DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Application
2. Claims 1, 4, and 22-28 are pending.
3. Claims 23-28 are withdrawn.
4. Claims 1, 4, and 22 are examined.
5. The Improper Markush Grouping rejection of claims 1 and 4 has been withdrawn in view of Applicant’s amendments to the claims.
Continued Examination Under 37 CFR 1.114
6. A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on January 22, 2026 has been entered.
Election/Restrictions
7. Applicant’s election without traverse of Group I, claims 1-4, and SEQ ID NO’s 1-3 as species, in the reply filed on November 29, 2023 is acknowledged.
Claim 5-21 were withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on November 29, 2023.
In the instant amendments, Applicant added new claims 23-28. These claims read only on the non-elected species, which were previously recited together with the elected species in claim 1. For that reason, they are withdrawn from consideration as being drawn to non-elected species, there being no allowable generic claim.
However, new claim 22, which is dependent from claim 1, and specifies the manner of the PCR amplification, reads on the elected species and would have been included in the elected group and is examined herein.
Claim Rejections - 35 USC § 112 - Indefiniteness
8. The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
9. Claims 1, 4, and 22 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
In claim 1, the following recitation renders the claim indefinite: “A method for identifying a wheat plant comprising in its genome an R gene, the method comprising specifically detecting in the wheat plant the presence of the nucleotide sequence of the R gene or the R protein encoded by the R gene, wherein detecting comprises a member selected from the group consisting of PCR amplification, nucleic acid sequencing, isolating genomic DNA and/or RNA from the wheat plant, nucleic acid hybridization, and an immunological assay for the specific detection of the R protein encoded by the R gene.”
While the claim sets forth, in general terms, several techniques that can be used to detect a gene in a genome, no specific active steps are recited, nor does the claim provide any structures to be used in those active steps. For example, while the claim recites “nucleic acid hybridization” as one of the methods of detecting, it is unclear what probe or probes can be used in said hybridization and under what conditions, in order to “specifically detect” the presence of the sequences recited in the claim. Similarly, a step of merely “isolating DNA and/or RNA from the wheat plant,” which is also recited as one of the methods of detecting, will not be sufficient to detect the presence or absence of SEQ ID NO: 1 or a nucleotide sequence encoding a protein with 96% identity to SEQ ID NO: 2.
The recitation “wherein a wheat plant comprising the nucleotide sequence and/or the R protein comprises the R gene,” as instantly amended, introduces further ambiguity into the claim language because it is unclear how it limits the claimed method. For example, in lines 7-8, the claim recites “wherein the R gene comprises a nucleotide sequence selected from the group consisting of”, yet the newly amended “wherein” clause sets forth the reverse relationship between the R gene and the “nucleotide sequence.” It is thus unclear which limitation is broader: the R gene that “comprises a nucleotide sequence” (as recited in line 7) or the nucleotide sequence that “comprises the R gene” (as recited in the amended “wherein” clause). The metes and bounds are unclear.
Given that claims 4 and 22 depend from claim 1 and fail to recite additional limitations overcoming its indefiniteness, these dependent claims are indefinite as well.
Claim Interpretation
10. The following is noted with regard to claim interpretation. Claim 1 is directed to a method of identifying a wheat plant comprising in its genome an R gene, wherein the R gene comprises or encodes one of the specified nucleic acid or amino acid sequences. The method comprises a single step of “specifically detecting the presence of the R gene.”
The claim does recite that the detecting is accomplished via one of the recited techniques, and does set forth the sequence information for the R gene and encoding protein that is to be detected. However, the claim does not specify a structure or structures to be used in the actual active method step. While claim 1 recites “specifically detecting” the R gene, the term “specifically,” which is not defined in the specification, is read as not being exclusive of detecting the presence of an R gene that has less than 100% identity to SEQ ID NO: 1 or 3, for example. It is also noted that the claims do not require that the plant to which the method is applied actually be resistant to wheat stem rust.
Claim Rejections - 35 USC § 103
11. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
12. Claims 1 and 4 remain and claim 22 is rejected under 35 U.S.C. 103 as being obvious over Lagudah et al (US Patent Publication, 20160138042, effective filing date June 6, 2013). Applicant’s argument submitted on January 22, 2026 was fully considered but it is not persuasive.
The applied reference has a common Inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
The Examiner notes that the instant specificaiton teaches that SEQ ID NO: 3 is the coding sequence of the Sr22 gene from Triticum aestivum ‘Schomburgk’, while SEQ ID NO: 1 is the genomic sequence of the same gene (see pages 6-7).
Lagudah et al teach wheat R genes encoding proteins that confer resistance to wheat stem rust, including wherein the R gene comprises SEQ ID NO: 1 or 3 (paragraphs 0001-0005). Lagudah et al teach a transgenic plant, including wheat, comprising an exogenous polynucleotide comprising said R gene (claims 1-10).
Lagudah et al teach a method of identifying a plant comprising said polynucleotide encoding said R protein, comprising obtaining a nucleic acid sample from a plant and screening said sample for the presence of absence of the polynucleotide (claims 37-39). Lagudah et al teach using a variety of methods to detect the presence of said polynucleotide, including PCR or nucleic acid probes, including wherein the oligonucleotides used as primers or probes are 10 to 30 or 15-25 nucleotides in length (paragraphs 0164-0165).
The nucleic acid of SEQ ID NO: 3 of Lagudah et al comprises several regions of 100% identity to the instant SEQ ID NO: 3, across at least 10 nucleotides, including the ones shown in the alignment below (the instant SEQ ID NO: 3 is the “Query”):
Range 1: 589 to 635
Query 598 GTCTCTATTGTTGGATATGGAGGGTTGGGCAAGACCACGCTCGCCAA 644
||||| |||||||||| ||||||||||||||||||||| || |||||
Sbjct 589 GTCTCCATTGTTGGATTTGGAGGGTTGGGCAAGACCACTCTTGCCAA 635
Range 4: 2555 to 2583
Query 2507 TAATGTTTGAACCGGGGGCTATGCCGAGG 2535
||||||||||| | || ||| ||||||||
Sbjct 2555 TAATGTTTGAATCAGGAGCTTTGCCGAGG 2583
Lagudah et al do not teach detecting the R genes as a single embodiment, using polynucleotides recognizing specific regions of SEQ ID NO: 3.
At the time of filing, it would have been prima facie obvious to one of ordinary skill in the art to follow the suggestion of Lagudah et al and use a probe or a primer pair that would recognize the R gene of their invention or the coding sequence of said gene, in a method of detecting the presence of said gene in a wheat plant, including wherein the plant exogenously expresses a construct comprising said gene. A probe specifically recognizing the regions of identity shown in the above alignments will necessarily recognize the corresponding regions in the instant SEQ ID NO: 3 (encoding SEQ ID NO: 2), and the method would read on the active step of the instantly claimed method of claims 1 and 4, in view of the above claim interpretation. It is noted that detecting the coding region will also detect the genomic sequence of the gene, represented by SEQ ID NO: 1, given that SEQ ID NO: 3 has 99.9% identity to SEQ ID NO: 1 over 69.8% of the length of SEQ ID NO: 3 (see the June 18, 2026 sequence search results for SEQ ID NO: 3 against the Published Applications Database, Result 20).
It would have been obvious to use any region of SEQ ID NO: 3 as a target for a probe or a primer (instant claim 22), with the specific region being a matter of routine optimization (MPEP 2144.05). For example, it would have been obvious to use a probe or a primer recognizing the 5’ half of the coding sequence (such as shown in “Range 1,” above) and/or a second probe or primer recognizing the 3’ end of the sequence (such as shown in “Range 4,” above).
One would have been motivated to do so given the express suggestion of Lagudah et al. Given the routine nature of the techniques involved, one would have had reasonable expectation of success.
Response to Arguments
Applicant argues that the claims have been amended to recite a wheat plant comprising the nucleotide sequence of the R gene at issue or the encoded protein. Applicant argues that “Without knowledge of the nucleotide sequences of the R genes of the present invention, a person having ordinary skill in the art at the time when the application was filed would not have been able to make and use Applicants' presently claimed method of identifying a wheat plant comprising in its genome an R gene of the present invention, which involves identifying a wheat plant comprising in its genome a nucleotide sequence selected from the group consisting of the nucleotide sequences set forth in (a)-(d) of claim 1. Moreover, the Examiner does not allege that Lagudah et al. teaches or even suggests the nucleotide sequences of an R gene of the present invention such as, for example, an R gene comprising the nucleotide sequenced set forth in (a)-(d) of claim 1” (pages 7-8 of the Remarks).
Applicant’s arguments are not found to be persuasive. Applicant’s claim amendments are acknowledged and the rejection has been modified accordingly. However, the amendments are not sufficient to overcome the rejection.
The instant issue is not the obviousness of the recited R gene but of the claimed method. The method is drawn to detecting the presence of said gene, and claim 1 does not require the use of any sequences comprised within or comprising SEQ ID NO: 1, 3, or a polynucleotide encoding an R protein with 96% identity to SEQ ID NO: 2. Claim 1 does not recite the use of any structures, such as, for example, primers or probes of a defined sequence.
The fact that a plant whose identification is the objective of the claimed method may be recited as comprising said R gene does not change the above analysis, because the presence of said gene in said plant does not affect the manner in which that presence is being detected. For example, any PCR amplification or probe hybridization method that may detect the presence of SEQ ID NO: 1 or 3 in a plant may also be used to detect the absence of said sequences. Similarly, a probe or primer pair that may detect a nucleic acid sequence comprising SEQ ID NO: 1 or 3 may not be required to hybridize with either of those sequences, in order to be utilized in a method of detection. Moreover, a method that detects an R gene having partial sequence identity to SEQ ID NO: 1 or 3 will also read on the instant invention. For these reasons, the claim amendments and Applicant’s arguments in the Remarks are not sufficient to overcome the rationale underpinning the prima facie funding of obviousness.
The Examiner maintains that reciting a specific structure or structures, such as a primer pair or probe identified by SEQ ID NO’s, to be used in the claimed method, may help overcome the rejection, provided that the use of said structures in the method is free from the prior art.
Conclusion
13. No claims are allowed.
14. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MYKOLA V KOVALENKO whose telephone number is (571)272-6921. The examiner can normally be reached Mon.-Fri. 9:00-5:30 PST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at (571)270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/MYKOLA V. KOVALENKO/Primary Examiner, Art Unit 1662
Prosecution Insights