Prosecution Insights
Last updated: May 29, 2026
Application No. 17/543,169

Method of Determining Disease Causality of Genome Mutations

Final Rejection §101§103§112
Filed
Dec 06, 2021
Priority
Oct 18, 2013 — provisional 61/892,920 +2 more
Examiner
CLOW, LORI A
Art Unit
1687
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Hospital for Sick Children
OA Round
2 (Final)
64%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
93%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allowance Rate
452 granted / 707 resolved
+3.9% vs TC avg
Strong +29% interview lift
Without
With
+28.7%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
23 currently pending
Career history
736
Total Applications
across all art units

Statute-Specific Performance

§101
13.2%
-26.8% vs TC avg
§103
48.0%
+8.0% vs TC avg
§102
12.8%
-27.2% vs TC avg
§112
9.4%
-30.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 707 resolved cases

Office Action

§101 §103 §112
DETAILED ACTION Applicant's response, filed 11 February 2026, has been fully considered. Rejections and/or objections not reiterated from previous Office Actions are hereby withdrawn. The following rejections and/or objections are either reiterated or newly applied. They constitute the complete set presently being applied to the instant application. Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Claims 1-11 and 13-20 are currently pending and under exam herein. Claim 12 has been cancelled. Priority The instant application priority has been updated to amend that said application is filed is a Continuation of US 15/092,113, filed 6 April 2016, now US Patent 11,193,170. The ‘113 application is a Continuation-in-Part of PCT/CA2014/000743, filed 17 October 2014, claiming benefit of priority of US Provisional Application 61/892,920, filed 18 October 2013. Priority is acknowledged to an EFD of 18 October 2013 for each of claims 1-11 and 13-20. Drawings The Replacement drawings filed 11 February 2026 are objected to because certain of said depictions continue to be visualized as blurry and/or difficult to read. See, for example, Figures 1; 3; 5A; 15C; 21A-B; 22; 27A-B; and 28A-B. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Applicant states that Replacement Drawings were submitted to overcome said objections, however each of said Figures listed above include text that is blurry and/or difficult to read. Specification The outstanding objections to the Specification are withdrawn in view of the amendments submitted herein. It is noted herein that any reference in the instant Office Action to the “Specification” refers to the Specification as published [PG PUB US2022/0228215]. Terminal Disclaimer The terminal disclaimer filed on 11 February 2026 disclaiming the terminal portion of any patent granted on this application which would extend beyond the expiration date of US Patent 11,193,170 has been reviewed and is accepted. The terminal disclaimer has been recorded. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1-11 and 13-18 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention. Claims 1 and 13, as amended recite, “detecting whether or not the exons detected in step i) are spliced into the rare or de novo sequence mutations of step”, wherein the claim is unclear with respect to the conditional recitation of “whether or not the exons…are spliced” as the claim may be interpreted as either: (1) a) detecting or b) not detecting the exons OR (2) detecting if the exons are either a) spliced into the rare sequence mutations or b) de novo sequence mutations. If the claims are interpreted under the first interpretation, said step is contingent on detecting or not detecting only and, if detection is not achieved in step iii) then step iv) need not occur. It is suggested that the claim be amended to recite, “detecting from step i) that are spliced into the rare or de novo sequence mutations of step ii)” or the like to provide positive, active claim language. Clarification is requested through clearer claim language. See MPEP at 211.04(II) with respect to contingent claim limitations in a method claim. This rejection applies to claims 1-18. Claim 13, as amended recites, “a method of detecting a critical exon associated with a disease which is a neuropsychiatric disorder selected from Autism Spectral disorder (ASD), schizophrenia (SZ), intellectual disability (ID), Fragile X syndrome, epilepsy and nervous disorders in a nucleic acid sample from a mammal, comprising the steps of: i) detecting exons within target genes in the nucleic acid sample which exhibit an expression level greater than the 75th percentile of exon expression levels in genes from one or more mammals having the disease using nucleic acid primers that target exons within target genes selected from the group consisting of: CCTCATCCCCATGGTGACATC (SEQ ID NO: 15) and TTACTGCGGTTGTGCAGGAG (SEQ ID NO: 16); GACTTTGTCTTCGCCCCAGA (SEQ ID NO: 17) and CTACCATCAAGCCGTCCCTG (SEQ ID NO: 18); TCCGACATTCTCACTTGCCA (SEQ ID NO: 19) and CCAGGGTCAGCACAAGTCAT (SEQ ID NO: 20); GGACTGTTCTCTGCTGGGAC (SEQ ID NO: 21) and GTTCGGAACCAGTACTCGCC (SEQ ID NO: 22); CCGCATCCTGATGTGTCTGA (SEQ ID NO: 23) and TTGCAGGTGGATACGTGACT (SEQ ID NO: 24)…” wherein the claim is unclear with respect to which primers are associated with which disease. If, for example the disorder selected is ASD, and the primers selected are 21 and 22, it would appear that these sets of primers do not target ASD. As such, clarification through clearer claim language is requested. The dependent claims fail to address the issue and thus are also rejected herein (claims 13-18). Claims 13-18 recites, “detecting rare mutations which occur at a frequency of less than 0.05 or de novo sequence mutations not possessed by either parent of the nucleic acid sample within each exon detected in step i) and determining the burden of mutation of each exon by dividing the number of mutations in each exon by the length of the exon”. The claim is unclear with respect to the detection of rare mutations with respect to the recited primer sequences. The step is unclear with respect to what is being detected in step i) such that a frequency of 0.05 of something (assumed to be a p value) is “detected” or that new sequences would be elucidated in step ii). The criteria to detect a rare mutation is not defined in the instant claim and thus renders the claim indefinite. For example, the parameters that constitute a “rare” mutations are not set forth and are further not even compared to any type of control or normal sample. As such, it is not clear as to what would even establish a burden of mutation. Clarification is requested through clearer claim language. Response to Applicant’s Arguments 1. Applicant states with respect to the rejection pertaining to detecting rare mutations using the recited primer sequences that the claim is clear and would be readily understood by one of skill in the art to whom the claim is directed. In this regard, the Examiner is respectfully directed to Table 6 and para. [0088] of the application as filed which confirms that the primers are used to quantify critical exons in the brain via PCR. This is not persuasive. It is maintained that the claim contains no parameters for which detection at a frequency of 0.05 may be compared. For example, the mutations are not compared to any type of control or normal sample, such that detection or analysis of a “rare” mutation would be established. As such, it is not clear as to what would even establish a burden of mutation. Clarification is requested through clearer claim language. 2. Applicant’s arguments with respect to all other outstanding rejections of record under 35 USC 112(b) are persuasive, as found at page 7-8 of the Response filed 11 February 2026. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-11 and 19-20 remain rejected under 35 U.S.C. 101 because the claimed invention is directed to an abstract ideas and natural phenomena without significantly more. The instant rejection reflects the framework as outlined in the MPEP at 2106.04: Framework with which to Evaluate Subject Matter Eligibility: (1) Are the claims directed to a process, machine, manufacture or composition of matter; (2A) Prong One: Do the claims recite a judicially recognized exception, i.e. a law of nature, a natural phenomenon, or an abstract idea; Prong Two: If the claims recite a judicial exception under Prong One, then is the judicial exception integrated into a practical application (Prong Two); and (2B) If the claims do not integrate the judicial exception, do the claims provide an inventive concept. Framework Analysis as Pertains to the Instant Claims: Step 1 Analysis: Directed to process, machine, manufacture/composition of matter Assessment With respect to step (1): yes, the claims are directed to methods, a tangible computer-readable medium and a system of detecting critical exons. Step 2A, Prong 1: Do Claims Recite Abstract Idea Assessment (a) Abstract Ideas With respect to step (2A)(1), the claims recite abstract ideas. The MPEP at 2106.04(a)(2) further explains that abstract ideas are defined as: mathematical concepts, (mathematical formulas or equations, mathematical relationships and mathematical calculations); certain methods of organizing human activity (fundamental economic practices or principles, managing personal behavior or relationships or interactions between people); and/or mental processes (procedures for observing, evaluating, analyzing/ judging and organizing information). With respect to the instant claims, under the (2A)(1) evaluation, the claims are found herein to recite abstract ideas that fall into the grouping of mental processes (in particular procedures for observing, analyzing and organizing information). The claim steps to abstract ideas are as follows: Claim 1: detecting exons within target genes for neuropsychiatric phenotypes in the nucleic acid sample which exhibit an expression level greater than the 75th percentile of exon expression levels in genes from one or more mammals having the disease using nucleic acid primers that target exons within the target genes; ii) detecting rare mutations which occur at a frequency of less than 0.05 or de novo sequence mutations not possessed by either parent of the nucleic acid sample within each exon detected in step i) and determining the burden of mutation of each exon by dividing the number of mutations in each exon by the length of the exon; iii) detecting whether or not the exons detected in step i) are spliced into the rare or de novo sequence mutations of step ii), and iv) identifying an exon as a critical exon the exon is spliced into the rare or de novo sequence mutations and when the burden of mutation of the exon is less than the 75th percentile of mutations in the exon and inversely correlates with the exon expression level, wherein steps directed to “detecting” and “identifying”, given the plan meaning of said terms and without any further specific steps otherwise in the claims, are those which may be performed mentally by merely observation of data to “detect” or “identify” specific sought after data. Further, steps directed to assessment of those in a 75th percentile and detecting at a frequency of less than 0.05 and dividing numbers by length of the exon, said operations may be performed using mathematical principals and pen and paper, or alternatively with the aid of a computer as a tool to perform them. Dependent claims 2-11: recite additional steps that further limit the judicial exceptions in independent claim 1 and as such, are further directed to abstract ideas. Hence, the claims explicitly recite numerous elements that, individually and in combination, constitute abstract ideas. (b) Natural phenomenon Insofar as the instant claims recite correlations of gene expression data with disease, said claims are directed to natural phenomenon herein and are also non-statutory as such. Claims 19 and 20 further include a tangible computer-readable storage medium… and a system, respectively and correspond to the same judicially recited exceptions as pertain to claim 1 above. The abstract ideas recited in the claims are evaluated under the Broadest Reasonable Interpretation (BRI) and determined herein to each cover performance either in the mind and/or performance by mathematical operation. There are no specifics as to the methodology involved and thus, under the BRI, said recitations are similar to the concepts of collecting information, analyzing it and displaying certain results of the collection and analysis (Electric Power Group, LLC, v. Alstom (830 F.3d 1350, 119 USPQ2d 1739 (Fed. Cir. 2016)), organizing and manipulating information through mathematical correlations (Digitech Image Techs., LLC v Electronics for Imaging, Inc. (758 F.3d 1344, 111 U.S.P.Q.2d 1717 (Fed. Cir. 2014)) and comparing information regarding a sample or test to a control or target data in (Univ. of Utah Research Found. v. Ambry Genetics Corp. (774 F.3d 755, 113 U.S.P.Q.2d 1241 (Fed. Cir. 2014) and Association for Molecular Pathology v. USPTO (689 F.3d 1303, 103 U.S.P.Q.2d 1681 (Fed. Cir. 2012)) that the courts have identified as concepts that can be practically performed in the human mind with pen and paper, and can include mathematical concepts. Further, see MPEP § 2106.04(a)(2), subsection III. The courts do not distinguish between mental processes that are performed entirely in the human mind and mental processes that require a human to use a physical aid (e.g., pen and paper or a slide rule) to perform the claim limitation (see, e.g., Benson, 409 U.S. at 67, 65, 175 USPQ at 674-75, 674: noting that the claimed "conversion of [binary-coded decimal] numerals to pure binary numerals can be done mentally," i.e., "as a person would do it by head and hand."); Synopsys, Inc. v. Mentor Graphics Corp., 839 F.3d 1138, 1139, 120 USPQ2d 1473, 1474 (Fed. Cir. 2016): holding that claims to a mental process of "translating a functional description of a logic circuit into a hardware component description of the logic circuit" are directed to an abstract idea, because the claims "read on an individual performing the claimed steps mentally or with pencil and paper"). Nor do the courts distinguish between claims that recite mental processes performed by humans and claims that recite mental processes performed on a computer. As the Federal Circuit has explained, "[c]ourts have examined claims that required the use of a computer and still found that the underlying, patent-ineligible invention could be performed via pen and paper or in a person’s mind" (see Versata Dev. Group v. SAP Am., Inc., 793 F.3d 1306, 1335, 115 USPQ2d 1681, 1702 (Fed. Cir. 2015); Mortgage Grader, Inc. v. First Choice Loan Servs. Inc., 811 F.3d 1314, 1324, 117 USPQ2d 1693, 1699 (Fed. Cir. 2016): holding that computer-implemented method for "anonymous loan shopping" was an abstract idea because it could be "performed by humans without a computer"). Step 2A, Prong 2:Integration to a Practical Application Assessment Because the claims do recite judicial exceptions, direction under (2A)(2) provides that the claims must be examined further to determine whether they integrate the abstract ideas into a practical application (MPEP 2106.04(d). A claim can be said to integrate a judicial exception into a practical application when it applies, relies on, or uses the judicial exception in a manner that imposes a meaningful limit on the judicial exception. This is performed by analyzing the additional elements of the claim to determine if the abstract idea is integrated into a practical application (MPEP 2106.04(d).I.; MPEP 2106.05(a-h)). If the claim contains no additional elements beyond the abstract idea, the claim is said to fail to integrate the abstract idea into a practical application (MPEP 2106.04(d).III). With respect to the instant recitations, the claims recite the following additional elements: Claims 1-11 do not include further claim limitations that pertain to additional elements beyond further limiting data. Claims 19-20 include computer-readable media and systems as additional elements. Further with respect to the additional elements in the instant claims, those steps directed to data gathering. Data gathering does not impose any meaningful limitation on the abstract idea, or on how the abstract idea is performed. Data gathering steps are not sufficient to integrate an abstract idea into a practical application. (MPEP 2106.05(g). The courts have recognized the following laboratory techniques insignificant extra-solution activity (see MPEP 2106.05(d)II.): determining the level of a biomarker in blood by any means (Mayo, 566 U.S. at 79, 101 USPQ2d at 1968; Cleveland Clinic Foundation v. True Health Diagnostics, LLC, 859 F.3d 1352, 1362, 123 USPQ2d 1081, 1088 (Fed. Cir. 2017)); detecting DNA or enzymes in a sample (Sequenom, 788 F.3d at 1377-78, 115 USPQ2d at 1157); Cleveland Clinic Foundation 859 F.3d at 1362, 123 USPQ2d at 1088 (Fed. Cir. 2017)). Further steps herein directed to additional non-abstract elements of “processor; computer; storage medium etc…” do not describe any specific computational steps by which the “computer parts” perform or carry out the abstract idea, nor do they provide any details of how specific structures of the computer, such as the computer-readable recording media, are used to implement these functions. The claims state nothing more than a generic computer which performs the functions that constitute the abstract idea. Hence, these are mere instructions to apply the abstract idea using a computer, and therefore the claim does not integrate that abstract idea into a practical application. The courts have weighed in and consistently maintained that when, for example, a memory, display, processor, machine, etc… are recited so generically (i.e., no details are provided) that they represent no more than mere instructions to apply the judicial exception on a computer, and these limitations may be viewed as nothing more than generally linking the use of the judicial exception to the technological environment of a computer. (see MPEP 2106.05(f)). None of the recited dependent claims recite additional elements which would integrate a judicial exception into a practical application. Step 2B: Do Claims Provide an Inventive Concept Assessment The claims are lastly evaluated using the (2B) analysis, wherein it is determined that because the claims recite abstract ideas, and do not integrate that abstract ideas into a practical application, the claims also lack a specific inventive concept. Applicant is reminded that the judicial exception alone cannot provide the inventive concept or the practical application and that the identification of whether the additional elements amount to such an inventive concept requires considering the additional elements individually and in combination to determine if they provide significantly more than the judicial exception. (MPEP 2106.05.A i-vi). With respect to the instant claims, the additional elements of data gathering described above do not rise to the level of significantly more than the judicial exception. As directed in the Berkheimer memorandum of 19 April 2018 and set forth in the MPEP, determinations of whether or not additional elements (or a combination of additional elements) may provide significantly more and/or an inventive concept rests in whether or not the additional elements (or combination of elements) represents well-understood, routine, conventional activity. Said assessment is made by a factual determination stemming from a conclusion that an element (or combination of elements) is widely prevalent or in common use in the relevant industry, which is determined by either a citation to an express statement in the specification or to a statement made by an applicant during prosecution that demonstrates a well-understood, routine or conventional nature of the additional element(s); a citation to one or more of the court decisions as discussed in MPEP 2106(d)(II) as noting the well-understood, routine, conventional nature of the additional element(s); a citation to a publication that demonstrates the well-understood, routine, conventional nature of the additional element(s); and/or a statement that the examiner is taking official notice with respect to the well-understood, routine, conventional nature of the additional element(s). As for laboratory operations of using primers to detect sequences, the courts have recognized the following laboratory techniques as well-understood, routine, conventional activity in the life science arts when they are claimed in a merely generic manner (e.g., at a high level of generality) or as insignificant extra-solution activity (see MPEP 2106.05(d)II.): determining the level of a biomarker in blood by any means (Mayo, 566 U.S. at 79, 101 USPQ2d at 1968; Cleveland Clinic Foundation v. True Health Diagnostics, LLC, 859 F.3d 1352, 1362, 123 USPQ2d 1081, 1088 (Fed. Cir. 2017)); detecting DNA or enzymes in a sample (Sequenom, 788 F.3d at 1377-78, 115 USPQ2d at 1157); Cleveland Clinic Foundation 859 F.3d at 1362, 123 USPQ2d at 1088 (Fed. Cir. 2017)). Finally, with respect to said claims, the computer-related elements or the general purpose computer do not rise to the level of significantly more than the judicial exception. The specification also notes that computer processors and systems, as example, are commercially available or widely used at [0061]. The additional elements are set forth at such a high level of generality that they can be met by a general purpose computer. Therefore, the computer components constitute no more than a general link to a technological environment, which is insufficient to constitute an inventive concept that would render the claims significantly more than an abstract idea (see MPEP 2106.05(b)I-III). The dependent claims have been analyzed with respect to step 2B and none of these claims provide a specific inventive concept, as they all fail to rise to the level of significantly more than the identified judicial exception. For these reasons, the claims, when the limitations are considered individually and as a whole, are rejected under 35 USC § 101 as being directed to non-statutory subject matter. It is noted that claims 13-18, as now amended, include recitation of specific primer sequences that pertain to the recited diseases and said primer sequences are not known in the art. As such, said steps are eligible under 2B and provide primer sequences that are not well-known conventional or routine. It is, however, suggested that the issues under 112(b) be resolved with respect to specific primers for specific diseases as recited above. Response to Applicant’s Arguments 1. Applicant states that, “the claims provide an inventive concept” and further that “the claims define the step of determining whether or not an exon is spliced into the identified de novo or rare mutation, and leads to the identification of an exon as a critical exon when the exon is spliced into the rare or de novo sequence mutation. While none of the cited prior art teaches anything with respect to critical exons, critical exons are clearly not determined by the prior art since none of the cited prior art teaches the step of determining the whether an exon is spliced into an identified de novo or rare mutation which leads to the identification of a critical exon. Thus, this step in the claimed method is clearly inventive in view of the teachings of the prior art, and therefore amounts to significantly more than the judicial exception”. It is respectfully submitted that this is not persuasive. The instant claim steps of determining if an exon is spliced into a rare of de novo sequence mutation and further “identifying an exon as critical when…the burden of mutation of the exon is less that the 7th percentile of mutations in the exon…” are recitations in the claim directed to the judicial exception, whereby said operations are performed mentally. Further said operations are directed to natural phenomena directed to correlations of mutation with disease. Applicant is reminded that the judicial exception alone cannot provide the improvement. The improvement can be provided by one or more additional elements. See the discussion of Diamond v. Diehr, 450 U.S. 175, 187 and 191-92, 209 USPQ 1, 10 (1981)) in subsection II, below. In addition, the improvement can be provided by the additional element(s) in combination with the recited judicial exception. See MPEP § 2106.04(d) (discussing Finjan, Inc. v. Blue Coat Sys., Inc., 879 F.3d 1299, 1303-04, 125 USPQ2d 1282, 1285-87 (Fed. Cir. 2018)). In the instant claims, the detection steps are directed to routine laboratory steps to provide data by which the said operations occur in the claim. Said operations are, themselves, judicial exceptions. There are no further steps beyond the analysis of the data herein and as such, the claim remain ineligible. 2. Applicant refers the Examiner to Example 29-Diagnosing and Treating Julitis and submits that this is applicable to claim 13. The arguments is persuasive with respect to claims 13-18 wherein specific primers are elucidated by which said operations occur and of which are not known in the prior art as conventional primers for detection of the set forth disease. Applicant is reminded to address the issues pertaining to claim 13 under 112(b) above for clarity of the claimed invention. Non-Statutory Double Patenting The rejection over Non-Statutory Double Patenting is hereby withdrawn in view of the Terminal Disclaimer filed. See above. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. 1. Claims 1-11 and 19-20 remain rejected under 35 U.S.C. 103 as being unpatentable over Kang et al. (Nature (2011) Vol. 478:483-489 and Supplementary Material; IDS reference) in view of Pinto et al. (Nature (2010) Vol. 466:368-372; IDS reference). Instant claim 1 is directed to: A method of detecting a critical exon associated with a disease in a nucleic acid sample from a mammal, comprising the steps of: i) detecting exons within target genes in the nucleic acid sample which exhibit an expression level greater than the 75th percentile of exon expression levels in genes from one or more mammals having the disease using nucleic acid primers that target exons within the target genes; ii) detecting rare mutations which occur at a frequency of less than 0.05 or de novo sequence mutations not possessed by either parent of the nucleic acid sample within each exon detected in step i) and determining the burden of mutation of each exon by dividing the number of mutations in each exon by the length of the exon; and iii) identifying an exon as a critical exon when the burden of mutation of the exon is less than the 75th percentile of mutations in the exon and inversely correlates with the exon expression level. With regard to claim 1, Kang et al. teach the analysis of exon-level transcriptome and associated genotyping data pertaining to various regions of the brain (page 483, abstract). Kang et al. teach identification of exons expressing greater than the 75th percentile of expression levels in genes (page 483, abstract); comparison of exon expression data between various stages of development and between regions at stages of development, as well as differences between male and female brain development. Such differences are a risk factor for diseases such as Autism and depression as described by reference to various research (page 483, col. 1); Kang et al. describe that genes that are hub genes in a co-expression network as implicated in various diseases (page 486, col. 2); Kang et al. disclose genes that include ASD associated genes (page 487, col. 1). Kang et al. teach further correlation of genes with causality of disease (page 487, col. 1-2; Supplemental Information at page 23). With regard to computer implementation of said method, Kang et al. teach implementation of software to perform copy number variant analysis (Supplemental Information at page 14, section 4.2). Kang et al. further teach exon array processing and analysis and co-expression analysis using computer implementation (Supplemental Information at pages 18-22, for example). With respect to claim 2, Kang et al. disclose disease associated with the neurological systems as pertain to development (page 483, col. 1-2; Table 1). With respect to claim 3, Kang et al. disclose diseases of developmental processes of the brain (page 483, col. 1). With respect to claim 4, Kang et al. disclose nucleic acid profiling from samples including the hippocampus and cerebrum, as example (page 484, col. 1). With respect to claim 5, Kang et al. disclose samples from the cerebral cortex (page 484, col. 1). With respect to claim 6, Kang et al. disclose prenatal, child and adult samples (page 484, col. 1). With respect to claim 7, Kang et al. disclose SNP detection (subset of SNV) at, for example page 488, col. 1). Further, CNVs are described in Supplementary Material at least at Section 4.2. With respect to claim 8, Kang et al. disclose CNV detection, which would include missense mutations as a subset thereof (Supplementary Material at least at Section 4.2). With respect to claim 9, Kang et al. disclose co-expression analysis (page 486, col. 1). With respect to claim 10, Kang et al. disclose weighted gene co-expression network analysis (page 486, col. 1). With respect to claim 11, Kang et al. disclose nucleic acid profiling from samples including the hippocampus and cerebrum, as example (page 484, col. 1). With respect to claims 19-20, Kang et al. disclose in the Supplementary Material (see, for example, Section 4.2) that computations are performed using a computer. The instant Specification indicates that computers are generically utilized to perform computation. As such, Kang et al. read on these limitations as claimed. Kang et al. do not specifically teach detection of burden of mutations, as in claim 1. However, Pinto et al. disclose methods of detection of the functional impact of global rare copy number variants, for example in autism spectrum disorders, including identification of rare mutations and de novo mutations to delineate the contribution of said variants to autism. The analysis includes comparison to controls (page 368), as well as assessment of burden of mutation assessments (page 368). It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have performed the methods of Kang et al. using the methods of Pinto et al. to elucidate a correlation between exon expression and disease, as Kang et al. specifically motivate one of skill to perform said methods for such an application (see page 488). Kang et al. state that “the present dataset along with an accompanying study provides the basis for a variety of further investigations and comparisons with other transcriptome related datasets of both healthy and diseased states”. One of skill would have had a reasonable expectation of success in using the datasets of Pinto with the techniques of Kang, as both references are in the same field of endeavor. Response to Applicant’s Arguments 1. With respect to claims 13-18, the rejections are withdrawn in view of the recitation of novel primers as associated with disease as claimed. Applicant is, however, asked to please amend the claims to clarify the issues under 112(b). See above. 2. With respect to claims 1-11 and 19-20, the rejections are maintained herein. Applicant states that, “Kang et al. relates to the generation and analysis of an exon-level transcriptome with associated genotyping data representative of males and females of different ethnicities from multiple brain regions of developing and adult human brains (see Abstract). Kang et al. is clear that: Only brains from clinically unremarkable donors with no signs of large-scale genomic abnormalities were included in the study (see pg. 483, col. 2, lines 8-10). There is no teaching or suggestion in Kang et al. of detecting exons that exhibit an expression level greater than the 75th percentile of exon expression levels in genes of nucleic acid from one or more mammals having a disease”. This is not persuasive. With respect to expression levels greater than a threshold of expression, the prior art to Kang et al. disclose exon array analyses. Further the art to Pinto et al. is relied upon to disclose individuals with disease (ASD) that include global burdens of rare, de novo copy number variation (abstract; p.368, col. 1; Table 1-Pinto). 2. Applicant states that, “regarding step iv), there is no teaching of identifying critical exons in Kang et al. Pinto does not overcome the deficiencies of Kang et al. to teach the claimed invention. Pinto does not teach anything with respect to 'critical exons'. As set out in the Abstract, while Pinto teaches an analysis of genome-wide characteristics of rare copy number variation in ASD using dense genotyping arrays, and found that some cases exhibited a higher global burden of rare, genic CNVs, there is no teaching of any of the steps of the claimed method. In particular, Pinto does not teach or suggest determining whether or not an exon is spliced into mutations, nor do they include any teaching of identifying an exon as a critical exon when i) the exon is spliced into a rare or de novo sequence mutation and ii) the burden of mutation of the exon is less than the 75th percentile of mutations in the exon and inversely correlates with the exon expression level”. This is not persuasive. Critical exon detection is disclosed in the art to Kang et al. as discussed in the above rejection. Pinto discloses the assessment of de novo variants in the context of those with disease, e.g. ASD. As such, the combination of references, wherein Kang et al. clearly contemplates assessment of neurodevelopmental disorders, it would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have performed the methods of Kang et al. using the methods of Pinto et al. to elucidate a correlation between exon expression and disease, as Kang et al. specifically motivate one of skill to perform said methods for such an application (see page 488). Kang et al. state that “the present dataset along with an accompanying study provides the basis for a variety of further investigations and comparisons with other transcriptome related datasets of both healthy and diseased states”. One of skill would have had a reasonable expectation of success in using the datasets of Pinto with the techniques of Kang, as both references are in the same field of endeavor, Furthermore, the assessment using cut-off values and thresholds as instantly claimed are design choices that researchers are routinely engaged in optimization routines such that those do not make a contribution over the art, per se, as setting said thresholds does not alter the operation of the methods as taught by the prior art. In re Aller, 220 F.2d 454, 456, 105 USPQ 233, 235 (CCPA 1955); In re Hoeschele, 406 F.2d 1403, 160 USPQ 809 (CCPA 1969); Merck & Co. Inc. v. Biocraft Lab. Inc., 874 F.2d 804, 809, 10 USPQ2d 1843, 1848 (Fed. Cir. 1989), cert. denied, 493 U.S. 975 (1989); In re Kulling, 897 F.2d 1147, 1149, 14 USPQ2d 1056, 1058 (Fed. Cir. 1990). Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Inquiries Papers related to this application may be submitted to Technical Center 1600 by facsimile transmission. Papers should be faxed to Technical Center 1600 via the PTO Fax Center. The faxing of such papers must conform to the notices published in the Official Gazette, 1096 OG 30 (November 15, 1988), 1156 OG 61 (November 16, 1993), and 1157 OG 94 (December 28, 1993) (See 37 CFR § 1.6(d)). The Central Fax Center Number is (571) 273-8300. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Lori A. Clow, whose telephone number is (571) 272-0715. The examiner can normally be reached on Monday-Thursday from 11:00AM to 9:00PM ET. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Karlheinz Skowronek can be reached on (571) 272-9047. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /Lori A. Clow/ Primary Examiner, Art Unit 1687
Read full office action

Prosecution Timeline

Dec 06, 2021
Application Filed
Aug 11, 2025
Non-Final Rejection mailed — §101, §103, §112
Feb 11, 2026
Response Filed
May 13, 2026
Final Rejection mailed — §101, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12640273
Dynamic Adaptation System for Surgical Simulation
5y 0m to grant Granted May 26, 2026
Patent 12633375
METHODS OF PREDICTING DOPAMINE PRODUCTION CAPABILITY OF DIFFERENTIATED NEURONAL CELLS
1y 6m to grant Granted May 19, 2026
Patent 12609206
Methods for Modeling Hepatic Inflammation
4y 11m to grant Granted Apr 21, 2026
Patent 12597485
ASSESSMENT METHOD AND DEVICE FOR INFECTIOUS DISEASE TRANSMISSION, COMPUTER EQUIPMENT AND STORAGE MEDIUM
4y 6m to grant Granted Apr 07, 2026
Patent 12585846
DIRECTED EVOLUTION FOR MEMBRANE DEVELOPMENT IN THREE DIMENSIONS
4y 4m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
64%
Grant Probability
93%
With Interview (+28.7%)
4y 2m (~0m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 707 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month