.
Copending claim 1 recites A method of modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with (a) a Type V CRISPR-Cas effector protein or a Type II CRISPR-Cas effector protein;(b) a reverse transcriptase; (c) an extended guide nucleic acid, wherein the extended guide nucleic acid comprises: (i) a Type V CRISPR nucleic acid or Type II CRISPR nucleic acid and/or a Type V CRISPR nucleic acid or Type II CRISPR nucleic acid and a tracr nucleic acid and (ii) an extended portion comprising a primer binding site and a reverse transcriptase template (RT template) (RTT). Copending claim 76 recites further comprising contacting the target nucleic acid with a single-stranded DNA binding protein (ssDNA binding protein), optionally wherein the ssDNA binding protein is Brex27. Copending claim 6 recites wherein the extended guide nucleic acid further comprises a structured RNA motif, optionally the structured RNA motif is AsCpf1BB (SEQ ID NO:189), BoxB (SEQ ID NO:190), pseudoknot (decoy) (SEQ ID NO:95, SEQ ID NO:203), pseudoknot (tEvoPreQ1) (SEQ ID NO:191), fmpknot (SEQ ID NO:192), mpknot (SEQ ID NO:193), MS2 (SEQ ID NO:194), PP7 (SEQ ID NO:195), SLBP (SEQ ID NO:196), TAR (SEQ ID NO:197), and/or ThermoPh (SEQ ID NO:198). Copending claim 27 recites wherein the target nucleic acid is double-stranded and comprises a first strand and a second strand and the primer binding site binds to the second strand (non-target, top strand) of the target nucleic acid, b) binds to the first strand (e.g, binds to the target strand, same strand to which the CRISPR-Cas effector protein is recruited, bottom strand) of the target nucleic acid, or (c) binds to the second strand (non-target strand, opposite strand from that to which the CRISPR-Cas effector protein is recruited) of the target nucleic acid. Copending claim 21 recites wherein the Type V CRISPR-Cas effector protein or the Type II CRISPR-Cas effector protein is a fusion protein and/or the reverse transcriptase is a fusion protein, wherein the Type V CRISPR-Cas fusion protein or Type II CRISPR-Cas fusion protein, the reverse transcriptase fusion protein and/or the extended guide nucleic acid is fused to one or more components that recruit the reverse transcriptase to the Type V CRISPR-Cas effector protein or Type II CRISPR-Cas effector protein, optionally the one or more components recruit via protein-protein interactions, protein-RNA interactions, and/or chemical interactions. Copending claim 67 recites wherein the reverse transcriptase is fused to one or more single-stranded RNA binding domains (RBDs).
Although the copending claims recite contacting a cell with components of examined claim 1, the copending claims do not recite the Brex27 protein fused to the Type V Cas effector. The copending claims do not recite specific sites fusion polypeptides on the CRISPR-Cas enzyme or RT. The copending claims do not recite the CRISPR-Cas or the RT is fused to a chromatin modulating peptide or an NHEJ inhibiting polypeptide.
Regarding claims 1, 7-11, 21, 67-68, 78-79, 174 and 176, the teachings of Scott, Song and Xu are recited above in paragraphs 57-59 and incorporated here. The obviousness of fusing the copending Brex27 peptide to the copending type V Cas effector is recited above as in paragraph 60. Additionally, one would have once envisaged 1) the polypeptide fused to the RT the copending claims fused to the N-terminus of the RT because in protein fusions and 2) Brex27 fused to the N- or C- terminus of the CRISPR-Cas enzyme because there are typically only two sites for the protein fusion, the N-terminus and C-terminus. Because of the limited sites available for protein-protein fusions, the skilled artisan would immediately envisage the ssRBD-RT N-terminal fusion structure. See MPEP 2131.02.III.
Regarding claim 17, the teachings of Liu are recited above in paragraphs 22 and 28 and incorporated here. It would have been obvious to use RTT and PBS nucleotide lengths recited in examined claim 17 because Scott demonstrates such a Cas12, type V prime editing guide structure.
Regarding claims 34-37, the teachings of Kim are recited above in paragraph 63 and incorporated here. The obviousness of having included the HN1 peptide fused to the N-terminus or the C-terminus of the copending Type V Prime Editor is recited above in paragraph 64.
Regarding claims 82 and 85, the teachings of Zhang are recited above in paragraph 65 and incorporated here. The obviousness of having included the Mu Gam peptide fused to the Type V CRISPR-Cas in the copending primed editing method is recited above in paragraph 66.
This is a provisional nonstatutory double patenting rejection.
Response to Arguments – NSDP
Applicant argues that the NSDP rejection over copending claims in Application 18/423374 and 18/989127 should be withdrawn because the combination of Liu, Song, Xu, Kim and Zhang fail to teach of suggest the claimed method (Remarks, Section V, subsections B and D). This argument has been fully considered but is not persuasive because it is directed to the withdrawn rejection. As indicated in the new rejection above, Scott teaches prime editing with Type V effectors and obviousness of including a Brex27 fusion is recited above.
Allowable Subject Matter
Claim 11 recites wherein the structured RNA comprises the nucleic acid sequence SEQ ID NO: 203, which an RNA sequence of 21 nucleotides. SEQ ID NO: 203 attached to the end of a CRISPR/Cas extended guide RNA appears free of the prior art. The Specification teaches that the sequence is derived from a known hairpin from HIV-1 (page 77) and was first described in WO 2021092130 (Table 17; cited in IDS filed 5/13/2022). The cited WIPO publication was published on May 14, 2021, six months before the effective filing date of the claimed invention. However, the WIPO publication does not name any others in addition to the inventors of this examined application. The inventive entity on the WIPO publication is identical to the inventive entity in the examined application. Therefore, the WIPO publication is not available as prior art because it is disqualified under §102(b)(1)(A). The published PCT Application and related US printed publication US 20210130835 A1 were both filed prior to November 5, 2021. However, because the PCT Application and US Application have identical inventive entities and assignees not later than November 5, 2021, both the WIPO and US patent application publications are disqualified under §102(b)(2)(A) and (C).
SEQ ID NO 203 was derived by Applicant by adding two nucleotides at the 5’ end of the previously known HIV-1 hairpin. A thorough search of the prior art could not find 1) sequences with all of SEQ ID NO:203 or 2) using the HIV-1 hairpin (i.e., SEQ ID NO 203 without the first two nucleotides) within a gene editing or CRISPR system. Although Liu teaches appending hairpins to the 3’ ends of pegRNAs, the possible structures for RNA hairpins is infinite because they can have variable stem lengths, variable loop lengths, and various number of bulges/mismatches in the stems. Thus, it would not have been obvious to specifically try SEQ ID NO 203 because there is not “a finite number of identified, predictable solutions” (MPEP 2143.I.E). Additionally, SEQ ID NO: 203 is quite short in terms of RNA hairpins – the stem is only predicted to have 6 hybridized nucleotide pairs (see office action mailed 6/9/2025, page 9). Liu teaches using a hairpin that has 15 hybridized nucleotide pairs in the stem to stabilize a guide RNA (Fig 116C). Allen teaches that when using hairpins to stabilize guide RNAs “the hairpin structures’ design must meet stringent constraints for thermodynamic stability since below a specific free energy cut-off, the nuclease activity is severely impaired.” (Allen et al., Frontiers in Genome Editing (2021), 2: 617910, pages 1-16; page 9, ¶1). Thus, it does not appear that any specific hairpin would have been obvious to append to the 3’ end of a prime editing guide RNA.
It is noted that claim 11 remains provisionally rejected for nonstatutory double patenting over copending application 18989127, which recites a hairpin with SEQ ID NO: 203.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Examiner, Art Unit 1635