DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status and Withdrawn Rejections
Applicant’s amendments filed April 15, 2026, amending claims 17 and 34-36, cancelling claim 174, and adding new claim 177 is acknowledged. Claims 1, 7-11, 17, 21, 34-37, 67-68, 78-79, 82, 85 and 176-177 are pending and under examination.
The NSDP rejection over application 18/423374 is withdrawn in view of the terminal disclaimer filed (see below). The cancelation of claim 174 renders the rejection of the claim under §112(d) moot. The amendments overcome the §112(b) rejections; however, claims 34-37 are still indefinite for the reasons below.
Any other rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow.
Terminal Disclaimer
The terminal disclaimers filed on April 15, 2026 disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of any patent granted on US Application 18/423374 have been approved. has been approved.
Priority
As indicated in previous office actions, the disclosure of the prior-filed application, Application Nos. 63/110386 fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) for one or more claims of this application. The provisional application fails to provide support for the claims under examination, since there is no disclosure therein of the Brex27 protein or any ssDNA binding proteins fused to the Cas effector. The first evidence of support of Brex27 fused to a Cas protein is November 5, 2021, the date the examined application was filed. As such, the effective filing date for all claims November 5, 2021.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 34-35 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection necessitated by amendment.
Claim 34 recites “wherein the one or more components comprise a chromatin modulating peptide, and wherein the chromatin modulating peptide is fused to… the Type V CIRSPR”. Claim 34 depends from claim 21, which recites wherein the reverse transcriptase is fused to one or more components that recruit the reverse transcriptase to the Type V CRISPR-Cas effector. Claim 34 is confusing for two reasons. First, chromatin modulating peptides (CMPs) are not known for the ability to recruit two domains to each other. So, it is not clear if the recited CMP is supposed to have the claimed recruitment function or if there is another component in the “one or more components” that is supposed to serve that function. Second, if the one or more components is fused to both the reverse transcriptase (RT) (claim 21) and to the CRISPR effector protein (claim 34) then the components wouldn’t need to function in recruitment since all the domains would already be fused to each other. As such, the arrangement of the CRISPR effector, RT, CMP and any additional recruitment component is unknown, rendering claim 34 indefinite.
Claim 35 is rejected for depending from claim 34 and not remedying the indefiniteness. Claim 35 requires a fusion protein comprising CMP-RT-Cas. However, if all the domains are fused to each other, then it is not clear where the “one or more domains” that function in recruitment of the RT and Cas effector are to be placed or whether they are required at all.
Response to Arguments - §112(b)
Applicant argues that the amendments to claim 35 overcome the §112(b) rejection (Remarks, page 6). This argument has been fully considered and is persuasive for overcoming the previous rejection for indefiniteness. However, the new combination of limitations in claims 34 and 35, which still depend from claim 21 requiring the “one or more components” to serve a recruitment function, are still confusing for the reasons stated in the rejection above.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 7, 9, 17, 78-79 and 176-177 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021) in view of Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021, of record) and Xu (US 20210301272 A1, published September 30, 2021; of record). This is a maintained rejection. It is a new rejection of new claim 177.
The Scott reference claims priority to four provisional applications, three of which were filed before November 5, 2021, the effective filing date of presently examined claimed invention. The point citations below are fully supported in the three provisional applications filed before November 5, 2021.
Regarding claims 1 and 176, Scott teaches methods for editing (i.e., modifying) a target nucleic acid using Cas12i2, a type V CRISPR polypeptide (Abstract; FIGs 12A-B and 13). Regarding (a) and (b), Scott teaches contacting mammalian cells with nucleic acids encoding Cas12i2 fused to a reverse transcriptase (RT) domain (FIGs 12-13; [0475]). Scott teaches Cas12i2 cleaves both strands of the target nucleic acid (FIG 12). Scott teaches the Cas12i2-RT fusion used in FIGs 12-13 was an “active nuclease” with SEQ ID NO 25 ([0475]), which comprises the Cas12i2 (H485A) variant fused to an MMLV RT domain (Table 7). Scott teaches the H485A substitution lacks crRNA processing activity ([0129]). Based on Scott’s description Cas12i2 as “active”, Scott’s teaching that the H485A substitution affects crRNA processing, and no evidence in Scott or the prior art that the H485A substitution affects DNA nuclease activity, Scott’s Cas12i2-RT fusion used in the mammalian editing methods ([0474]-[0480]) is interpreted as a Type V CRISPR-Cas effector fused to an RT domain, wherein CRISPR-Cas effector is a double stranded nuclease that cuts both strands of the target nucleic acid resulting in a double stranded break. Regarding (c), Scott teaches contacting the cells with an editing template RNA comprising 1) a 5’ hairpin and spacer sequence that hybridizes to the target DNA (i.e., a guide nucleic acid) and 2) an RT donor RNA (i.e., an extension sequence) that comprises an edit sequence and a primer binding site (PBS) (FIG 12A-B, Fig 19B, [0031], [0476]). Scott teaches that the DNA strand that the crRNA binds to (i.e., the target strand) is also the strand that hybridizes to the primer binding sequence after cleavage (FIG. 12; FIG 19B, [0059]).
Scott does not teach a Brex27 peptide.
Song teaches methods using prime editors (Abstract). Song teaches that the efficiency of the prime editor PE2 is often inefficient (Abstract). Song teaches a fusion protein comprising the type II CRISPR-Cas effector Cas9, the Rad51 DBD, and RT (Figure 1). Song teaches the Rad51 DBD is derived from human Rad51 (i.e., is hRad51) (page 6, ¶4). Song teaches Rad51 DBD fused to the N-terminus of Cas9 or to the C-terminus of Cas9 (Fig 1). Song teaches the editing efficiencies of the C-terminal Cas9-DBD fusion prime editor are improved over a Cas9 prime editor without the Rad51 DBD domain (Fig 1b). Song teaches the nucleic acid sequence encoding the Rad51 DBD domain is 339 base pairs in length (Supplemental note).
Xu teaches fusions between Cas9 and BE27 (i.e., Brex27, BRCA2 exon 27) ([0285]; Fig 13). Xu teaches that BE27 functions to recruit Rad51 to the site of Cas9 editing ([0283]). Xu teaches fusing BE27 to Cas9 increases the efficiency of target insertion and decreases indels ([0286]; Figs 8, 10A). Xu teaches BE27 can also be fused to Cpf1 (i.e., Cas12a) ([0167]). Xu teaches that BE27 is only 36 amino acids in length, requiring only 108 bp coding sequence ([0284]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included Xu’s Brex27 Rad51-recruiting domain fused to the C-terminus of Cas12i2 in the Type V Prime Editor of Scott. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Brex27 could be fused to Scott’s Cas12i2-RT fusion because Song demonstrates a Rad51 domain fusion to a Cas9-based prime editor and Xu teaches Brex27 can be fused to the Type V Cas, Cpf1. The skilled artisan would have been motivated to do so because Song teaches that recruiting Rad51 to the site of prime editing increases prime editing efficiency of most intended targets, which would predictably also result from fusing Brex27 since Brex27 recruits Rad51 to the site of genome editing. One would have been motivated to fuse Brex27 to Scott’s Cas12i2-RT prime editor instead of Rad51 because the Brex27 domain coding sequence is less than a third of the size of Rad51, which will facilitate cloning and downstream delivery to cells for genome target modification.
Regarding claims 7 and 9, Scott teaches the guide RNA with the RT donor RNA extension also comprises additional protection elements including hairpins and pseudoknots (i.e., a structured RNA motif) ([0203], FIG. 12A-B).
Regarding claims 17 and 177, Scott also teaches that the primer binding site of the RT donor DNA is about 30 nucleotides in length and about 80 nucleotides in length ([0185]). Scott teaches the edit sequence (i.e., the RTT sequence) is about 50 nucleotides ([0190]). Scott teaches that the Type V nuclease can be one that requires a tracrRNA ([0070]) and accordingly the editing template RNA can comprise a tracrRNA component ([0156]). Scott provides examples of Cas12b Type V Cas effectors, which are known in the art to require tracrRNAs ([0102]-[0103]). Scott does not teach a type V CRISPR Cas effector that requires a tracrRNA or a Cas12b species in the working example.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have substituted the Cas12i2 effector in the Cas12i2-RT-Brex27 fusion rendered obvious above for Cas12b and included the known required Cas12b tracrRNA element. It would have amounted to the simple substitution on one known Cas12 enzyme for another and incorporation of a known tracrRNA sequence by known means to yield predictable results. The skilled artisan would have been motivated to do so with a reasonable expectation of success because Scott suggests that other Type V Cas effectors, like Cas12b can be used, and that the necessary tracrRNA sequence can be included in the extended guide RNA.
Regarding claim 78, Xu teaches fusing Brex27 to the C-terminus of Cas9 (Fig 13A). Song teaches fusing Rad51 to the C-terminus of the prime editor.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have specifically fused the Brex27 peptide to the C-terminus of the Cas12i2-RT fusion because Song and Xu teach the C-terminus is an effective site of fusion for peptides that help stabilize/recruit ssDNA.
Regarding claim 79, Song teaches the N-terminal Cas9 fusion to Rad51 were lower for some targets, but higher for other targets compared to prime editors without the ssDNA binding domain (Fig 1C).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included Xu’s Brex27 fused to the N-terminus of Cas12i2 in Scott’s Cas12i2 prime editor. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Brex27 could be fused to the N-terminus because Song demonstrates fusion of a different small protein to a different prime editor. The skilled artisan would have been motivated to do so because Song teaches such a fusion increased prime editing efficiency of two of the target loci. Additionally, rearrangement of parts is prima facie obvious that the court has held normally require only ordinary skill in the art and hence are considered routine expedients. See MPEP 2144.04.VI.C.
Claims 8, 10, 21 and 67-68 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021; of record) and Xu (US 20210301272 A1, published September 30, 2021; of record), as applied to claims 1, 7, 9, 17, 78-79, and 176-177 above, and further in view of Liu (US 20230357766 A1, effectively filed at least as early as September 24, 2021; of record). This is a maintained rejection.
The teachings of Scott, Song and Xu are recited above and applied as for claims 1, 7, 9, 17, 78-79, and 176-177. Scott also teaches the structured region can comprise a sequence called “preQ” ([0203]). Scott also teaches the extended guide RNA can comprise the RNA bacteriophage MS2 sequence ([0203]). Scott teaches protein fusions can be at the N-terminus, the C-terminus or at an intramolecular position ([0144]).
Scott, Song and Xu do not teach a structure sequence with SEQ ID NO: 191. Scott, Song and Xu do not teach recruiting the RT domain to the site of the CRISPR nuclease using an additional component.
Regarding claims 8 and 10, Liu teaches methods of editing a genome using a prime editor complexed with modified prime editing guide RNAs (pegRNAs, i.e., extended guide nucleic acid) (Abstract). Liu teaches Cas9-RT fusions in a complex with pegRNAs (Fig 10). Liu also teaches hRad51-Cas9 fusions ([1655]). Liu teaches “Next-generation pegRNA modification for improving prime editing efficiency” (Example 3, [1364]-[1379]). Liu teaches pegRNAs comprising the evopreQ1 (i.e., a pseudoknot) at its 3’ end ([1370], FIG 106). Liu teaches the sequence of evoPreQ is SEQ ID NO 215 ([0017] and Table 6). Liu’s SEQ ID NO 215 is 100% identical to SEQ ID NO 191 of the current application as shown below:
Liu SEQ 215: TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACTAGAAA
App SEQ 191: TTGACGCGGTTCTATCTAGTTACGCGTTAAACCAACUAGAAA
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have specifically used Liu’s evoPreQ having a sequence that is 100% identical to SEQ ID NO 191 of present application as the structured RNA component in Scott’s extended guide RNA. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have been motivated to do so with a reasonable expectation of success because 1) Scott suggests that the structured region is a preQ sequence and 2) Liu demonstrates successfully appending the evoPreQ sequence onto a prime editing RNA.
Regarding claims 21 and 67-68, Liu also teaches pegRNAs comprising an MS2 hairpin at the 3’ end (FIG. 135, [1437]). Liu teaches the prime editor fused to the MS2 coat protein which binds to the MS2 RNA sequence (i.e., wherein the reverse transcriptase is fused to one or more ssRBDs; wherein the reverse transcriptase fusion protein and/or extended guide nucleic acid is fused to one or more components that recruit the reverse transcriptase to the CRISPR-Cas effector protein) (FIG. 135). Liu teaches the fusion protein may comprise any suitable structural configuration including 1) the fusion of the C-terminus of a Cas effector to the N-terminus or C-terminus of an RT ([0607]). Liu teaches that using the MS2-MCP system with the prime editor increases the recruitment of the RT with the pegRNA ([1437]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have additionally modified Scott’s prime editing method by including an MS2 sequence in Scott’s extended guide RNAs and fused the MS2-binding domain MCP to the reverse transcriptase instead of fusing the RT to Cas12i2. It would have amounted to the simple combination of elements by known means to yield predictable results. The skilled artisan would have been predicted that the RT can be fused to MCP and the guide RNA could include an MS2 sequence with a reasonable expectation of success because 1) Scott suggests that the guide RNAs can include an MS2 sequence, which are well known to function in recruiting proteins to the Cas/guide RNA complex, and 2) Liu demonstrates the MS2-MCP-RT recruitment system in a different prime editing system. The skilled artisan would have been motivated to have done so because Liu teaches using the MS2-MCP recruitment system for the RT increases the recruitment without the need for producing a large Cas-RT fusion. Regarding the specific placement of the MCP in the MCP-RT fusion, the skilled artisan would have predicted that the ssRBD -RT fusion could be used because both Liu and Scott make clear that protein fusions can be in either orientation. Additionally, rearrangement of parts is prima facie obvious that the court has held normally require only ordinary skill in the art and hence are considered routine expedients. See MPEP 2144.04.VI.C.
Claims 34-37 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021, of record), and Xu (US 20210301272 A1, published September 30, 2021; of record) as applied to claims 1, 7, 9, 17, 78-79, and 176-177 above, and further in view of Kim (US 20240218358 A1, priority to KR patent application 10-202-0123432, filed September 24, 2020; of record). This is a new rejection necessitated by amendment.
Claims 34-35 are indefinite for the reasons described above in paragraph 9. For the purpose of compact prosecution, claim 34 is interpreted as depending from claim 1 and requiring a CMP fused the N- or C-terminus of the Type V Cas effector (i.e., Cas12) and does not require a recruitment domain. Claim 35 is interpreted requiring a fusion protein comprising CMP-RT-Cas12.
The teachings of Scott, Song and Xu are recited above and applied as for claims 1, 7, 9, 17, 78-79, and 176-177. Scott also teaches that the RT domain can be fused to the N-terminus or the C-terminus of the Type V CRISPR nuclease ([0371]).
Scott, Song and Xu do not teach a chromatin modulating peptide (CMP) fused to the Cas12i2 protein.
Kim teaches prime editing-based gene editing composition with enhanced editing efficiency (Abstract). Kim teaches a Prime editor comprising a Cas9 protein fused to an RT and additionally fused to HN1 and H1G, which are chromatin modulating peptides (CMPs) (FIG 4A, [0045]). Kim teaches the HN1 fused to the N-terminus of the Cas9 protein (FIG. 4A). Kim teaches the sequence of the HN1 fused to the N-terminus of Cas9 (FIG 4B, underlined), which is 100% identical to SEQ ID NO 202 of the current application. Kim teaches that including the HN1 domain in the prime editor increased prime editing efficiency of the prime editor (FIG 4D, [0122]). Kim teaches the CRISPR Cas should be an enzyme which has the function of a nuclease ([0071]).
Regarding claims 34 and 36-37, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have further included the HN1 peptide fused to the N-terminus of the Cas12i2-RT-Brex27 rendered obvious above to create an HN1-Cas12i2-RT-Brex27. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that HN1 could be fused to the Cas12i2-RT-Brex27 fusion protein because Kim demonstrates fusion of HN1 to a prime editor using a different CRISPR Cas nuclease. The skilled artisan would have been motivated to do so because Kim teaches including a CMP increases prime editing efficiency of the intended target.
Regarding claim 35, it would have been obvious to one skilled in the art to further created an HN1-RT-Cas12-Brex27 fusion protein. It would have amounted to the simple rearrangement of parts of an obvious fusion protein which is prima facie obvious. MPEP 2144.04.VI.C. Additionally, the skilled artisan would have had a reasonable expectation that the domains could be rearranged in the fusion protein because 1) each of Song and Kim teach optimizing the domain arrangement of the prime editor domains and 2) Scott teaches the RT can be fused at the N- or C- terminus of Cas12 effector.
Claims 82 and 85 are rejected under 35 U.S.C. 103 as being unpatentable over Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8, and Supplemental material, published September 23, 2021; of record) and Xu (US 20210301272 A1, published September 30, 2021; of record), as applied to claims 1, 7, 9, 17, 78-79, and 176-177 above, and further in view of Zhang (US 20230049737 A1, priority to December 30, 2019, of record). This is a maintained rejection.
The teachings of Scott, Song and Xu are recited above and applied as for claims 1, 7, 9, 17, 78-79, and 176-177.
Scott, Song and Xu do not teach an NHEJ inhibitor polypeptide, such as Mu Gam fused to components of the prime editor.
Zhang teaches the mechanism of prime editing, including the role of Gam (FIGs. 1, 3-5). Zhang teaches a prime editor comprises RT and Gam fused to Cas9 (Fig 6). Zhang teaches the function of Gam is to protect the linear DNA from exonuclease activity ([0059]). Zhang teaches an exemplary Gam protein is Mu Gam ([0061]). Zhang teaches Cas enzyme in the Cas-Gam fusion can be a type V Cas12 effector ([0100]).
Regarding claims 82 and 85, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the Mu Gam peptide fused to the Cas12i2-Brex27 fusion protein rendered obvious above to create a Gam-Cas12i2-Brex27. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Gam could be fused to the obvious Cas12i2-Brex27 because Zhang teaches such a fusion to a prime editor using a different Cas effector and teaches that other Cas effectors like type V Cas12 enzymes can be used. The skilled artisan would have been motivated to do so because Zhang teaches that including Gam can protect the DNA that was cleaved during prime editing from degradation via exonucleases.
Response to Arguments - §103
Applicant argues that there is no suggestion or motivation to modify Scott, who uses Cas12 CRISPR effectors, with Brex27 because the references that teach Brex27 only attach the peptide to Cas9, which are Type II CRISPR effectors (Remarks, ¶ spanning pages 7-8). This argument has been fully considered but is not persuasive. As of November 2021, the effective filing date of the claimed invention, it was well established that most, if not all, of the applications that were first developed with Cas9 (i.e., prime editing, transcriptional activation, chromatin remodeling, base editing) were soon tested and found effective with Cas12 enzymes. In fact, Scott even references the first prime editors using Cas9 ([0005]) and illustrates the differences between them (Fig 1B). This is also evident in a February 2021 review of Cas12 effectors and their applications (Tong et al., Frontiers in Cell and Developmental Biology (2021), 8:622103). Tong teaches that Cas12 systems have been utilized in genome editing (pages 4-5), transcriptional regulation, and base editing (page 6). Therefore, the skilled artisan would have recognized that any advancement or application demonstrated with Cas9-based systems could be applied to Cas12-based systems, including Brex27 fusions to promote gene editing by prime editing.
Applicant argues that Song only teaches the Rad51 DNA binding domain to prime editors and not Brex27. Applicant argues that Song states they “could not rule out the possibility that the Rad51 DBD might prevent binding of the pegRNA to the ssDNA, blocking the RT of the pegRNA RT-template region” (Remarks, ¶ spanning pages 7-8). This argument has been fully considered but is not persuasive.
First, the quoted line from Song is in the Introduction section of Song, where the authors postulate what might occur before actually doing the experiment. Then, Song demonstrates that including the Rad51 DBD increases prime editing efficiency (Fig 1b), thereby showing that their hypothesis of the Rad51 DBD blocking the RT of the pegRNA RT-template region was incorrect. As such, Applicant is misrepresenting the findings and suggestions of Song.
Second, Examiner recognizes that obviousness may be established by combining or modifying the teachings of the prior art to produce the claimed invention where there is some teaching, suggestion, or motivation to do so found either in the references themselves or in the knowledge generally available to one of ordinary skill in the art. See In re Fine, 837 F.2d 1071, 5 USPQ2d 1596 (Fed. Cir. 1988), In re Jones, 958 F.2d 347, 21 USPQ2d 1941 (Fed. Cir. 1992), and KSR International Co. v. Teleflex, Inc., 550 U.S. 398, 82 USPQ2d 1385 (2007). In this case, the skilled artisan would have known based on Song and Xu that using and/or recruiting a ssDNA binding protein to genome editing processes requiring a ssDNA intermediate would enhance editing. Prime editing and homology directed repair (HDR) both involve a ssDNA intermediate. As such the skilled artisan would have realized that means to promote ssDNA-binding protein interaction with the ssDNA, either direct fusion with Rad51 DBD or recruitment of Rad51 through using Brex27, would increase prime editing. Thus, the prior art recognized the functional equivalence of fusing Rad51 DBD directed to a Cas effector and fusing Brex27 to a Cas effector for recruitment of endogenous Rad51. As indicated in the rejection above, the skilled artisan would have been motivated to use Brex27 instead of Rad51-DBD because it is much smaller. Utilizing smaller domains to reach the same end result is generally desirable in the art because of payload size limits. This general understanding is also put forth by Scott who champions using Cas12 systems effectors due to the smaller size of both the effector and the guide RNA as compared to Cas9 ([0005]).
Applicant argues that there was a considerable amount of uncertainty given the activity of Cas9 compared to Cas12i2, activity of Rad51 compared to Brex27, and the end result to be achieved (page 8, ¶2). This argument has been fully considered but is not persuasive. MPEP 2143.02 teaches that obviousness does not require absolute predictability, but only a reasonable expectation of success is required. As stated above, Xu teaches that Brex27 could be fused to Type V CRISPRs ([0101]), so it was entirely predictable that a Cas12i2-Brex27 fusions could be made and used to enhance genome editing where a polynucleotide sequence is inserted into the genome. The use of Type V effectors in prime editing was also well established as taught in Scott. Thus, it was entirely predictable that the Scott’s prime editor with Cas12i2 could also be fused to Brex27. Because Song teaches prime editing can be improved by including and/or recruiting a ssDNA binding protein, it was also entirely predictable that the prime editor with Cas12i2 fused to Brex27 would improve prime editing as well. Each of the modifications to Scott in the obviousness rejection of record requires a simple combination of elements and/or a simple substitution. Since protein domain swapping and rearranging is routine in the art, as demonstrated by each of the cited references, it was entirely predictable that the claimed fusion proteins could be made and facilitate prime editing.
Applicant argues that based on their findings that Cas12a-hRad51 inhibited prime editing, the effect of fusing Brex27 to Scott’s Cas12i2 protein was not predictable (¶ spanning pages 8-9). This argument has been fully considered but is not persuasive. First, Applicant fuses the entire Rad51 protein, which is 339 amino acids long, to Cas12a. In contrast to Applicant’s working examples, Song fuses just the DNA-binding domain of Rad51 to Cas9, which is only 113 amino acids, a third of the size of the entire Rad51 protein. Additionally, Applicant’s working examples uses RT expressed in trans instead of fused to the Cas effector like in Song and Scott. Thus, Applicant’s proffered evidence only shows the unpredictability of fusing an entire Rad51 protein to a Type V CRISPR when the RT domain is recruited in trans, which is not sufficient for showing unpredictability of fusing a much smaller DNA binding domain to Scott’s prime Cas12i-based prime editor.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 7-11, 17, 21, 34-37, 67-68, 78-79, 82, 85, 174 and 176 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 6, 12, 21, 32, 42, 60, 76, 106-107, 114, 122, 124-125, 129 and 141 of copending Application No. 18989127 in view of Scott (US 20230023791 A1, priority to June 1, 2021), Song (Song et al., Nature Communications (2021), 12: 5617, pages 1-8; published September 23, 2021) and Xu (US 20210301272 A1, published September 30, 2021). Claims 34-37 are rejected in view of Kim (US 20240218358 A1, priority to KR patent application 10-202-0123432, filed September 24, 2020). Claims 82 and 85 are further rejected in view of Zhang (US 20230049737 A1, priority to December 30, 2019). This is a new rejection necessitated by amendment.
Copending claim 1 recites A method of modifying a target nucleic acid, the method comprising: contacting the target nucleic acid with (a) a Type V CRISPR-Cas effector protein; (b) a reverse transcriptase; (c) an extended guide nucleic acid, wherein the extended guide nucleic acid comprises: (i) a Type V CRISPR nucleic acid and/or a Type V CRISPR nucleic acid and a tracr nucleic acid and (ii) an extended portion comprising a primer binding site and a reverse transcriptase template (RT template) (RTT). Copending claim 76 recites further comprising contacting the target nucleic acid with a single-stranded DNA binding protein (ssDNA binding protein), optionally wherein the ssDNA binding protein is Brex27. Copending claim 6 recites wherein the extended guide nucleic acid further comprises a structured RNA motif, optionally the structured RNA motif is AsCpf1BB (SEQ ID NO:189), BoxB (SEQ ID NO:190), pseudoknot (decoy) (SEQ ID NO:95, SEQ ID NO:203), pseudoknot (tEvoPreQ1) (SEQ ID NO:191), fmpknot (SEQ ID NO:192), mpknot (SEQ ID NO:193), MS2 (SEQ ID NO:194), PP7 (SEQ ID NO:195), SLBP (SEQ ID NO:196), TAR (SEQ ID NO:197), and/or ThermoPh (SEQ ID NO:198). Copending claim 27 recites wherein the target nucleic acid is double-stranded and comprises a first strand and a second strand and the primer binding site binds to the second strand (non-target, top strand) of the target nucleic acid, b) binds to the first strand (e.g, binds to the target strand, same strand to which the CRISPR-Cas effector protein is recruited, bottom strand) of the target nucleic acid, or (c) binds to the second strand (non-target strand, opposite strand from that to which the CRISPR-Cas effector protein is recruited) of the target nucleic acid. Copending claim 21 recites wherein the Type V CRISPR-Cas effector protein or the Type II CRISPR-Cas effector protein is a fusion protein and/or the reverse transcriptase is a fusion protein, wherein the Type V CRISPR-Cas fusion protein or Type II CRISPR-Cas fusion protein, the reverse transcriptase fusion protein and/or the extended guide nucleic acid is fused to one or more components that recruit the reverse transcriptase to the Type V CRISPR-Cas effector protein or Type II CRISPR-Cas effector protein, optionally the one or more components recruit via protein-protein interactions, protein-RNA interactions, and/or chemical interactions. Copending claim 67 recites wherein the reverse transcriptase is fused to one or more single-stranded RNA binding domains (RBDs).
Although the copending claims recite contacting a cell with components of examined claim 1, the copending claims do not recite the Brex27 protein fused to the Type V Cas effector. The copending claims do not recite specific sites fusion polypeptides on the CRISPR-Cas enzyme or RT. The copending claims do not recite the CRISPR-Cas or the RT is fused to a chromatin modulating peptide or an NHEJ inhibiting polypeptide.
Scott teaches methods for editing (i.e., modifying) a target nucleic acid using Cas12i2, a type V CRISPR polypeptides (Abstract; FIGs 12A-B and 13). Scott teaches contacting mammalian cells with nucleic acids encoding Cas12i2 fused to an RT domain (FIGs 12-13; [0475]). Scott teaches the active Cas12i2 cleaves both strands of the target nucleic acid that cuts both strands of the target nucleic acid resulting in a double stranded break (FIG 12). Scott teaches contacting the cells with an editing template RNA comprising 1) a 5’ hairpin and spacer sequence that hybridizes to the target DNA (i.e., a guide nucleic acid) and 2) an RT donor RNA (i.e., an extension sequence) that comprises an edit sequence and a primer binding site (PBS) (FIG 12A-B, Fig 19B, [0031], [0476]). Scott teaches that the DNA strand that the crRNA binds to (i.e., the target strand) is also the strand that hybridizes to the primer binding sequence (FIG. 12; FIG 19B, [0059]).
Song teaches methods using prime editors (Abstract). Song teaches that efficiency of prime editor PE2 is often inefficient (Abstract). Song teaches a fusion protein comprising the CRISPR-Cas effector Cas9, Rad51 DBD, and RT (Figure 1). Song teaches the Rad51 DBD is derived from human Rad51 (i.e., is hRad51) (page 6, ¶4). Song teaches Rad51 DBD fused to the N-terminus of Cas9 or to the C-terminus of Cas9 (Fig 1). Song teaches the editing efficiencies of the C-terminal Cas9-DBD fusion PE are improved over PE2 (Fig 1b). Song teaches the nucleic acid sequence encoding the Rad51 DBD domain is 339 base pairs in length (Supplemental note).
Xu teaches fusions between Cas9 and BE27 (i.e., Brex29, BRCA2 exon 27) ([0285]; Fig 13). Xu teaches that BE27 functions to recruit Rad51 to the site of Cas9 editing ([0283]). Xu teaches fusing BE27 to Cas9 increases the efficiency of target insertion and decreases indels ([0286]; Figs 8, 10A). Xu teaches that BE27 is only 36 amino acids in length, requiring only 108 bp coding sequence ([0284]). Xu teaches Type V proteins can also be used in the invention fused to BE27.
Regarding claims 1, 17, 21, 67-68, 78-79, and 176-177, it would have been obvious to one skilled in the art to fuse the components of the copending prime editing complexes and used in methods of modifying a targeted nucleic acid because both Song and Xu teach using Cas effectors in methods modifying target genomic sequences, including with reverse transcriptase. The obviousness of fusing the Brex27 peptide to the copending Type V Cas-effectors, which encompass Scott’s Cas12i2-RT fusion to be used in prime editing methods is recite above in paragraph 20. It also would have been obvious to have fused the ssRBD polypeptide in the copending claims to the N-terminus of the RT because in protein fusions because there are typically only two sites for protein fusions, the N-terminus and C-terminus. Because of the limited sites available for protein-protein fusions, the skilled artisan would immediately envisage the ssRBD-RT N-terminal fusion structure. See MPEP 2131.02.III.
Regarding claims 7-10, Liu teaches methods of editing a genome using a prime editor complexed with modified pegRNAs (Abstract). Liu teaches Cas9, a CRISPR-Cas effector protein) fused to a reverse transcriptase to form a Prime Editing enzyme (Fig 1D). Liu teaches the Cas9-RT fusion contacts the target nucleic acid via a PEgRNA (i.e., an extended guide nucleic acid) (Fig 1D). Liu teaches the PEgRNA structure which includes a 3’ extension arm with an optional hairpin, stemloop, or toeloop (i.e., a structured RNA motif at the 3’ end of the extended guide nucleic acid) (Fig 3D). Liu teaches upon Cas9-RT-pegRNA binding to the target DNA, the target DNA is modified (Fig 1D). Liu teaches “Next-generation pegRNA modification for improving prime editing efficiency” (Example 3, [1364]-[1379]). Liu teaches pegRNAs comprising the evopreQ1-1 (i.e., a pseudoknot) at its 3’ end ([1370], FIG 106). Liu teaches the sequence of evoPreQ1-1 is SEQ ID NO 215 ([0017] and Table 6). SEQ ID NO 215 is 100% identical (i.e., comprises) SEQ ID NO 191 of the current application. Liu also teaches the CRISPR-Cas and guide RNAs can include Type V CRIRPS-Cas enzymes and guide RNAs ([0263], [0361], [0392]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have appended the evoPreQ1 sequence onto the type V guide RNA in the method rendered obvious above. It would have amounted to a simple combination of elements by known means to yield predictable results. The skilled artisan would have predicted that tEvoPreQ1 sequence could have been appended, and been motivated to do so, because Liu teaches the invention of using stabilizing structured motifs can be applied to type V CRISPR-Cas systems.
Regarding claims 34-37, Kim teaches prime editing-based gene editing composition with enhanced editing efficiency (Abstract). Kim teaches a Prime editor comprising a CRIPSR-Cas protein fused to an RT and additionally fused to HN1 and H1G, which are chromatin modulating peptides (CMPs) (FIG 4A, [0045]). Kim teaches the HN1 fused to the N-terminus of the CRISPR-Cas protein (FIG. 4A). Kim teaches the sequence of the HN1 fused to the N-terminus of CRISPR-Cas protein (FIG 4B, underlined), which is 100% identical to SEQ ID NO 202 of the current application. Kim teaches that including the HN1 domain to the prime editor increased prime editing efficiency of the prime editor (FIG 4D, [0122]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the HN1 peptide fused to the N-terminus or the C-terminus of the Type V Prime Editor fused to Brex27 rendered obvious above. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that HN1 could be fused to the copending Type V prime editor because Kim demonstrates fusion of HN1 to a prime editor of the related Type II CRISPR-Cas. The skilled artisan would have been motivated to do so because Kim teaches it increased prime editing efficiency of the intended target. Regarding the placement of the fusion on the N- or C-terminus, rearrangement of parts is prima facie obvious that the court has held normally require only ordinary skill in the art and hence are considered routine expedients. See MPEP 2144.04.VI.C.
Regarding claims 82 and 85, Zhang teaches the mechanism of prime editing, including the role of Gam (FIGs. 1, 3-5). Zhang teaches a prime editor comprises RT and Gam fused to a CRISPR-Cas enzyme (Fig 6). Zhang teaches the function of Gam is to protect the linear DNA from exonuclease activity ([0059]). Zhang teaches an exemplary Gam protein is Mu Gam ([0061]).
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have included the Mu Gam peptide fused to the Type V CRISPR-Cas-Brex27 rendered obvious above the copending primed editing method. It would have amounted to the simple combination of known elements by known means to yield predictable results. The skilled artisan would have predicted that Gam could be fused to the copending Type V CRISPR-Cas because Zhang teaches such a fusion to a prime editor of the related Type II CRISPR-Cas prime editor. The skilled artisan would have been motivated to do so because Zhang teaches including Gam can protect the DNA that was cleaved during prime editing from degradation via exonucleases.
This is a provisional nonstatutory double patenting rejection.
Response to Arguments – NSDP
Applicant argues that the NSDP rejection over copending claims in Application 18/989127 should be withdrawn because the combination of Liu, Song, Xu, Kim and Zhang fail to teach of suggest the claimed method and the copending claims do not recite Brex27 actually fused to the CRISPR effector (Remarks, page 10). This argument has been fully considered but is not persuasive because the only modification needed to the copending claims is fusion of two copending elements, Type V effector and Brex27. Because both Xu and Song teach fusing ssDNA binding proteins to Cas effectors in either prime editing or HDR for the purpose of improving editing efficiencies, the skilled artisan would have been motivated to have fused the copending elements.
Allowable Subject Matter
Claim 11 recites wherein the structured RNA comprises the nucleic acid sequence SEQ ID NO: 203, which an RNA sequence of 21 nucleotides. SEQ ID NO: 203 attached to the end of a CRISPR/Cas extended guide RNA appears free of the prior art. The Specification teaches that the sequence is derived from a known hairpin from HIV-1 (page 77) and was first described in WO 2021092130 (Table 17; cited in IDS filed 5/13/2022). The cited WIPO publication was published on May 14, 2021, six months before the effective filing date of the claimed invention. However, the WIPO publication does not name any others in addition to the inventors of this examined application. The inventive entity on the WIPO publication is identical to the inventive entity in the examined application. Therefore, the WIPO publication is not available as prior art because it is disqualified under §102(b)(1)(A). The published PCT Application and related US printed publication US 20210130835 A1 were both filed prior to November 5, 2021. However, because the PCT Application and US Application have identical inventive entities and assignees not later than November 5, 2021, both the WIPO and US patent application publications are disqualified under §102(b)(2)(A) and (C).
SEQ ID NO 203 was derived by Applicant by adding two nucleotides at the 5’ end of the previously known HIV-1 hairpin. A thorough search of the prior art could not find 1) sequences with all of SEQ ID NO:203 or 2) using the HIV-1 hairpin (i.e., SEQ ID NO 203 without the first two nucleotides) within a gene editing or CRISPR system. Although Liu teaches appending hairpins to the 3’ ends of pegRNAs, the possible structures for RNA hairpins is infinite because they can have variable stem lengths, variable loop lengths, and various number of bulges/mismatches in the stems. Thus, it would not have been obvious to specifically try SEQ ID NO 203 because there is not “a finite number of identified, predictable solutions” (MPEP 2143.I.E). Additionally, SEQ ID NO: 203 is quite short in terms of RNA hairpins – the stem is only predicted to have 6 hybridized nucleotide pairs (see office action mailed 6/9/2025, page 9). Liu teaches using a hairpin that has 15 hybridized nucleotide pairs in the stem to stabilize a guide RNA (Fig 116C). Allen teaches that when using hairpins to stabilize guide RNAs “the hairpin structures’ design must meet stringent constraints for thermodynamic stability since below a specific free energy cut-off, the nuclease activity is severely impaired.” (Allen et al., Frontiers in Genome Editing (2021), 2: 617910, pages 1-16; page 9, ¶1). Thus, it does not appear that any specific hairpin would have been obvious to append to the 3’ end of a prime editing guide RNA.
It is noted that claim 11 remains provisionally rejected for nonstatutory double patenting over copending application 18989127, which recites a hairpin with SEQ ID NO: 203.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights