DETAILED CORRESPONDENCE
Application Status
1. The present application is being examined under the pre-AIA first to invent provisions.
2. Applicant’s amendment to the claims filed on 01/01/2026 in response to the Non-Final Rejection mailed on 07/01/2025 is acknowledged. This listing of claims replaces all prior listings of claims in the application.
3. Claims 9, 12, and 22 are cancelled.
4. Claims 2-4, 6-8, 10-11, 13, 18, 23-27 and 52-57 are pending.
5. Applicant’s remarks filed on 01/01/2026 in response to the Non-Final Rejection mailed on 07/01/2025 have been fully considered and are deemed persuasive to overcome at least one of the rejections and/or objections as previously applied.
The text of those sections of Title 35 U.S. Code not included in the instant action can be found in the prior Office Action.
Nucleotide and/or Amino Acid Sequence Disclosures
6. The objection to the disclosure is withdrawn in view of applicants’ amendment to the specification to include appropriate sequence identifiers in the description for Figure 1B.
Improper Markush Grouping
7. The rejection of claims 2-4, 6-13, 18, 22-27, and 52-57 on the basis that it contains an improper Markush grouping of alternatives is withdrawn in view of applicants’ amendment to the claims to recite the sequences SEQ ID NO: 6, SEQ ID NO: 11, and SEQ ID NO: 16 and to cancel claims 9, 12, and 22. Applicants’ remarks that SEQ ID NO: 6, SEQ ID NO: 11, and SEQ ID NO: 16 share a common use of increased production of recombinant IgG, BIWA4 in CHO cells.
Claim Rejections - 35 USC § 102
8. The rejection of claims 2-4, 9-12, and 52 is/are rejected under pre-AIA 35 U.S.C. 102(b) as being anticipated by Corey et al. (WO 2009/149182 A1; cited on PTO-892 mailed on 07/01/2025) is withdrawn in view of applicants’ remarks that Corey et al. identifies miRNAs that modulate expression by using oligonucleotides that are complementary to the endogenous miRNA and amendment to cancel claims 9 and 12.
Claim Rejections - 35 USC § 103
9. The rejection of claims 6, 13, 18, 22-25, 27, and 53 is/are rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Corey et al. (WO 2009/149182 A1; cited on PTO-892 mailed on 07/01/2025) in view of Mendenhall et al. (Journal of Visualized Experiments, 2012; cited on IDS filed on 04/27/2022) is withdrawn in view of applicants’ amendment to the claims to cancel claim 22 and in favor of the new rejection, which is necessitated upon further consideration of the claims in view of applicants’ remarks.
10. The rejection of claims 7 and 8 under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Corey et al. (WO 2009/149182 A1; cited on PTO-892 mailed on 07/01/2025) in view of Mendenhall et al. (Journal of Visualized Experiments, 2012; cited on IDS filed on 04/27/2022) as applied to claims 6, 13, 18, 22-25, 27, and 53 above, and further in view of Gori et al. (Gene Therapy, 2010; cited on IDS filed on 04/27/2022) is withdrawn for the reasons set forth above.
11. Claims 2-4, 6, 10-11, 13, 18, 22-25, 27 and 52-53 are newly rejected under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Corey et al. (WO 2009/149182 A1; cited on PTO-892 mailed on 07/01/2025) in view of Mendenhall et al. (Journal of Visualized Experiments, 2012; cited on IDS filed on 04/27/2022). This new grounds of rejection is necessitated upon further consideration of the claims in view of applicants’ remarks.
12. With respect to claims 2 and 9-12, Corey et al. teach a viral expression vector comprising a contacting an endogenous microRNA with a complementary single-stranded oligonucleotide that hybridizes to the miRNA wherein the endogenous miRNA 100% identical to the sequence of SEQ ID NO: 16 for expression in a mammalian cell [see Abstract; paragraphs 0033, 0066, 0070, alignment attached as APPENDIX A]. Corey et al. teach wherein multiple combinations of complementary oligonucleotides can be used [see paragraphs 0172-0173]. Corey et al. teach that the development of systematic and efficient methods for indentifying promoter sequences that may be miRNA targets is essential for prioritizing predictions and efficiently allocating experimental resources towards validating the most promising targets for modulation of expression of target genes [see Abstract; paragraph 0010]. While it is acknowledged that the sequence disclosed by Corey et al. contains Thymine residues as opposed to uracils, one of ordinary skill in the art is aware that the nucleic acid thymine is substituted with uracil in RNA.
With respect to claim 3, Corey et al. teach the mammalian expression vector wherein the vector comprises a polynucleotide sequence encoding the microRNA [see Abstract; paragraphs 0033, 0066, 0070].
With respect to claim 4, Corey et al. teach the mammalian expression vector wherein said microRNA leads to increase in the production of a therapeutic protein of interest in a mammalian expression system [see Abstract; paragraphs 0008, 0014, 0033, 0066, 0070].
With respect to claims 18, 22-23, Corey et al. teach a viral expression vector comprising a microRNA that is 100% identical to the sequence of SEQ ID NO: 16 for expression in a mammalian cell [see Abstract; paragraphs 0033, 0066, 0070, alignment attached as APPENDIX A].
With respect to claim 53, Corey et al. teach wherein the expression vector is a plasmid or viral vector [see paragraph 0074].
With respect to claim 52, Corey et al. teach the mammalian expression vector wherein the expression vector is a plasmid or a viral vector [see paragraph 0074].
However, while Corey et al. teach the identification of endogenous miRNA, Corey et al. does not teach mammalian expression vectors comprising the miRNA; the vector of claim 6 further comprising a selection marker gene; the vector of claim 13, further comprising at least one gene of interest; the mammalian cell of claim 18, wherein the cell is stable transfected; the mammalian cell of claim 24, stably expressing a protein of interest; the mammalian cell of claim 25, wherein the cell is a rodent or a human cell; the mammalian cell of claim 27, wherein the human cell is a HEK-293 cell, a PER.C6 cell or a CAP cell.
Mendenhall et al teach that packaging of microRNA into lentiviral expression constructs into pseudoviral particles enables up to 100% transduction in difficult-to-transfect cells, such as primary, stem and differentiated cells, which is an improvement over standard plasmid vectors [see Abstract]. Mendenhall et al teach that the lentiviral vector integrates into genomic DNA and provides stable expression of microRNA [see Abstract]. Mendenhall et al teach the lentiviral vector further comprising a marker gene or gene of interest, which encodes puromycin resistance or GFP [see Abstract]. Mendenhall et al teach products required for production of pseudoviral particles [see Abstract; Fig. 1]. Mendenhall et al teach a Lentivector construct plasmid encoding the microRNA [see Abstract; Fig. 1]. Mendenhall et al teach 293TN (a HEK 293 cell derivative) comprising the Lentivector construct plasmid, and the produced lentiviral vector RNA, which are also secreted into the medium as pseudoviral particles [see Abstract; Fig. 1]. Mendenhall et al teach cells, such as human embryonic H9 cells infected with the pseudoviral particles [see Fig. 1].
At the time the invention was made, it would have been obvious for one of ordinary skill in the art to modify the microRNA vectors of Corey et al. to include the plasmid construct, lentivirus construct, 293TN cell comprising both constructs, and human embryonic cells comprising a stably integrated lentiviral construct taught by Mendenhall et al, because Corey et al. teach the identification of miRNA comprising SEQ ID NO: 16 for enhancing expression of therapeutic proteins in mammalian cells, and Mendenhall teach it is within the ordinary skill in the art to produce the plasmid construct encoding a microRNA, a lentiviral construct comprising the RNA, a 293TN cell comprising both constructs, and a cell, such as a human embryonic cell, infected with the pseudoviral particles comprising the lentiviral construct. It would have been obvious to one of ordinary skill in the art to make the abovementioned products of inserting the miRNA of SEQ ID NO: 16 into a mammalian expression vector, because such products would be useful for producing pseudoviral particles that could be used with the hESCs to further study the role of microRNA in maintaining the pluripotent status of hESCs or their ability to self-renew.
One would have been motivated to make such a modification in order to receive the expected benefit of providing products capable of producing pseudoviral particles capable of up to 100% transduction of cells, including difficult to transfect cells, such as embryonic stem cells as taught by Mendenhall et al. Based upon the teachings of the cited references, the high skill of one of ordinary skill in the art, and absent any evidence to the contrary, there would have been a reasonable expectation of success to result in the claimed invention.
13. Claims 7 and 8 are newly rejected pre-AIA 35 U.S.C. 103(a) as being unpatentable over Corey et al. (WO 2009/149182 A1; cited on PTO-892 mailed on 07/01/2025) in view of Mendenhall et al. (Journal of Visualized Experiments, 2012; cited on IDS filed on 04/27/2022) as applied to claims 2-4, 6, 10-11, 13, 18, 22-25, 27 and 52-53 above, and further in view of Gori et al. (Gene Therapy, 2010; cited on IDS filed on 04/27/2022). This new grounds of rejection is necessitated upon further consideration of the claims in view of applicants’ remarks.
14. The relevant teachings of Corey et al. and Mendenhall et al. as applied to claims 2-4, 6, 10-11, 13, 18, 22-25, 27 and 52-53 are set forth above.
However, the combination of Corey et al. and Mendenhall et al. do not teach the mammalian expression vector wherein the selection marker gene is an amplifiable selection marker gene and the mammalian expression vector wherein the amplifiable selection marker is a glutamine synthetase gene or a dihydrofolate reductase gene.
Gori et al teach a lentiviral vector comprising the marker genes Tyr22-DHFR and GFP, where hESCs transduced with the lentiviral vector demonstrate improved cell survival of hematopoietic cells differentiated from hESCs while under methotrexate selection (e.g., page 239, left column, 1st full paragraph; page 239, Stable expression of DHFR and GFP in undifferentiated hESCs; page 246, left column, 1st full paragraph; Fig. 1).
It would have been obvious to one of ordinary skill in the art at the time the invention was made to modify the lentiviral construct of Corey et al. and Mendenhall et al. to include the DHFR coding sequence taught by Gori et al, because Mendenahll et al teach it is within the ordinary skill in the art to make a lentiviral construct encoding GFP for the infection of hESCs, and Gori et al teach the infection of hESCs with a lentiviral construct encoding both GFP and DHFR.
One would have been motivated to make such a modification in order to receive the expected benefit of providing a lentiviral vector capable of conferring improved survival of hESC differentiated cells, such as hematopoietic cells, as taught by Gori et al. Based upon the teachings of the cited references, the high skill of one of ordinary skill in the art, and absent any evidence to the contrary, there would have been a reasonable expectation of success to result in the claimed invention.
15. The rejection of claims 54-57 under pre-AIA 35 U.S.C. 103(a) as being unpatentable over Corey et al. (WO 2009/149182 A1; cited on PTO-892 mailed on 07/01/2025) in view of Mendenhall et al. (Journal of Visualized Experiments, 2012; cited on IDS filed on 04/27/2022) and Barron et al. (Journal of Biotechnology, 2011; cited on IDS filed on 04/27/2022) is maintained for the reasons of record and the reasons set forth below. The rejection has been modified in view of applicants’ remarks.
16. With respect to claims 54-57, comprising a contacting an endogenous microRNA with a complementary single-stranded oligonucleotide that hybridizes to the miRNA wherein the endogenous miRNA 100% identical to the sequence of SEQ ID NO: 16 for expression in a mammalian cell [see Abstract; paragraphs 0033, 0066, 0070, alignment attached as APPENDIX A]. Corey et al. teach wherein multiple combinations of complementary oligonucleotides can be used [see paragraphs 0172-0173]. Corey et al. teach that the development of systematic and efficient methods for indentifying promoter sequences that may be miRNA targets is essential for prioritizing predictions and efficiently allocating experimental resources towards validating the most promising targets for modulation of expression of target genes [see Abstract; paragraph 0010].
However, Corey et al. does not teach a CHO cell comprising the one or more microRNA of claim 54; the CHO cell of claim 54, wherein the CHO cell further stably expresses a protein of interest; the CHO cell of claim 56, wherein the protein of interest is a recombinant protein; and the CHO cell of claim 57, wherein the cell is stably transfected with an expression vector.
Mendenhall et al teach that packaging of microRNA into lentiviral expression constructs into pseudoviral particles enables up to 100% transduction in difficult-to-transfect cells, such as primary, stem and differentiated cells, which is an improvement over standard plasmid vectors [see Abstract]. Mendenhall et al teach that the lentiviral vector integrates into genomic DNA and provides stable expression of microRNA [see Abstract]. Mendenhall et al teach the lentiviral vector further comprising a marker gene or gene of interest, which encodes puromycin resistance or GFP [see Abstract]. Mendenhall et al teach products required for production of pseudoviral particles [see Abstract; Fig. 1]. Mendenhall et al teach a Lentivector construct plasmid encoding the microRNA [see Abstract; Fig. 1]. Mendenhall et al teach 293TN (a HEK 293 cell derivative) comprising the Lentivector construct plasmid, and the produced lentiviral vector RNA, which are also secreted into the medium as pseudoviral particles [see Abstract; Fig. 1]. Mendenhall et al teach cells, such as human embryonic H9 cells infected with the pseudoviral particles [see Fig. 1].
Barron et al. teach that the efficient production of recombinant proteins by CHO cells in modern bioprocesses is augmented by the use of proliferation control strategies [see Abstract]. Barron et al. further teach that exogenous overexpression of miRNA-7 results in increased normalized cell production at 37oC and dysregulated miRNA expression is a potential tool to modify CHO cell bioprocess phenotypes [see Abstract; p. 210, column 1].
At the time the invention was made, it would have been obvious for one of ordinary skill in the art to modify the microRNA vectors of Corey et al. to include the plasmid construct, lentivirus construct, CHO cell comprising both constructs, and CHO cells comprising a stably integrated lentiviral construct taught by Mendenhall et al. and Barron et al., because Corey et al. teach the miRNA comprising SEQ ID NO: 16 for enhancing expression of therapeutic proteins in mammalian cells, and Mendenhall teach it is within the ordinary skill in the art to produce the plasmid construct encoding a microRNA, a lentiviral construct comprising the RNA, a mammalian cell comprising both constructs, and a cell, such as a human embryonic cell, infected with the pseudoviral particles comprising the lentiviral construct. Barron et al. teach that the efficient production of recombinant proteins by CHO cells in modern bioprocesses is augmented by the use of proliferation control strategies such as miRNA. One of ordinary skill in the art would have had a reasonable expectation of success and a reasonable level of predictability to combine the teachings of Corey et al., Mendenhall et al. and Barron et al. because Mendenhall et al. acknowledges it is within the ordinary skill in the art to produce the plasmid construct encoding a microRNA, a lentiviral construct comprising the RNA, a mammalian cell comprising both constructs, and a cell, such as a human embryonic cell, infected with the pseudoviral particles comprising the lentiviral construct and Barron et al. acknowledges that the efficient production of recombinant proteins by CHO cells in modern bioprocesses is augmented by the use of proliferation control strategies such as miRNA. Therefore, the above invention would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention.
Response to Remarks Regarding Prior Art Rejections
17. Applicants’ remarks filed on 01/01/2026 have been fully considered by the examiner; however, they are rendered moot in view of the new and modified rejections set forth above.
Conclusion
18. Status of the claims:
Claims 2-4, 6-8, 10-11, 13, 18, 23-27 and 52-57 are pending.
Claims 2-4, 6-8, 10-11, 13, 18, 23-27 and 52-57 are rejected.
No claims are in condition for an allowance.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to PAUL J HOLLAND whose telephone number is (571)270-3537. The examiner can normally be reached Monday to Friday from 8AM to 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Manjunath Rao can be reached at 571-272-0939. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/PAUL J HOLLAND/Primary Examiner, Art Unit 1656
APPENDIX A
ID AYE84243 standard; RNA; 23 BP.
XX
AC AYE84243;
XX
DT 16-SEP-2010 (first entry)
XX
DE Gene regulation related antagomir sequence, SEQ:20597.
XX
KW gene expression; gene regulation; gene silencing; rna interference; ss.
XX
OS Homo sapiens.
XX
CC PN WO2009149182-A1.
XX
CC PD 10-DEC-2009.
XX
CC PF 03-JUN-2009; 2009WO-US046127.
XX
PR 04-JUN-2008; 2008US-0058909P.
PR 24-APR-2009; 2009US-0172556P.
XX
CC PA (TEXA ) UNIV TEXAS SYSTEM.
XX
CC PI Corey DR, Younger ST;
XX
DR WPI; 2009-S15200/05.
XX
CC PT Modulating expression of target gene in cell comprises contacting
CC PT endogenous miRNA complementary to portion of promoter of target gene with
CC PT single-stranded complementary oligonucleotide that hybridizes to miRNA.
XX
CC PS Example 2; SEQ ID NO 20597; 1629pp; English.
XX
CC The present invention relates to a method for modulating the expression
CC of a target gene in a cell comprising contacting an endogenous micro RNA
CC (miRNA) complementary to a portion of a promoter of the target gene with
CC a single-stranded complementary oligonucleotide (see AYE83649-AYF03649)
CC that hybridizes to the miRNA, thereby modulating the expression of the
CC target gene, where the target sequence is selected from SEQ ID 1-20000
CC (see AYE63649-AYE83648). The miRNA targets a non-coding RNA (ncRNA)
CC transcribed from the promoter, and the single-stranded complementary
CC oligonucleotide comprises at least one locked nucleic acid (LNA) base,
CC and at least one 2'-O-methyl (2'-OMe) base. The invention also provides a
CC method for identifying an endogenous miRNA that modulates expression of a
CC target gene, comprising: (i) identifying an endogenous miRNA exhibiting
CC complementarity to a portion of a promoter of the target gene, and (ii)
CC assessing the ability of the complementary miRNA to modulate expression
CC of the target gene. The present sequence is a single-stranded
CC oligonucleotide designed to target miRNAs that bind to a promoter of a
CC target gene, for use in a method for modulating gene expression. These
CC sequences are also termed antagomirs to indicate their ability to
CC antagonize miRNAs.
XX
SQ Sequence 23 BP; 8 A; 9 C; 5 G; 0 T; 1 U; 0 Other;
Query Match 100.0%; Score 23; Length 23;
Best Local Similarity 65.2%;
Matches 15; Conservative 8; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUUUGCACGGGUGGGCCUUGUCU 23
|:::|||||||:|||||::|:|:
Db 23 GTTTGCACGGGTGGGCCTTGTCT 1