DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 03/03/2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Withdrawal of Rejections
The response and amendments filed on 03/03/2026 are acknowledged. Any previously applied minor objections and/or minor rejections (i.e., formal matters), not explicitly restated here for brevity, have been withdrawn necessitated by Applicant’s formality correction and/or amendments. For the purposes of clarity of the record, the reasons for the Examiner’s withdrawal, and/or maintaining, if applicable, of the substantive or essential claim rejections are detailed directly below and/or in the Examiner’s Response to Arguments section.
Briefly, the previous claim rejections under 35 U.S.C. 103 for obviousness have been withdrawn necessitated by Applicant’s amendments; however, new grounds of rejection are set forth below.
The following rejections and/or objections are either reiterated or newly applied. They constitute the complete set presently being applied to the instant application.
Claim Rejections - 35 USC § 103, Obviousness
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1-8 and 12-18 are rejected under 35 U.S.C. 103 as being unpatentable over Vadolas (WO 2008/128299; Publication date: October 30, 2008 – cited in the IDS filed on 09/06/2024; previously cited) in view of Rosen (Discovery of the first known small-molecule inhibitors of the heme-regulated eukaryotic initiation factor 2α (HRI) kinase; 2009 – cited in the IDS filed on 08/18/2022).
Vadolas’ general disclosure relates to a method of treating a hemoglobinopathy in a subject comprising “the administration of an effective amount of an agent which increases fetal hemoglobin levels” (see, e.g., Vadolas at [0018] and claims 1-2 and 25).
Regarding claims 1 and 12 pertaining to increasing fetal hemoglobin (HbF) levels, Vadolas teaches a method of increasing HbF levels through administration of quercetin, a type of eukaryotic translation initiation factor 2-alpha kinase 1 (eIFαK1) inhibitor, to a subject (see, e.g., Vadolas at [0018] and claims 1-2 and 25, note that the treatment of a subject would necessarily include the treatment of cells of the subject), or to a cell (see, e.g., Vadolas at [0029] and claim 2). Accordingly, Vadolas teaches a method of increasing HbF levels through administration of quercetin (eIFαK1 inhibitor) (see, e.g., Vadolas at [0018]) with a pharmaceutically acceptable carrier (see, e.g., Vadolas at [0054] and claim 17).
Regarding claims 2-4 and 13-15, Vadolas teaches that subjects are “selected from the group consisting of β-thalassemia and non-sickle cell hemoglobinopathy” (see, e.g., Vadolas at [0021], [0041] and claim 10), which are β-chain hemoglobinopathies. Moreover, Vadolas teaches treating a condition characterized by polymerization of hemoglobin in the cells of the subject, wherein “A "condition characterized by polymerization of hemoglobin in the cell of a subject" means a condition in which polymerization of hemoglobin S is present in at least one of the subject's cells. Polymerization of hemoglobin S results in the characteristic crescent shape of erythrocytes referred to as sickling. A condition characterized by polymerization of hemoglobin S includes sickle cell anemia, sickle cell β-thalassemia, sickle cell hemoglobin C disease and any other sickle hemoglobinopathy in which hemoglobin S interacts with a hemoglobin other than hemoglobin S” (see, e.g., Vadolas, [0040]-[0041]).
Regarding claim 7, Vadolas teaches that “erythroid cells have been commonly used to evaluate potential inducers of HbF” (see, e.g., Vadolas at [0042] and claim 4), and therefore an artisan would readily envisage methods of treating erythroid cells by administering potential inducers of HbF.
Regarding claims 8 and 18, Vadolas teaches administering multiple combinations of compounds that increase fetal hemoglobin levels (see, e.g., Vadolas at [0035]-[0037]), together with a pharmaceutically acceptable carrier or diluent (see, e.g., Vadolas at [0056] and claim 17) for treating a hemoglobinopathy in a subject in need thereof (see, e.g., Vadolas at [0052] and claim 1).
However, Vadolas does not teach: wherein the eIFαK1 inhibitor is not quercetin (claims 1 and 12); or wherein the eIFαK1 inhibitor, which is not quercetin, is a small molecule (claims 5 and 16); or wherein the eIFαK1 inhibitor, which is not quercetin, is a kinase domain inhibitor or a heme binding domain inhibitor (claims 6 and 17).
Rosen’s general disclosure relates to the discovery of the first known inhibitors of eIFαK1 (HRI), which are indeno[1,2-c]pyrazoles (see, e.g., Rosen, abstract).
Regarding claims 1 and 12 pertaining to the eIFαK1 inhibitor not being quercetin, Rosen teaches aminopyrazolindane, which is an eIFαK1 (HRI) inhibitor (see, e.g., Rosen, Introduction, pg. 6548 & Figure 1).
Regarding claims 5 and 16 pertaining to the eIFαK1 inhibitor being small molecule, Rosen teaches that aminopyrazolindane is a small molecule (see, e.g., Rosen, Introduction, pg. 6548 & Figure 1).
Regarding claims 6 and 17 pertaining to the eIFαK1 inhibitor being a kinase domain inhibitor or a heme binding domain inhibitor, Rosen teaches that aminopyrazolindane is an ATP-competitive HRI kinase inhibitor (see, e.g., Rosen, Introduction, pg. 6548 & Figure 1).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to increase fetal hemoglobin levels by substituting quercetin, as taught by Vadolas, for aminopyrazolindane, as taught by Rosen. One would have been motivated to do so because Rosen teaches that aminopyrazolindane, wherein “small-molecule inhibition of HRI (i.e., eIFαK1) kinase should be expected to promote an increased rate of globin production and hemoglobin levels” (see, e.g., Rosen, Introduction, pg. 6548). Moreover, Vadolas teaches a method of increasing HbF levels through administration of quercetin, a type of eukaryotic translation initiation factor 2-alpha kinase 1 (eIFαK1) inhibitor, to a subject (see, e.g., Vadolas at [0018] and claims 1-2 and 25). Therefore, based on the teachings of Vadolas and Rosen, it would have been obvious to increase fetal hemoglobin levels with aminopyrazolindane because aminopyrazolindane promotes globin production and hemoglobin levels, similar to quercetin. Moreover, Rosen teaches that aminopyrazolindane, like quercetin, is a small molecule that displays ATP-competitive HRI kinase inhibition (see, e.g., Rosen, Introduction, pg. 6548); therefore, aminopyrazolindane and quercetin have the same mechanism of action. One would have expected success because Vadolas and Rosen both teach eIFαK1 inhibitors for increasing hemoglobin production.
Claims 9 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Vadolas and Rosen, as applied to claims 1-8 and 12-18 above, and further in view of Essack (US2014/0356458; Publication Date: December 4, 2014 – previously cited).
The teachings of Vadolas and Rosen, herein referred to as modified-Vadolas-Rosen, are discussed above as it pertains to inducing fetal hemoglobin levels.
However, modified-Vadolas-Rosen does not teach: wherein said fetal hemoglobin inducer is pomalidomide (claims 9 and 19).
Essack’s general disclosure relates to “embodiments for treatment and/or prevention of sickle cell disease” (see, e.g., Essack, abstract). Additionally, Essack discloses methods for inducing HbF production in subjects through the delivery of compounds alone or in conjunction with one another, so that “two or more compounds may act additively or synergistically” (see, e.g., Essack at abs, [0055]).
Regarding claims 9 and 19 pertaining to use of pomalidomide as an HbF inducer, Essack teaches a method of treating an individual with sickle cell disease by delivering “an inducer of HbF production” (see, e.g., Essack at [0033]), and explicitly teaches that the inducer may be pomalidomide (see, e.g., Essack at [0033], [0053], claims 1-3). Accordingly, pomalidomide is a prior art element and art-recognized inducer of fetal hemoglobin production, suitable for use in the treatment of hemoglobinopathies such as sickle cell disease (see, e.g., Essack, claims 1-3).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to induce/increase fetal hemoglobin levels, as taught by modified-Vadolas-Rosen, by administering pomalidomide, as taught by Essack. One would have been motivated to do so because Essack teaches that pomalidomide is a fetal hemoglobin inducer that can be delivered to individuals for the treatment of sickle cell disease (see, e.g., Essack, [0033]). Moreover, modified-Vadolas-Rosen teaches a method of increasing HbF levels through administration of a eukaryotic translation initiation factor 2-alpha kinase 1 (eIFαK1) inhibitor, to a subject (see, e.g., Vadolas at [0018] and claims 1-2 and 25) (see, e.g., Rosen, Introduction, pg. 6548). Therefore, based on the teachings of modified-Vadolas-Rosen and Essack, it would have been obvious to increase fetal hemoglobin levels by administering a pomalidomide because pomalidomide is a HbF inducer. Furthermore, one of ordinary skill in the art would expect that administration of an eIFαK1 inhibitor, as taught by modified-Vadolas-Rosen, and a fetal hemoglobin inducer, such as pomalidomide, as taught by Essack, would result in additive, or even synergistic, increases in fetal hemoglobin levels since both the eIFαK1 inhibitor and pomalidomide induce fetal hemoglobin expression. One would have expected success because modified-Vadolas-Rosen and Essack both teach methods of increasing fetal hemoglobin levels.
Claims 10-11 and 20-21 are rejected under 35 U.S.C. 103 as being unpatentable over Vadolas and Rosen, as applied to claims 1-8 and 12-18 above, and further in view of Renneville (EHMT1 and EHMT2 inhibition induces fetal hemoglobin expression; 2015 – cited in the IDS filed on 09/06/2024; previously cited).
The teachings of Vadolas and Rosen, herein referred to as modified-Vadolas-Rosen, are discussed above as it pertains to inducing fetal hemoglobin levels.
However, modified-Vadolas-Rosen does not teach: wherein the fetal hemoglobin inducer is a histone methyltransferase (HMT) inhibitor (claims 10 and 20); or wherein said HMT inhibitor is UNC0638 (claims 11 and 21).
Renneville’s general disclosure relates to the induction of γ-globin through inhibition of HMTs by UNC0638 and RNA-mediated knockdown of various HMT genes (see, e.g., Renneville, abstract). RNA sequencing analysis of erythroblasts by Renneville discloses that γ-globin genes were among the most significantly upregulated genes by UNC0638, resulting in an increase in HbF levels (see, e.g., Renneville, pg. 1932 at results).
Regarding claims 10-11 and 20-21 pertaining to a HMT inhibitors and UNC0638, Renneville teaches administration of UNC0638, which is an HMT inhibitor, and which “selectively inhibits the catalytic activity” of histone methyltransferases to increase HbF expression (see, e.g., Renneville at pg. 1932 at results).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to induce/increase fetal hemoglobin levels, as taught by modified-Vadolas-Rosen, by administering an HMT inhibitor, such as UNC0638, as taught by Renneville. One would have been motivated to do so because Renneville teaches that inhibition of HMTs results in “induced γ-globin gene expression and HbF synthesis” in human erythrocytes (see, e.g., Renneville at pg. 1936 at discussion). Moreover, modified-Vadolas-Rosen teaches a method of increasing HbF levels through administration of a eukaryotic translation initiation factor 2-alpha kinase 1 (eIFαK1) inhibitor, to a subject (see, e.g., Vadolas at [0018] and claims 1-2 and 25) (see, e.g., Rosen, Introduction, pg. 6548). Therefore, based on the teachings of modified-Vadolas-Rosen and Renneville, it would have been obvious to administer an HMT inhibitor because HMTs increase HbF expression. Furthermore, one of ordinary skill in the art would expect that administration of an eIFαK1 inhibitor, as taught by modified-Vadolas-Rosen, and an HMT inhibitor, such as UNC0638, as taught by Renneville, would result in additive, or even synergistic, increases in fetal hemoglobin levels since both the eIFαK1 inhibitor and HMT inhibitor induce fetal hemoglobin expression. One would have expected success because modified-Vadolas-Rosen and Renneville both teach methods of increasing fetal hemoglobin levels.
Claim 22 is rejected under 35 U.S.C. 103 as being unpatentable over Vadolas and Rosen, as applied to claims 1-8 and 12-18 above, and further in view of Orkin (US 2014/0271657; Date of Publication: September 18, 2014 – previously cited).
The teachings of Vadolas and Rosen, herein referred to as modified-Vadolas-Rosen, are discussed above as it pertains to inducing fetal hemoglobin levels.
However, modified-Vadolas-Rosen does not teach: wherein the eIF2αK1 inhibitor is contained within a cell administered to the subject (claim 22).
Orkin’s general disclosure relates to “combinatorial compositions and methods for increasing HbF expression for the treatment and/or amelioration of the symptoms of hemoglobinopathy” (see, e.g., Orkin at [0008]). Moreover, Orkin discloses a combination of inhibitors of BCL11A expression and inhibitors of DNA methylation and/or inhibitors of histone deacetylases for increasing HbF expression and treating hemoglobinopathies (see, e.g., Orkin at [0008]).
Regarding claim 22 pertaining to inhibitors contained within cells, Orkin teaches a method of treating a hemoglobinopathy, in which “an ex vivo strategy can also be used for therapeutic applications, for example, contacting cells ex vivo and administering the contacted cells to the patient” (see, e.g., Orkin at [0210]).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to administer an eIFαK1 inhibitor, as taught by modified-Vadolas-Rosen, that is contained within a cell, as taught by Orkin. One would have been motivated to do so because Orkin teaches the “HbF expression is increased in said cell, or its progeny, relative to HbF expression in said cell prior to contacting” and prior to administration (see, e.g., Orkin at [0243]). Moreover, modified-Vadolas-Rosen teaches a method of increasing HbF levels through administration of a eukaryotic translation initiation factor 2-alpha kinase 1 (eIFαK1) inhibitor, to a subject (see, e.g., Vadolas at [0018] and claims 1-2 and 25) (see, e.g., Rosen, Introduction, pg. 6548).Therefore, based on the teachings of modified-Vadolas-Rosen and Orkin, it would have been obvious to administer the eIF2αK1 inhibitor contained within a cell to a patient. One would have expected success because modified-Vadolas-Rosen and Orkin both teach methods of increasing fetal hemoglobin levels.
Claims 23-24 are rejected under 35 U.S.C. 103 as being unpatentable over Vadolas and Rosen, as applied to claims 1-8 and 12-18 above, and further in view of Collard (WO 2010/127195; Date of Publication: September 1, 2011 – previously cited).
The teachings of Vadolas and Rosen, herein referred to as modified-Vadolas-Rosen, are discussed above as it pertains to inducing fetal hemoglobin levels.
Regarding claims 23-24 pertaining to the eIFαK1 inhibitor, modified-Vadolas-Rosen teaches a small molecule inhibitor of eIFαK1 to increase fetal hemoglobin levels (see, e.g., Rosen, Introduction, pg. 6548 & Figure 1).
However, modified-Vadolas-Rosen does not teach: wherein the eIFαK1 inhibitor is an antisense molecule, siRNA, or shRNA (claims 23-24).
Collard’s general disclosure pertains to antisense compounds for modulating the expression and/or function of globin genes to treat diseases associated with globins (see, e.g., Collard, abstract).
Regarding claims 23-24 pertaining to the eIFαK1 inhibitor being an antisense molecule, Collard teaches antisense compounds for modulating the expression and/or function of globin genes (see, e.g., Collard, abstract). Although Collard does not explicitly teach an antisense molecule targeting eIFαK1 for inhibition, Collard does state “Additional target segments are readily identifiable by one having ordinary skill in the art in view of this disclosure” (see, e.g., Collard, [0071]), and “one or more implementations, equivalent alterations and modifications will occur to others skilled in the art upon the reading and understanding of this specification” (see, e.g., Collard, [00200]); therefore, one of ordinary skill in the art would be able to utilize the methods set forth by Collard to produce an antisense molecule that targets the eIFαK1 gene for eIFαK1 inhibition.
It would have been obvious to one of ordinary skill in the art to substitute the eIFαK1 small molecule inhibitor, as taught by modified-Vadolas-Rosen, for Collard’s antisense compound. One would have been motivated to do so because Collard teaches “oligonucleotides typically contain at least one region of modified nucleotides that confers one or more beneficial properties (such as, for example, increased nuclease resistance, increased uptake into cells, increased binding affinity for the target)”. Moreover, modified-Vadolas-Rosen teaches a method of increasing HbF levels through administration of a eukaryotic translation initiation factor 2-alpha kinase 1 (eIFαK1) inhibitor, to a subject (see, e.g., Vadolas at [0018] and claims 1-2 and 25) (see, e.g., Rosen, Introduction, pg. 6548). Therefore, based on the teachings of modified-Vadolas-Rosen and Collard, it would have been obvious to use an antisense molecule, wherein the antisense molecule is an eIFαK1 inhibitor, for inducing HbF expression. One would have expected success because modified-Vadolas-Rosen and Collard both teach methods of increasing fetal hemoglobin levels.
Claims 25-26 are rejected under 35 U.S.C. 103 as being unpatentable over Vadolas and Rosen, as applied to claims 1-8 and 12-18 above, and further in view of Doench (Rational design of highly active sgRNAs for CRISPR-Cas9–mediated gene inactivation; 2014 – newly cited – herein referred to as “Doench2014”) and Doench (Optimized sgRNA design to maximize activity and minimize off-target effects of CRISPR-Cas9; 2016 – newly cited – herein referred to as “Doench2016”).
The teachings of Vadolas and Rosen, herein referred to as modified-Vadolas-Rosen, are discussed above as it pertains to inducing fetal hemoglobin levels.
However, modified-Vadolas-Rosen does not teach: wherein the eIFαK1 inhibitor comprises administering at least one Cas9 and at least one eIFαK1 guide RNA (claims 25 and 26).
Doench2014’s general disclosure relates to creating “a pool of sgRNAs, tiling across all possible target sites of a panel of six endogenous mouse and three endogenous human genes and quantitatively assessed their ability to produce null alleles of their target gene by antibody staining and flow cytometry. We discovered sequence features that improved activity, including a further optimization of the protospacer-adjacent motif (PAM) of Streptococcus pyogenes Cas9. The results from 1,841 sgRNAs were used to construct a predictive model of sgRNA activity to improve sgRNA design for gene editing and genetic screens. We provide an online tool for the design of highly active sgRNAs for any gene of interest” (see, e.g., Doench2014, abstract).
Regarding claims 25 and 26 pertaining to the eIFαK1 inhibitor comprising a Cas9 and eIFαK1 guide RNA, Doench2014 teaches the development of guide RNAs which are delivered to Cas9-expressing lines (see, e.g., Doench2014, Methods, “Library Design” - “Cas9 activity assay”).
Doench2016’s general disclosure relates to a “recently devised sgRNA design rules to create human and mouse genome-wide libraries, perform positive and negative selection screens and observe that the use of these rules produced improved results. Additionally, we profile the off-target activity of thousands of sgRNAs and develop a metric to predict off-target sites. We incorporate these findings from large-scale, empirical data to improve our computational design rules and create optimized sgRNA libraries that maximize on-target activity and minimize off-target effects to enable more effective and efficient genetic screens and genome engineering” (see, e.g., Doench2016, abstract).
Regarding claims 25 and 26 pertaining to the eIFαK1 inhibitor comprising a Cas9 and eIFαK1 guide RNA, Doench2016 teaches the guide RNA sequence for eIFαK1 (see, e.g., Doench2016, Supplemental Table 2). Doench2016 teaches that the guide RNA sequence is ATGAACATGTTCTATCCACG and the annotated gene ID is 27102 (see, e.g., Doench2016, Supplemental Table 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to substitute the eIFαK1 small molecule inhibitor, as taught by modified-Vadolas-Rosen, for an eIFαK1 guide RNA and Cas9, as taught by Doench2014 and Doench2016. One would have been motivated to do so because Doench2014 teaches “When introduced into mammalian cells, the Cas9:sgRNA complex creates sequence-specific double-strand (ds)DNA breaks that are repaired by the error-prone nonhomologous end-joining (NHEJ) pathway, often resulting in gene inactivation by the creation of frameshift alleles (see, e.g., Doench2014, Introduction, pg. 1262). Furthermore, Doench2014 teaches that the Cas9:sgRNA complex is used to knockout specific genes in cells resulting in full gene inactivation (see, e.g., Doench2014, Introduction, pg. 1262). Additionally, Doench2016 teaches the guide RNA sequence for eIFαK1 (see, e.g., Doench2016, Supplemental Table 2); therefore, this gene can be knocked out using the Cas9:sgRNA complex. Moreover, modified-Vadolas-Rosen teaches a method of increasing HbF levels through administration of a eukaryotic translation initiation factor 2-alpha kinase 1 (eIFαK1) inhibitor, to a subject (see, e.g., Vadolas at [0018] and claims 1-2 and 25) (see, e.g., Rosen, Introduction, pg. 6548). Therefore, based on the teachings of modified-Vadolas-Rosen, Doench2014, and Doench2016, it is obvious that knocking out or inactivating eIFαK1 using the Cas9:sgRNA complex would also result in increased HbF levels. One would have expected success because modified-Vadolas-Rosen, Doench2014, and Doench2016 all teach methods of inactivating cellular complex.
Examiner’s Response to Arguments
Applicant's arguments filed 03/03/2026 have been fully considered but they are not persuasive.
Regarding Applicant’s argument that Vadolas never teaches that quercetin is a type of eIFαK1 inhibitor (remarks, page 8), this argument is not persuasive because quercetin is inherently an eIFαK1 inhibitor. The instant specification teaches “Quercetin has
also been identified as an ATP-competitive kinase inhibitor of eIF2aK1 (Srivastava et
al. (1986) Prog. Clin. Biol. Res., 213:315-8; Kanelakis et al. (2009) Adv. Hematol.,
251915)” (see, e.g., instant specification, pg. 7, lines 30-33). Furthermore, the instant specification cites multiple research papers showing that quercetin, prior to the effective filing date of this application, is an inhibitor of eIF2aK1; therefore, one of ordinary skill in the art would be able to apply these papers to the teachings of Vadolas to understand that quercetin, as taught by Vadolas, is a eIF2aK1 inhibitor. Therefore, Vadolas does not need to teach or suggest that quercetin is a eIF2aK1 inhibitor since this is known in the art and an inherent property of quercetin.
Regarding Applicant’s argument that the instant application specifically excludes the administration of quercetin and Vadolas does not provide guidance on how to select for another eIF2aK1 inhibitor (remarks, pages 8-9), this argument is not persuasive because Rosen teaches aminopyrazolindane, which is an eIFαK1 (HRI) inhibitor (see, e.g., Rosen, Introduction, pg. 6548 & Figure 1). One of ordinary skill in the art would be motivated to substitute quercetin, as taught by Vadolas, for aminopyrazolindane, as taught by Rosen, because they are both functional equivalents since they both inhibit eIFαK1. Since Vadolas shows that quercetin inhibits eIF2aK1, which results in an increase in HbF levels (see, e.g., Vadolas at [0018]), one of ordinary skill in the art would expect a similar increase in HbF levels following administration of aminopyrazolindane since aminopyrazolindane is also a eIFαK1 inhibitor.
Regarding Applicant’s argument that the supportive evidence of Pabuprapap teaches that quercetin has many properties associated with it and does not suggest that quercetin inhibits eIFαK1 for increasing fetal hemoglobin (remarks, pages 9-11), this argument is not persuasive because, as discussed above, the instant specification teaches and cites multiple research papers showing that quercetin is an inhibitor of eIFαK1 (see, e.g., instant specification, pg. 7, lines 30-33). The other properties exhibited by quercetin are not relevant to the instantly claimed invention; therefore, Applicant’s argument that quercetin exhibits anti-inflammatory properties, anticancer activity, antioxidant activity and α-glucosidase inhibitory activity is not relevant, as the instantly claimed invention pertains to administering an eIFαK1 inhibitor that is not quercetin. The instantly claimed invention pertains to an eIFαK1 inhibitor, which quercetin inherently is. However, the instantly claimed invention claims that the eIFαK1 inhibitor is not quercetin; therefore, the teachings of Rosen, which teaches aminopyrazolindane as the eIFαK1 inhibitor, was used (see, e.g., Rosen, Introduction, pg. 6548 & Figure 1).
Regarding Applicant’s argument that there is no nexus between inhibiting eIFαK1 and increasing fetal hemoglobin production (remarks, page 13), this argument is not persuasive because, as discussed above, quercetin is known in the art and taught in the instant specification to be an eIFαK1 inhibitor. Additionally, Vadolas shows that quercetin inhibits eIF2aK1, which results in an increase in HbF levels (see, e.g., Vadolas at [0018]). Therefore, the art does indeed teach that inhibiting eIFαK1 results in an increase in fetal hemoglobin levels. Moreover, Rosen teaches aminopyrazolindane, which is an eIFαK1 (HRI) inhibitor (see, e.g., Rosen, Introduction, pg. 6548 & Figure 1). Therefore, quercetin and aminopyrazolindane are functional equivalents and one of ordinary skill in the art would expect aminopyrazolindane to also result in an increase in fetal hemoglobin levels upon administration.
Conclusion
Claims 1-26 are rejected.
No claims are allowed.
Correspondence Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to NATALIE IANNUZO whose telephone number is (703)756-5559. The examiner can normally be reached Mon - Fri: 8:30-6:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Sharmila Landau can be reached at (571) 272-0614. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/NATALIE IANNUZO/Examiner, Art Unit 1653
/SHARMILA G LANDAU/Supervisory Patent Examiner, Art Unit 1653
Prosecution Insights