DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Response to Amendment/Status of Claims
Receipt of Arguments/Remarks filed on 08/21/2025 is acknowledged. Claims 1,3,5,7 and 9-12 were cancelled. Claims 13,15,16,18,22 and 24 were amended. Claims 47-53 are new. Claims 13,15,16,18,20-24,26,39,40,43,45 and 47-53 are pending.
Applicant elected Group II (claims 13,15,16,18,20-24,26,39,40 and 43) without traverse in the reply filed on 04/29/2025. Claim 45 remains withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. New claims 52 and 53 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Claims 13,15,16,18,20-24,26,39,40,43 and 47-51 are under examination.
Response to Arguments
Applicant’s arguments and amendments, see page 1, filed 08/21/2025, with respect to the objections to the drawings have been fully considered and are persuasive. The objection to the drawings has been withdrawn due to the amendments to FIGS. 9,11,13,15,17 and 18 which properly label each graph.
Applicant’s arguments and amendments, see page 1, filed 08/21/2025, with respect to the objection to claim 13 have been fully considered and are persuasive. The objection to claim 13 has been withdrawn due to the amendment to claim 13 reciting the full gene name for KRAS.
Applicant’s arguments and amendments, see pages 1-2, filed 08/21/2025, with respect to the 35 U.S.C. 112(b) rejections of claims 15,16,18,22 and 24 as being indefinite have been fully considered and are persuasive. The rejection has been withdrawn due to the amendments to claim 15 correcting the SEQ ID NOs, removing “optionally” from claims 16 and 18, and removing “near” from claim 18, and providing italicized letters for the modifications in claims 22 and 24.
Applicant’s arguments and amendments, see pages 2-4, filed 08/21/2025, with respect to the rejection(s) of claim(s) 13,16,18,20,23,39 and 43 under 35 U.S.C. 102(a)(2) as anticipated by US 20180273577; claim 15 under 35 U.S.C. 103 as unpatentable under ‘577 and Sorenson; claims 22 and 24 as unpatentable over ‘577 and Sorenson and further in view of Lee et al.; claim 21 as unpatentable over ‘577 and Lee et al.; claim 26 as unpatentable over ‘577 and Phillips; and claim 40 as unpatentable over ‘577 have been fully considered and are persuasive due to the amendments canceling the specific sequences being examined. Therefore, the rejections have been withdrawn. However, upon further consideration, new grounds of rejections are made in view of the amendments to claims 13,15,22 and 24 canceling the examined sequences and leaving SEQ ID NOs: 119 and 120 in claim 13, SEQ ID NOs: 126 and 127 in claim 15, SEQ ID NOs: 72 and 73 in claim 22 and SEQ ID NOs: 76 and 77 in claim 24 which have not been examined.
Applicant’s arguments and amendments, see pages 4-6, filed 08/21/2025, with respect to the rejection(s) of claim(s) 13,16,18,20,23,39 and 43 on the ground of nonstatutory double patenting as unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of ‘577, as well as claim 15 on the ground of nonstatutory double patenting as unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of ‘577 and Sorenson; claims 22 and 24 on the ground of nonstatutory double patenting as unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of ‘577, Sorenson and Lee; claim 21 on the ground of nonstatutory double patenting as unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of ‘577 and Lee; claim 26 on the ground of nonstatutory double patenting as unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of ‘577 and Phillips; and claim 40 on the ground of nonstatutory double patenting as unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of ‘577 have been fully considered and are persuasive. Therefore, the rejections have been withdrawn. However, upon further consideration, new grounds of rejections are made in view of the amendments to claims 13,15,22 and 24 canceling the examined sequences and leaving SEQ ID NOs: 119 and 120 in claim 13, SEQ ID NOs: 126 and 127 in claim 15, SEQ ID NOs: 72 and 73 in claim 22 and SEQ ID NOs: 76 and 77 in claim 24 which have not been examined.
The following rejections and/or objections are either reiterated or newly applied. They constitute the complete set presently being applied to the instant application.
Priority
This application is a divisional of 16/842,404 (04/07/2020) which is a continuation in part of 16/070,600 (07/17/2018), which is a 371 of International PCTUS2017014013 (01/19/2017) which claims benefit of 62/280458 (01/19/2016), as reflected in the filing receipt dated 12/01/2021.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 08/21/2025 is in compliance with the provisions of 37 CFR 1.97, and therefore is being considered by the examiner.
Claim Objections
Claim 13 is objected to because of the following informalities: SEQ ID NO: 117 targeted to a human KRAS mRNA encoding a G12C mutation and SEQ ID NO: 118 targeted to a human KRAS mRNA encoding a G12D mutation was canceled in claim 13. However line 3 of claim 13 still recites that the antisense oligonucleotide is targeted to a KRAS mRNA encoding a mutation selected from G12C, G12D, G12V and G13D. As the sequences targeting the G12C and G12D mutations were canceled, these same mutations should also be canceled in line 3. Appropriate correction is required.
In addition, option c) in claim 13 recites “a sequence at least 90% identical to any one of a) to b). As there are only two options, it would be more appropriate to recite “a sequence at least 90% identical to a) or b)”. Appropriate correction is required.
Claim Rejections - 35 USC § 102
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 13,16,18,20,23,39,43 and 47-49 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by US 20180273577 (‘577), effectively filed 24 Sept 2015.
Claim Interpretation: Regarding claim 13, the structure of SEQ ID NO: 119 would target a human KRAS mRNA encoding a G12V mutation, and the structure of SEQ ID NO: 120 would target a human KRAS mRNA encoding a G13D mutation, because a structure and all its properties are inseparable.
Regarding claim 13, ‘577 teaches compounds and compositions for inhibiting KRAS expression (paragraph 0002), including antisense oligonucleotides (paragraph 0175). ‘577 recites a compound comprising a modified oligonucleotide consisting of 8-80 linked nucleosides and comprising the nucleobase sequence of any one of SEQ ID NOs: 13-2190 (claim 2). SEQ ID NO:2057 of ‘577 is 16 nucleotides in length and has 100% identity to instant SEQ ID NO: 119. See alignment below, wherein Qy is instant SEQ ID NO: 119 and Db is SEQ ID NO: 2057 of ‘577:
PNG
media_image1.png
88
356
media_image1.png
Greyscale
SEQ ID NO: 2057 is also shown in Table 30 on page 107.
Regarding claim 16, ‘577 recites the modified oligonucleotide comprises at least one modified internucleoside linkage, wherein the modified internucleoside linkage is a phosphorothioate internucleoside linkage (claim 17).
Regarding claim 18, ‘577 recites the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides, a 5’ wing segment consisting of linked nucleosides and a 3’ wing segment consisting of linked nucleotides, wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleotide of each wing segment comprises a modified sugar (claim 8). Therefore, ‘577 teaches an antisense oligonucleotide comprising at least one modified nucleotide within 5 nucleotides of the 5’ end and/or 3’ end of SEQ ID NO: 2057.
Regarding claim 20, ‘577 recites the modified oligonucleotide comprises at least one modified sugar, wherein the modified sugar is 2’-O-methoxyethyl (claim 20). Claim 20 depends on claim 16 which depends back to claim 8 reciting the gap and wing structure and sugar modification in each nucleotide of each wing segment and therefore anticipates.
Regarding claim 23, ‘577 recites the modified oligonucleotide comprises a modified sugar which is a locked nucleic acid (claim 19). Claim 19 depends on claim 18, which depends on claim 16 which depends on claim 8 reciting the gap and wing structure and sugar modification in each nucleotide of each wing segment. ‘577 also discloses each nucleoside in the 5′ wing segment and each nucleoside in the 3′ wing segment has a cEt sugar modification, and therefore anticipates (paragraph 0365 describing the oligonucleotides in Table 30 which includes SEQ ID NO: 2057).
Regarding claims 39 and 43, ‘577 recites a composition comprising the compound of any one of claims 1-37 and a pharmaceutically acceptable carrier (claim 38).
Regarding claim 47, ’577 recites a compound comprising a modified oligonucleotide consisting of 8-80 linked nucleosides and comprising the nucleobase sequence of SEQ ID NO: 2057 (claim 2), and also recites wherein the modified oligonucleotide consists of 10-30,12-30,15-30 or 16-30 linked nucleosides (claim 28). As the length of 20 nucleotides of instant claim 47 falls within the claimed range of 8-80 nt recited in claim 2 of ‘577 and within the claimed ranges of claim 28 of ‘577 (10-30,12-30,15-30,16-30 nt), it anticipates.
Regarding claim 48, ‘577 teaches gapmer antisense oligonucleotides in Table 30 designed as 3-10-3 gapmers, and the internucleoside linkages throughout each gapmer are phosphorothioate linkages and includes SEQ ID NO: 2057 in Table 30 (paragraph 0365, Table 30 page 107).
Regarding claim 49, ‘577 teaches gapmer antisense oligonucleotides in Table 30 designed as 3-10-3 gapmers, and each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has a cEt sugar modification and includes SEQ ID NO: 2057 in Table 30 (paragraph 0365, Table 30 page 107). Therefore, ‘577 teaches at least 3 modified nucleotides at each of the 5’ and 3’ end.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over US 20180273577 (‘577), as applied to claims 13,16,18,20,23,39,43 and 47-49 above, and further in view of Sorenson (U.S. Patent No. 6,020,124), Issued 1 Feb. 2000.
The teachings of ‘577 as applicable to claims 13,16,18,20,23,39,43 and 47-49 are described above.
‘577 does not teach wherein the antisense oligonucleotide consists of the sequence of GCACTCTTGCCTACGCCAAC (SEQ ID NO: 126).
However, before the effective filing date, Sorenson teaches mutated oncogenes are associated with particular types of tumors, including K-ras genes with mutations in positions 1 or 2 of codon 12 (Column 1, lines 49-54), and that the ability to detect sequences of mutated oncogenes in small samples of biological fluid such as blood plasma would provide a useful diagnostic tool, and the presence of mutated K-ras gene sequences in plasma would be indicative of the presence in the patent of a tumor which contains mutated oncogenes (Column 1, lines 60-65). Sorenson teaches oligonucleotides for use with LCR for allele-specific ligation and amplification to identify mutations at position 1 in codon 12 of the K-ras gene in Table II, and teaches SEQ ID NO: 13 (column 10). SEQ ID NO: 13 of Sorenson is 20 nucleotides in length and is therefore the same length as instant SEQ ID NO: 126 and is 92% identical to SEQ ID NO: 126. See alignment below, wherein Qy is instant SEQ ID NO: 126 and Db is SEQ ID NO: 13 of Sorenson.
PNG
media_image2.png
94
395
media_image2.png
Greyscale
SEQ ID NO: 13 of Sorenson includes the “GCAC” as the first four nucleotides that were not included in the 16-mer of ‘577 of SEQ ID NO: 2057, and all but one nucleotide of SEQ ID NO: 13 of Sorenson is the same as instant SEQ ID NO: 126 and SEQ ID NO: 2057 teaches the same sequence TCTTGCCTACGCCAAC as nucleotides 5-20 of instant SEQ ID NO: 126.
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the modified oligonucleotide of SEQ ID NO: 2057 of ‘577 to comprise ‘GCAC’ at the 5’ end of the antisense oligonucleotide of SEQ ID NO: 2057 of ‘577 based on the oligonucleotide of Sorenson, with a reasonable expectation of success. There would be a reasonable expectation of success because both the oligonucleotide sequences of ‘577 and Sorenson are directed to mutant KRAS gene sequences, the oligonucleotide of Sorenson (SEQ ID NO: 13) is the same length as the instant recited sequence of SEQ ID NO: 126 and has 92% identity thereto, and the oligonucleotide of ‘577 (SEQ ID NO: 2057) is 100% identical to nucleotides 5-20 of instant SEQ ID NO: 126. One of ordinary skill in the art would have been motivated to provide an antisense oligonucleotide consisting of the sequence “GCACTCTTGCCTACGCCAAC” based on the combined teachings of ‘577 and Sorenson and because Sorenson teach the need for a diagnostic tool with the ability to detect sequences of mutated oncogenes in small samples of biological fluid such as blood plasma and the presence of mutated K-ras gene sequences in plasma would be indicative of the presence in the patent of a tumor which contains mutated oncogenes, and would make obvious the limitations of claim 15.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Claims 22 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over ‘577 and Sorenson as applied to claim 15 above, and further in view of Lee et al. (J. of Cardiovasc. Trans. Res. (2013) 6:969-980).
The teachings of ‘577 and Sorenson as applicable to claim 15 are described above.
‘577 teaches gapmer antisense oligonucleotides designed as 3-10-3 cEt gapmers, where the central gap segment comprises 10 2’-deoxynucleosides and is flanked by wing segments on the 5’ direction and the 3’ direction comprising three nucleosides each, and each nucleoside in the 5’ wing segment and each nucleoside in the 3’ wing segment has a cEt sugar modification and the internucleoside linkages through each gapmer are phosphorothioate linkages (Paragraph 0365, page 105).
‘577 and Sorenson do not teach the gapmer modification motif recited in instant claims 22 wherein the 5 nucleotides in the 5’ wing and the 3’ wing are 2’-MOE modified nucleotides, or the specific position of the locked nucleic acid in SEQ ID NO: 76.
However, before the effective filing date, Lee et al. teach the benefits regarding the gapmer design for antisense oligonucleotides, in which the flanking regions of the ASO contain 2’-MOE or LNA modifications while the center contains unmodified sugars that serve as suitable substrates for RNAase H-mediated cleavage (page 970, left column and Figure 1b). Lee teaches the gapmer design provides enhanced stability, increased potency, and reductions in non-specific toxicities, and that the second-generation ASOs (2’-MOE gapmers) have been widely used in vivo (page 970, left column). Lee teaches in Fig. 1b that in order to facilitate RNase H activity, unmodified DNA is included in the internal, typically ten nucleotides (“the gap”), and the gap is flanked on the 5’ and 3’ ends with 2-5 of the MOE/LNA-modified nucleotides which enhances ASO stability and affinity for target RNA.
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to further modify the antisense oligonucleotides of ‘577 and Sorenson with the teachings of Lee et al. regarding gapmer design and benefits with a reasonable expectation of success as all of the teachings pertain to antisense oligonucleotides, and ‘577 and Lee et al. pertain to gapmer antisense oligonucleotides. In addition, ‘577 already taught 5’ and 3’ wings with modified cEt modifications, all phosphorothioate linkages, and also that the modified oligonucleotide comprises a modified sugar which is a locked nucleic acid (claim 19). This would have amounted to applying a known technique (ASO gapmer design of Lee et al.) to a known product (the modified ASO sequences of ‘577 and Sorenson) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to provide the modifications as recited in instant claims 22 and 24 to the modified antisense oligonucleotides of ‘577 that have all phosphorothioate linkages and which have wings with modified cEt and/or LNA sugars, and the oligonucleotide of Sorenson because Lee et al. teach the benefits of the gapmer design include enhanced stability, increased potency, and reductions in non-specific toxicities and teach that that in order to facilitate RNase H activity, unmodified DNA is included in the internal, typically ten nucleotides (“the gap”), and the gap is flanked on the 5’ and 3’ ends with 2-5 of the MOE-modified nucleotides which enhances ASO stability and affinity for target RNA. An ordinary artisan could use the combined teachings regarding gapmer design of ‘577 and Lee et al. to arrive at the instant gapmer arrangement because Lee et al. teach the 10 nucleotide length of the gap flanked on the 5’ and 3’ ends with up to 5 MOE/LNA modified nucleotides, and one would be motivated to optimize the placement of the LNA modified nucleotide at one of the 5 nucleotides in the 3’ wing segment with a reasonable expectation of success. Accordingly, the limitations of claims 22 and 24 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Claim 21 is rejected under 35 U.S.C. 103 as being unpatentable over US 20180273577 (‘577), as applied to claims 13,16,18,20,23,39,43 and 47-49 above, and further in view of Lee et al. (J. of Cardiovasc. Trans. Res. (2013) 6:969-980).
The teachings of ‘577 as applicable to claims 13,16,18,20,23,39,43 and 47-49 are described above.
‘577 does not teach wherein the antisense oligonucleotide comprises at least three 2’-MOE modified nucleotides at each of the 5’ end and/or the 3’ end.
However, before the effective filing date, Lee et al. teach the benefits regarding the gapmer design for antisense oligonucleotides, in which the flanking regions of the ASO contain 2’-MOE or LNA modifications while the center contains unmodified sugars that serve as suitable substrates for RNAase H-mediated cleavage (page 970, left column and Figure 1b). Lee teaches the gapmer design provides enhanced stability, increased potency, and reductions in non-specific toxicities, and that the second-generation ASOs (2’-MOE gapmers) have been widely used in vivo (page 970, left column). Lee teaches in Fig. 1b that in order to facilitate RNase H activity, unmodified DNA is included in the internal, typically ten nucleotides (“the gap”), and the gap is flanked on the 5’ and 3’ ends with 2-5 of the MOE/LNA-modified nucleotides which enhances ASO stability and affinity for target RNA.
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to modify the modified antisense oligonucleotide of ‘577 with the teachings of Lee et al. with a reasonable expectation of success as this would have amounted to applying a known technique (ASO gapmer design of Lee et al.) to a known product (the modified ASO sequence of ‘577) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to provide at least 3 2’-MOE modified nucleotides at each of the 5’ end and/or the 3’ end of the antisense oligonucleotide of ‘577 because Lee et al. teach the benefits of the gapmer design include enhanced stability, increased potency, and reductions in non-specific toxicities and teach that that in order to facilitate RNase H activity, unmodified DNA is included in the internal, typically ten nucleotides (“the gap”), and the gap is flanked on the 5’ and 3’ ends with 2-5 of the MOE-modified nucleotides which enhances ASO stability and affinity for target RNA, and would make obvious the limitations of claim 21.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Claim 26 is rejected under 35 U.S.C. 103 as being unpatentable over US 20180273577 (‘577), as applied to claims 13,16,18,20,23,39,43 and 47-49 above, and further in view of Phillips (Hypertension Vol. 29, Issue 1, January 1997, pages 177-187).
The teachings of ‘577 as applicable to claims 13,16,18,20,23,39,43 and 47-49 are described above.
‘577 does not teach a nucleic acid molecule encoding the antisense oligonucleotide.
However, before the effective filing date, Phillips teaches that viral vectors have been developed to deliver antisense DNA, and include retrovirus and adenovirus, and that the adeno-associated virus (AAV) vector is the vector of choice for ultimate use in gene therapy as it offers safety because it is nonpathogenic, has longevity because it integrates into the genome, and has sufficient carrying capacity (Abstract). Phillips teaches that an antisense oligonucleotides 12-15 nucleotides long is specific enough to be complementary to a single sequence, and increasing the length of the antisense should result in higher level of specificity, but it decreases its uptake into cells, however with viral vectors, the uptake problem is overcome because the virus freely enters cells by binding to viral receptors on cell membranes, and in a viral vector a full length DNA-antisense sequence can be used (Pharmacology of AS-ODNs, page 179).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to provide the antisense oligonucleotide of ‘577 in a vector encoding the antisense oligonucleotide with a reasonable expectation of success. An ordinary artisan would have been motivated to do so because Phillips teaches viral vector delivery of antisense DNA and the benefits of AAV vector use include safety, longevity, and sufficient carrying capacity, and that viral vectors allow sufficient uptake of antisense DNA into cells, and would make obvious the limitations of claim 26.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Claims 40 is rejected under 35 U.S.C. 103 as being unpatentable over US 20180273577 (‘577), as applied to claims 13,16,18,20,23,39,43 and 47-49 above and further in view of Xie et al. (US 20100286241), cited on an IDS.
The teachings of ‘577 as applicable to claims 13,16,18,20,23,39,43 and 47-49 are described above.
‘577 teaches that the present invention provides pharmaceutical compositions comprising one or more antisense compounds (paragraph 0340). ‘577 teaches that administering a compound targeted to KRAS can be used for treating cancer in an individual (paragraph 0166).
‘577 does not explicitly teach a composition comprising two or more antisense oligonucleotides comprising instant SEQ ID NOs: 119 and 120 or a sequence at least 90% identical thereto.
Xie et al. teach siRNA polynucleotides comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-474, and which inhibits the expression of K-ras polypeptide (paragraph 0019), and also teaches a composition comprising any one or more of the siRNA polynucleotides described herein and a physiologically acceptable carrier (paragraph 0021). SEQ ID NO: 312 is shown on page 27 in Table 8 of Xie et al. as the antisense sequence of the siRNA that targets mutation K-ras K13/Asp. SEQ ID NO: 312 of Xie et al. is 25 nucleotides in length and nucleotides 8-23 of SEQ ID NO: 312 are 100% identical to nucleotides 1-16 of instant SEQ ID NO: 120, but include 5 conservative substitutions. See alignment below wherein Qy is instant SEQ ID NO: 120 and Db is SEQ ID NO: 312 of Xie et al. :
PNG
media_image3.png
93
368
media_image3.png
Greyscale
Xie et al. teach any polynucleotide of the invention may be further modified to increase stability or reduce cytokine production in vivo and possible modifications include, but are not limited to, the addition of flanking sequences at the 5′ and/or 3′ ends; the use of phosphorothioate or 2′ O-methyl rather than phosphodiester linkages in the backbone; and/or the inclusion of nontraditional bases (paragraph 0074), and the polynucleotides of the invention can be chemically modified in a variety of ways to achieve a desired effect. In certain embodiments, oligonucleotides of the invention may be 2′-O-substituted oligonucleotides (paragraph 0075).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to combine the modified antisense oligonucleotide of SEQ ID NO: 2057 of ‘577 and the modified antisense oligonucleotide of SEQ ID NO: 312 of Xie et al. into a composition with a reasonable expectation of success, as one would only need to select the modified oligonucleotide sequences from a list in ‘577 which are all taught to target Kras as well as select an antisense sequence of Xie et al. from a list which also targets mutated Kras. One of ordinary skill in the art would have been motivated to do so because ‘577 teaches pharmaceutical compositions comprising one or more antisense compounds (paragraph 0340) and the use of the antisense compounds targeting KRAS for treating cancer, and Xie et al. also teaches a composition comprising any one or more of the siRNA polynucleotides described herein and a physiologically acceptable carrier (paragraph 0021). Therefore an ordinary artisan could easily combine the oligonucleotides of SEQ ID NO: 2057 of ‘577 and SEQ ID NO: 312 of Xie et al. in a composition to determine if there is an improvement in the ability to treat cancer using a combination of antisense oligonucleotides that target KRAS, and would make obvious the limitations of claim 40.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Claims 50 and 51 are rejected under 35 U.S.C. 103 as being unpatentable over US 20180273577 (‘577), as applied to claims 13,16,18,20,23,39,43 and 47-49 above, and further in view of Pecot et al. (Mol Cancer Ther 13 (12):2876-2885, Published 1 Dec 2014), cited on an IDS dated 01/31/2024.
The teachings of ‘577 as applicable to claims 13,16,18,20,23,39,43 and 47-49 are described above.
‘577 does not teach wherein the composition further comprises a nanoparticle or wherein the nanoparticle is a nanoliposome.
Pecot et al. cures this deficiency. Pecot et al. teach that since its discovery over 30 years ago, the KRAS proto-oncogene has remained the single most elusive cancer target, and that mutation activation of the RAS GTPases is present in approximately one third of all cancers, and that although attempts have been made to develop pharmaceutical inhibitors of mutant KRAS-driven cancers, KRAS itself is still widely regarded as undruggable (Intro, first paragraph). Pecot et al. teach in vivo experiments using a nano-liposomal delivery platform, DOPC, for systemic delivery of siRNAs targeting KRAS, and various lung and colon cancer models were used to determine efficacy of systemic KRAS siRNA based on tumor growth, development of metastasis, and down-stream signaling (Abstract). Pecot et al. teach a proof-of-concept study in lung and colon cancer preclinical models that demonstrates the efficacy of KRAS silencing using nanoparticle-mediated siRNA delivery (Introduction, page 2877). Pecot et al. teach “using our well-characterized 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) nanoliposomes we have recently demonstrated highly effective systemic delivery of oligonucleotides in orthotopic lung cancer models. Through exploitation of the enhanced-permeability and retention (EPR) effect, we also demonstrated the ability to systemically deliver siRNAs to metastatic lesions. Thus, for all in vivo experiments, we assessed therapeutic efficacy of KRAS targeting with DOPC-mediated siRNA delivery” (page 2879, right column). Pecot et al. teach results demonstrated that systemically delivered KRAS siRNAs demonstrated significant therapeutic activity on the primary tumor as well as control of metastatic spread (page 2880, right column).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to provide the composition comprising the antisense oligonucleotide of ‘577 and further comprising a nanoparticle, wherein the nanoparticle is a nanoliposome based on the teachings of Pecot et al. There would be a reasonable expectation of success, because both ‘577 and Pecot et al. pertain to oligonucleotides inhibiting KRAS activity. One of ordinary skill in the art would have been motivated to provide the composition comprising the antisense oligonucleotide of ‘577 with a nanoliposome, because Pecot et al. teach the need for a therapeutic for mutant KRAS-driven cancers which is widely regarded as undruggable, and that in vivo experiments using a nano-liposomal delivery platform, DOPC, for systemic delivery of siRNAs targeting KRAS in lung and colon cancer models demonstrates highly effective systemic delivery of oligonucleotides in orthotopic lung cancer models, the ability to systemically deliver siRNAs to metastatic lesions, and that systemically delivered KRAS siRNAs demonstrated significant therapeutic activity on the primary tumor as well as control of metastatic spread.
Accordingly, the limitations of claims 50 and 51 would have been prima facie obvious to one of ordinary skill in the art before the effective filing date.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 13,16,18,20,23,39,43 and 47-49 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 (‘159) in view of US 20180273577 (‘577), effectively filed 24 Sept 2015.
The instant application recites a species of antisense oligonucleotide sequences targeted to KRAS, while Patent ‘159 recites a genus of dsRNA molecules comprising an antisense strand and sense strand wherein the antisense strand is complementary to a region of a human KRAS gene.
The instant application claims an antisense oligonucleotide 16-25 nucleotides in length and targeted to naturally occurring human KRAS mRNA encoding a mutation selected from G12V and G13D, and comprises SEQ ID NO: 119 or SEQ ID NO: 120, and wherein the antisense oligonucleotide comprises at least one non-naturally occurring chemical modification (claim 13), at least one phosphorothioate linkage (claim 16), at least one modified nucleotide within 5 nucleotides of the 5’ end and/or 3’ end (claim 18), and wherein the modified nucleotide is a 2’-MOE modified nucleotide (claim 20), a modified nucleotide is a locked nucleic acid (claim 23); a composition comprising the ASO and a pharmaceutical composition comprising the ASO (claims 39 and 43); all phosphorothioate linkages (claim 48); and at least three modified nucleotides at each of the 5’ and 3’ end (claim 49).
Patent ‘159 claims a dsRNA molecule comprising an antisense strand that is at least 90% complementary to a region of the nucleotide sequence of a synthetic human KRAS gene that contains the missense mutations G12C, G12D, and G13D or the missense mutations G12C, G12V and G13D, the region consisting of 18-25 consecutive nucleotides (claims 1-3,8,9). Patent ‘159 claims a nucleic acid construct and a nucleic acid molecule comprising the RNA molecule of claim 1 (claims 10-12), a composition comprising the RNA molecule, including a composition of two or more RNA molecules each comprising a different antisense strand (claims 13-14), and a pharmaceutical composition comprising the RNA molecule (claim 18).
While Patent ‘159 claims an dsRNA comprising an antisense strand that targets a KRAS gene that contains the missense mutations G12C, G12D, and G13D or the missense mutations G12C, G12V and G13D, Patent ‘159 does not claim the specific antisense strand sequence.
The teachings of ‘577 have been described above in the 35 U.S.C.102(a)(2) rejection.
It would have been obvious to one of ordinary skill in the art before the effective filing date to combine the teachings of Patent ‘159 and ‘577 and use the antisense oligonucleotide of ‘577. One skilled in the art would have been motivated to use the antisense oligonucleotide of ‘577 because Patent ‘159 claims the target as human KRAS, and ‘577 also teaches the target as human KRAS, and therefore, as the target gene is the same, there is a reasonable expectation of success in using any of the taught antisense sequences.
Claim 15 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of US 20180273577 (‘577), effectively filed 24 Sept 2015 and Sorenson (U.S. Patent No. 6,020,124), Issued 1 Feb. 2000.
The instant application claims an antisense oligonucleotide consisting of the sequence of SEQ ID NO: 126 targeted to a human KRAS mRNA encoding a G12V mutation (claim 15).
The teachings of Patent ‘159 and ‘577 are set forth above.
Patent ‘159 and ‘577 do not teach an antisense oligonucleotide consisting of the sequence of SEQ ID NO: 126.
However, Sorenson cures this deficiency. The teachings of Sorenson are described above in the 35 U.S.C. 103 rejections.
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to combine the teachings of Patent ‘159, ‘577 and Sorenson to arrive at the antisense oligonucleotide sequence of instant SEQ ID NO: 126 with a reasonable expectation of success, because Patent ‘159, ‘577 and Sorenson all pertain to antisense oligonucleotides directed to mutant KRAS gene sequences. One of ordinary skill in the art would have been motivated to provide an antisense oligonucleotide consisting of the sequence “GCACTCTTGCCTACGCCAAC” because Sorenson teach the need for a diagnostic tool with the ability to detect sequences of mutated oncogenes in small samples of biological fluid such as blood plasma and the presence of mutated K-ras gene sequences in plasma would be indicative of the presence in the patent of a tumor which contains mutated oncogenes.
Claims 22 and 24 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of US 20180273577 (‘577), Sorenson and Lee et al. (J. of Cardiovasc. Trans. Res. (2013) 6:969-980).
The instant claims, Patent ‘159, ‘577 and Sorenson are set forth above.
Patent ‘159, ‘577 and Sorenson do not teach the gapmer modification motif recited in instant claims 22 and 24.
However, Lee et al. cures this deficiency. The teachings of Lee et al. are described above in the 35 U.S.C. 103 rejections.
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to combine the teachings of Patent ‘159, ‘577, Sorenson and Lee et al. with a reasonable expectation of success as Patent ‘159, ‘577 and Sorenson teach antisense oligonucleotides targeting the same gene, KRAS and Lee et al. pertains to gapmer design of antisense oligonucleotides. This would have amounted to applying a known technique (ASO gapmer design of Lee et al.) to a known product ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to provide the modifications to the antisense oligonucleotides because Lee et al. teach the benefits of the gapmer design include enhanced stability, increased potency, and reductions in non-specific toxicities and teach that that in order to facilitate RNase H activity, unmodified DNA is included in the internal, typically ten nucleotides (“the gap”), and the gap is flanked on the 5’ and 3’ ends with 2-5 of the MOE-modified nucleotides which enhances ASO stability and affinity for target RNA. An ordinary artisan could use the combined teachings regarding gapmer design of ‘577 and Lee et al. to arrive at the instant gapmer arrangement because Lee et al. teach the 10 nucleotide length of the gap flanked on the 5’ and 3’ ends with up to 5 MOE/LNA modified nucleotides, and one would be motivated to optimize the placement of the LNA modified nucleotide at one of the 5 nucleotides in the 3’ wing segment with a reasonable expectation of success, and would make obvious the limitations of claims 22 and 24.
Claim 21 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of US 20180273577 (‘577) and Lee et al. (J. of Cardiovasc. Trans. Res. (2013) 6:969-980).
The instant claims, Patent ‘159 and ‘577 are set forth above.
Patent ‘159 and ‘577 do not teach wherein the antisense oligonucleotide comprises at least three 2’-MOE modified nucleotides at each of the 5’ end and/or the 3’ end.
However, Lee et al. cures this deficiency. The teachings of Lee et al. are described above in the 35 U.S.C. 103 rejections.
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to combine the teachings of Patent ‘159, ‘577, and Lee et al. with a reasonable expectation of success as Patent ‘159 and ‘577 teach antisense oligonucleotides targeting the same gene, KRAS and ‘577 and Lee et al. both pertain to gapmer antisense oligonucleotides. This would have amounted to applying a known technique (ASO gapmer design of Lee et al.) to a known product (the modified ASO sequence of ‘577 having a gapmer structure) ready for improvement to yield predictable results. One of ordinary skill in the art would have been motivated to provide at least 3 2’-MOE modified nucleotides at each of the 5’ end and/or the 3’ end of the antisense oligonucleotide of ‘577 because Lee et al. teach the benefits of the gapmer design include enhanced stability, increased potency, and reductions in non-specific toxicities and teach that that in order to facilitate RNase H activity, unmodified DNA is included in the internal, typically ten nucleotides (“the gap”), and the gap is flanked on the 5’ and 3’ ends with 2-5 of the MOE-modified nucleotides which enhances ASO stability and affinity for target RNA, and would make obvious the limitations of claim 21.
Claim 26 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of US 20180273577 (‘577) and Phillips (Hypertension Vol. 29, Issue 1, January 1997, pages 177-187).
The instant claims, Patent ‘159 and ‘577 are set forth above.
Patent ‘159 and ‘577 do not teach a nucleic acid molecule encoding the antisense oligonucleotide.
Phillips cures this deficiency. The teachings of Phillips is described above in the 35 U.S.C. 103 rejections
Therefore, it would have been obvious to one of ordinary skill in the art to combine the teachings of Patent ‘159, ‘577 and Phillips to provide the antisense oligonucleotide in a vector encoding the antisense oligonucleotide with a reasonable expectation of success. An ordinary artisan would have been motivated to do so because Phillips teaches viral vector delivery of antisense DNA and the benefits of AAV vector use include safety, longevity, and sufficient carrying capacity, and that viral vectors allow sufficient uptake of antisense DNA into cells, and would make obvious the limitations of claim 26.
Claim 40 is rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of US 20180273577 (‘577) and Xie et al (US 20100286241), cited on an IDS.
The instant claims, Patent ‘159 and ‘577 are set forth above.
Patent ‘159 and ‘577 do not explicitly teach a composition comprising two or more antisense oligonucleotides comprising instant SEQ ID NOs: 119 and 120 or a sequence at least 90% identical to any one of a) to b.
Xie et al. teach siRNA polynucleotides comprising at least one nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-474, and which inhibits the expression of K-ras polypeptide (paragraph 0019), and also teaches a composition comprising any one or more of the siRNA polynucleotides described herein and a physiologically acceptable carrier (paragraph 0021). SEQ ID NO: 312 is shown on page 27 in Table 8 of Xie et al. as the antisense sequence of the siRNA that targets mutation K-ras K13/Asp. SEQ ID NO: 312 of Xie et al. is 25 nucleotides in length and nucleotides 8-23 of SEQ ID NO: 312 are 100% identical to nucleotides 1-16 of instant SEQ ID NO: 120, but include 5 conservative substitutions. See alignment below wherein Qy is instant SEQ ID NO: 120 and Db is SEQ ID NO: 312 of Xie et al. :
PNG
media_image3.png
93
368
media_image3.png
Greyscale
Xie et al. teach any polynucleotide of the invention may be further modified to increase stability or reduce cytokine production in vivo and possible modifications include, but are not limited to, the addition of flanking sequences at the 5′ and/or 3′ ends; the use of phosphorothioate or 2′ O-methyl rather than phosphodiester linkages in the backbone; and/or the inclusion of nontraditional bases (paragraph 0074), and the polynucleotides of the invention can be chemically modified in a variety of ways to achieve a desired effect. In certain embodiments, oligonucleotides of the invention may be 2′-O-substituted oligonucleotides (paragraph 0075).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to combine the teachings of Patent ‘159 with the modified antisense oligonucleotide of SEQ ID NO: 2057 of ‘577 and the modified antisense oligonucleotide of SEQ ID NO: 312 of Xie et al. into a composition with a reasonable expectation of success, as one would only need to select the modified oligonucleotide sequences from a list in ‘577 which are all taught to target Kras as well as select an antisense sequence of Xie et al. from a list which also targets mutated Kras. One of ordinary skill in the art would have been motivated to do so because ‘577 teaches pharmaceutical compositions comprising one or more antisense compounds (paragraph 0340) and the use of the antisense compounds targeting KRAS for treating cancer, and Xie et al. also teaches a composition comprising any one or more of the siRNA polynucleotides described herein and a physiologically acceptable carrier (paragraph 0021). Therefore an ordinary artisan could easily combine the oligonucleotides of SEQ ID NO: 2057 of ‘577 and SEQ ID NO: 312 of Xie et al. in a composition to determine if there is an improvement in the ability to treat cancer using a combination of antisense oligonucleotides that target KRAS, and would make obvious the limitations of claim 40.
Claims 50 and 51 rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3,8-14 and 18 of U.S. Patent No. 10,619,159 in view of US 20180273577 (‘577) and Pecot et al. (Mol Cancer Ther 13 (12):2876-2885, Published 1 Dec 2014), cited on an IDS dated 01/31/2024.
The instant claims, Patent ‘159 and ‘577 are set forth above.
Patent ‘159 and ‘577 do not teach wherein the composition further comprises a nanoparticle or wherein the nanoparticle is a nanoliposome.
Pecot et al. cures this deficiency. Pecot et al. teach that since its discovery over 30 years ago, the KRAS proto-oncogene has remained the single most elusive cancer target, and that mutation activation of the RAS GTPases is present in approximately one third of all cancers, and that although attempts have been made to develop pharmaceutical inhibitors of mutant KRAS-driven cancers, KRAS itself is still widely regarded as undruggable (Intro, first paragraph). Pecot et al. teach in vivo experiments using a nano-liposomal delivery platform, DOPC, for systemic delivery of siRNAs targeting KRAS, and various lung and colon cancer models were used to determine efficacy of systemic KRAS siRNA based on tumor growth, development of metastasis, and down-stream signaling (Abstract). Pecot et al. teach a proof-of-concept study in lung and colon cancer preclinical models that demonstrates the efficacy of KRAS silencing using nanoparticle-mediated siRNA delivery (Introduction, page 2877). Pecot et al. teach “using our well-characterized 1,2-dioleoyl-sn-glycero-3-phosphatidylcholine (DOPC) nanoliposomes we have recently demonstrated highly effective systemic delivery of oligonucleotides in orthotopic lung cancer models. Through exploitation of the enhanced-permeability and retention (EPR) effect, we also demonstrated the ability to systemically deliver siRNAs to metastatic lesions. Thus, for all in vivo experiments, we assessed therapeutic efficacy of KRAS targeting with DOPC-mediated siRNA delivery” (page 2879, right column). Pecot et al. teach results demonstrated that systemically delivered KRAS siRNAs demonstrated significant therapeutic activity on the primary tumor as well as control of metastatic spread (page 2880, right column).
Therefore, it would have been obvious to one of ordinary skill in the art before the effective filing date, to provide the composition of Patent ‘159 comprising the antisense oligonucleotide of ‘577 with a nanoparticle, wherein the nanoparticle is a nanoliposome based on the teachings of Pecot et al. There would be a reasonable expectation of success, because both ‘577 and Pecot et al. pertain to oligonucleotides inhibiting KRAS activity. One of ordinary skill in the art would have been motivated to provide the composition comprising the antisense oligonucleotide of Patent ‘159 and ‘577 with a nanoliposome, because Pecot et al. teach the need for a therapeutic for mutant KRAS-driven cancers which is widely regarded as undruggable, and that in vivo experiments using a nano-liposomal delivery platform, DOPC, for systemic delivery of siRNAs targeting KRAS in lung and colon cancer models demonstrates highly effective systemic delivery of oligonucleotides in orthotopic lung cancer models, the ability to systemically deliver siRNAs to metastatic lesions, and that systemically delivered KRAS siRNAs demonstrated significant therapeutic activity on the primary tumor as well