Prosecution Insights
Last updated: July 28, 2026
Application No. 17/572,262

TRANSCRIPTIONAL REGULATORY ELEMENT AND ITS USE IN ENHANCING THE EXPRESSION OF HETEROLOGOUS PROTEIN

Non-Final OA §112§OTHER
Filed
Jan 10, 2022
Priority
Aug 14, 2018 — CN PCT/CN2018/100467 +2 more
Examiner
VIJAYARAGHAVAN, JAGAMYA NMN
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Wuxi Biologics Ireland Limited
OA Round
3 (Non-Final)
62%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 62% of resolved cases
62%
Career Allowance Rate
21 granted / 34 resolved
+1.8% vs TC avg
Strong +46% interview lift
Without
With
+46.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
39 currently pending
Career history
83
Total Applications
across all art units

Statute-Specific Performance

§103
53.4%
+13.4% vs TC avg
§102
3.4%
-36.6% vs TC avg
§112
21.4%
-18.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 34 resolved cases

Office Action

§112 §OTHER
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on April 1, 2026 has been entered. Status of claims Claims 21-40 are pending. Claims 1-20 are cancelled. Claims 38-40 have been withdrawn. WITHDRAWN REJECTIONS Double Patenting Claims 21-34 were rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11,254,952 (hereinafter "'952 patent"). Claims 35-37 were rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-20 of U.S. Patent No. 11,254,952 (hereinafter "'952 patent") further in view of Lee et at (Appl Microbiol. Biotechnol.; Published 25 April 2013; Hereinafter “Lee;” See PTO-892 of 5/23/2025). The rejections are withdrawn following filing and approval of terminal disclaimer. MAINTAINED REJECTIONS Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 21-37 stand rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Claim 21 recites: “A vector comprising a heterologous nucleotide sequence and a nucleotide sequence selected from the group consisting of (i) to (ii): a sequence having at least 100% to sequence identity with or differing by 1-10 nucleotides relative to of SEQ ID SEQ ID NOs: 3-9; and a sequence having at least 100% to sequence identity with or differing by 1-10 nucleotides relative to reverse complementary sequence of any of SEQ ID NOs: 3-9.” This claimed composition encompasses all vectors polynucleotides comprising 1-10 base variants across any one of SEQ ID NOs: 3-9. Applicant’s claims do not provide support for all nucleic acids comprising 1-10 base variants of SEQ ID NO: 3-9 or to the reverse complementary sequence of SEQ ID NO: 3-9. The specification as filed does not provide sufficient evidence that Applicants were in possession of the full scope of the claimed invention at the time of filing of the instant invention. As such, 1-10 base pair variants to a 1000 base pair polynucleotide, which is smaller than the length of any of the claimed polynucleotide encompasses   1000 C 10 × 3 10 = 3.49 × 10 17 nucleotide molecules. This amounts to enormous number of polynucleotides which do not have support in the specification. The specification also does not provide any guidance on how or where the nucleotides need to be changed. It is clear that the vector of the invention was restricted to SEQ ID NOs: 3-9. For example, see instant specification at [0153] – [0159] and [0165]. Thus, Applicants were not in possession of the full scope of the claimed invention at the time of filing of the instant invention. Claims 22-37 inherit the rejection due to their dependency on claim 21. It is also noted that similar analyses apply for the subject matter of claims 28-34 notwithstanding their dependence on claim 21 as indicated in previous office actions. Regarding claims 22 and 26: Claim 22 recites: “The vector of claim 21, further comprising a nucleotide sequence selected from the group consisting of (iii) to (iv): a sequence having at least 80% identity to sequence identity with SEQ ID NO: 13; and a sequence having at least 80% identity with a reverse complementary sequence of SEQ ID NO: 13” This claimed composition encompasses all vectors polynucleotides comprising 80% identity to SEQ ID NO: 13, which the specification indicates as the first intron of human EF1α. (See specification [0084], [0119]-[0120]). Applicant’s claims do not provide support for all nucleic acids comprising 20% variants of SEQ ID NO: 13 or to the reverse complementary sequence of SEQ ID NO: 13. The specification as filed does not provide sufficient evidence that Applicants were in possession of the full scope of the claimed invention at the time of filing of the instant invention. As such, 20% of base pair variants of SEQ ID NO: 13, a 943 bp polynucleotide encompasses   943 C 189 × 3 189 = 1 × 10 295 polynucleotide molecules, when only substitution mutations are considered. It is noted that the claim also encompasses deletions and insertions, which raises the number of polynucleotide molecules. This amounts to enormous number of polynucleotides which do not have support in the specification. The specification also does not provide any guidance on how or where the nucleotides need to be changed. It is clear that the vector of the invention was restricted to SEQ ID NOs: 13. For example, see instant specification at [0084], [0119]-[0120]. Thus, Applicants were not in possession of the full scope of the claimed invention at the time of filing of the instant invention. Similar rejection applies to claim 26. Regarding claim 24: Claim 24 is directed to a CMV promoter comprising 80% identity to SEQ ID NO: 16. Applicant’s specification does not provide support for all nucleic acids which are 20% variants of SEQ ID NO: 16. The specification as filed does not provide sufficient evidence that Applicants were in possession of the full scope of the claimed invention at the time of filing of the instant invention. As such, 20% of base pair variants of SEQ ID NO: 16, a 680 bp polynucleotide encompasses   680 C 136 × 3 136 = 1 × 10 213 polynucleotide molecules, when only substitution mutations are considered. It is noted that the claim also encompasses deletions and insertions, which raises the number of polynucleotide molecules. This amounts to enormous number of polynucleotides which do not have support in the specification. The specification also does not provide any guidance on how or where the nucleotides need to be changed. It is clear that the vector of the invention was restricted to SEQ ID NOs: 16. For example, see instant specification at Table 8-9. Thus, Applicants were not in possession of the full scope of the claimed invention at the time of filing of the instant invention. Response to Arguments: Applicants argued that the newly issued written description guidelines were promulgated in response to developments in case law since the Lilly decision permitted reliance upon specific sequences that were known in the art, rather than requiring them to be recited in the specification. Applicants pointed to a specific example of “Claim 1. An isolated nucleic acid that encodes a polypeptide with at least 85% amino acid sequence identity to SEQ ID NO: 2.” which was shown to satisfy written description requirement; when the recitation of a polypeptide with at least 85% identity represented a partial structure and there was no functional limitation, while also not indicating which 15% may vary from SEQ ID NO: 2. Applicants indicated that the written description rejection was erroneous because it appears to be based on concerns regarding the functional limitation about enhancer activity. Applicant indicated that claims 21-34 specify only structural limitations and contain no functional limitation at all, so the rejection of record is inapplicable to them. Applicants’ arguments have been fully considered but are not persuasive. It is submitted that Applicants incorrectly assume that lack of functional language in the claims. It is noted that the instant claims are directed to a vector. The specification describes a “vector” as “a polynucleotide sequence encoding a certain protein operatively inserted therein and enables the expression of this protein in a genetic engineering recombinant technique. The vector can be used to transform, transduce or transfect a host cell, and enable the genetic material element carried by the vector to be expressed in the host cell.“ (See Specification [0096]). As such the claims are directed to a functional entity – a vector, which expresses a protein of interest in a cell of interest. As such the argued claim 1 of the USPTO guidance does not apply to the instant claims. Enhancers are defined as DNA sequences that can activate transcription independent of direction and distance to a promoter (See evidence in Thomas; p. 1; col. 2, para 1, PTO-892). Li evaluated enhancer variants and identified that on average “11% of enhancer positions are prone to KMs [killer mutations].“ (See Li Abstract, PTO-892). Li’s study identified specific nucleotide positions in enhancers where mutation can disrupt transcription factor binding and deactivate enhancer activity, demonstrating that enhancer function is highly sensitive to single nucleotide change. Li “identified 3,756,018 enhancer positions that carry KMPs [killer mutation positions] in HepG2 cell line, approximately 48% of which could cause KMs by all three possible mutations.“ (See Li; p. 2162, col. 2, para 1). As such Li taught that at least certain positions in enhancers are crucial for maintaining activity. The specification does not identify regions in the WXRE enhancer elements that can affect its function in a vector. It is also submitted that 10 nucleotide change still amounts to a large number of variations in the enhancer sequence with no restriction on the position. As such, there was no support for all sequences encompassed by the claims. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claim 21-37 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 16-36 of copending Application No. 17/801,038 (hereinafter '038 application) (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because of the reasons set forth below. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Regarding claims 21 and 35: Claim 30 of the reference application recites a vector comprising among other elements, a SEQ ID NO: 35, which is 100% identical to instantly claim SEQ ID NO: 3 and a SEQ ID NOs: 36 and 46 which are 100% and 97.4% identical to instantly claimed SEQ ID NO: 4. (See alignments below) Further claim 25 of the ‘038 application teaches a sequence encoding an antibody (as required by claim 35), which reads on the claimed heterologous sequence. ‘038 application also Query Match 100.0%; Score 3619; Length 3619; Best Local Similarity 100.0%; Matches 3619; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GATCTGCCTGCCTCTGCCCCGTGAGTGCTGGGATTAAAGGCCAGCACCGCCATGCCTGGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3619 GATCTGCCTGCCTCTGCCCCGTGAGTGCTGGGATTAAAGGCCAGCACCGCCATGCCTGGC 3560 Qy 61 CTCCTTTAAGTGCAGGTGTAGCACGCCAGAAATACCCTGCTGGTGACAGTGTGAGCCACA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3559 CTCCTTTAAGTGCAGGTGTAGCACGCCAGAAATACCCTGCTGGTGACAGTGTGAGCCACA 3500 Qy 121 TGCGTGAGACTGCTGCAGAGGTCCCAGCTTAGGTTGTGCCCTTCTTTCTTGAGAAATGTC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3499 TGCGTGAGACTGCTGCAGAGGTCCCAGCTTAGGTTGTGCCCTTCTTTCTTGAGAAATGTC 3440 Qy 181 TTACTTGGTGATTTTGAGTGGAAACATGTATTTAGCTGACATATGAGCCTAGTCTTTTAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3439 TTACTTGGTGATTTTGAGTGGAAACATGTATTTAGCTGACATATGAGCCTAGTCTTTTAT 3380 Qy 241 GTATAAATGTGTGTTATATTTCTAGATACAAAAATATTAAAAATTAGAAATCTTCAGGGC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3379 GTATAAATGTGTGTTATATTTCTAGATACAAAAATATTAAAAATTAGAAATCTTCAGGGC 3320 Qy 301 TGGAGAGGGGTTCATTGGTTAAGAGCTCATTGGTTAAGGGCTGCTCCTGTATAGGACCCG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3319 TGGAGAGGGGTTCATTGGTTAAGAGCTCATTGGTTAAGGGCTGCTCCTGTATAGGACCCG 3260 Qy 361 GGTTACCTGTCAGCACCGTATGACGGCTCTCAACCATCTGCAGCTCCCGTTCCAGAGGAC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3259 GGTTACCTGTCAGCACCGTATGACGGCTCTCAACCATCTGCAGCTCCCGTTCCAGAGGAC 3200 Qy 421 CCAGTGTCTTCTTCTGGCCTCTACAGACATACATATAGACAAAACACCCATACACAAAAA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3199 CCAGTGTCTTCTTCTGGCCTCTACAGACATACATATAGACAAAACACCCATACACAAAAA 3140 Qy 481 TTTAATTAGAAATCTTAATTTTTTTCTTTCAATTTTCTAGATTGACTGGGGATAACTTTT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3139 TTTAATTAGAAATCTTAATTTTTTTCTTTCAATTTTCTAGATTGACTGGGGATAACTTTT 3080 Qy 541 TTGTTAACTTTACTGTCTTGAGGATAACGTTCAGTATGAGTTGTATTTCTAGAGTTTGTC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3079 TTGTTAACTTTACTGTCTTGAGGATAACGTTCAGTATGAGTTGTATTTCTAGAGTTTGTC 3020 Qy 601 TTTATTTTTAGGCAAAAATAACCTTTATTACCATTTTGGGGGGTGACTGTTTTACAACTT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3019 TTTATTTTTAGGCAAAAATAACCTTTATTACCATTTTGGGGGGTGACTGTTTTACAACTT 2960 Qy 661 TTCCAACTTTCTGCTTCATCTCTTGTGTCCTATATAGGCCCCTATTTACTGTCATTATTA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2959 TTCCAACTTTCTGCTTCATCTCTTGTGTCCTATATAGGCCCCTATTTACTGTCATTATTA 2900 Qy 721 GAGATAGGACTTGATGTCATGTCAACTCCATCTTTGTTATAAATCTCAAGAAGAGCTAAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2899 GAGATAGGACTTGATGTCATGTCAACTCCATCTTTGTTATAAATCTCAAGAAGAGCTAAT 2840 Qy 781 TTCTTTTGTGTTATTACAACCAAAAATAAACAAGGTAGCTTATAAACAGTGACTTATTTT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2839 TTCTTTTGTGTTATTACAACCAAAAATAAACAAGGTAGCTTATAAACAGTGACTTATTTT 2780 Qy 841 TATAGTTCTAGATATGGGAAGATCATGGTGACAGTAGATTCAATGTCTAGTTGGAAGTTG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2779 TATAGTTCTAGATATGGGAAGATCATGGTGACAGTAGATTCAATGTCTAGTTGGAAGTTG 2720 Qy 901 ACTCTTCTTCATAGATGGAATCCTTGCTATAATATAATCTCAGGATGGAAGGGATGAGCT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2719 ACTCTTCTTCATAGATGGAATCCTTGCTATAATATAATCTCAGGATGGAAGGGATGAGCT 2660 Qy 961 AAGCCCTCTGGGATCTCTTATTAATCTGTTCATTCATTTACTTATTGCATAGTGCTCTAA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2659 AAGCCCTCTGGGATCTCTTATTAATCTGTTCATTCATTTACTTATTGCATAGTGCTCTAA 2600 Qy 1021 TTCTGTTCATGGAGACTCTGTTCTTACACATTAGGTGGTTAGGGAGGGACATGATCAATC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2599 TTCTGTTCATGGAGACTCTGTTCTTACACATTAGGTGGTTAGGGAGGGACATGATCAATC 2540 Qy 1081 AGGACATAGGAGCAACAATAATTTTTATTATATTTCCCAAAATACATGGCAGTTCCTGAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2539 AGGACATAGGAGCAACAATAATTTTTATTATATTTCCCAAAATACATGGCAGTTCCTGAC 2480 Qy 1141 CTTGCTTTATTACTGCAAACATACAGCTTGTGGCCATTGGACTTAGCCATATGAGAAATG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2479 CTTGCTTTATTACTGCAAACATACAGCTTGTGGCCATTGGACTTAGCCATATGAGAAATG 2420 Qy 1201 TAAGAATTTATTTTATATTGTAGCTGCAAATGGTAGGTTCATCAAATTGTGCCTTAAGTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2419 TAAGAATTTATTTTATATTGTAGCTGCAAATGGTAGGTTCATCAAATTGTGCCTTAAGTT 2360 Qy 1261 CACATCTTAATTTGCTACAAAAAAAAAAGAGGAGTAGTGTAAGTTACATTTAATTTTCAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2359 CACATCTTAATTTGCTACAAAAAAAAAAGAGGAGTAGTGTAAGTTACATTTAATTTTCAA 2300 Qy 1321 TTACTTAGTAACAGTTTGTAAGTGCTACTTGATCCTGTTTTATATCTAGCATTGAGTATA 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2299 TTACTTAGTAACAGTTTGTAAGTGCTACTTGATCCTGTTTTATATCTAGCATTGAGTATA 2240 Qy 1381 GATCAACAAGTGTTTCAATTCTTGTTTGGACATGCTGTTCTCTCCTTCATCACAAGTTAC 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2239 GATCAACAAGTGTTTCAATTCTTGTTTGGACATGCTGTTCTCTCCTTCATCACAAGTTAC 2180 Qy 1441 TTCTGGCTAAACAAGGCACAAATTTCGCATGACCACCAATCCAAGGACAGGGCGACAATT 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2179 TTCTGGCTAAACAAGGCACAAATTTCGCATGACCACCAATCCAAGGACAGGGCGACAATT 2120 Qy 1501 TTAATGAGTTTCATTGAGAGCTGGCCAACTGAGCATCTGTTCCTTTTGTTTTCCTGTACG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2119 TTAATGAGTTTCATTGAGAGCTGGCCAACTGAGCATCTGTTCCTTTTGTTTTCCTGTACG 2060 Qy 1561 TGGTAAGCCAGTGTTTCTACACTCCTTAGCCTTGTTGCTGTGTGTATAGTGTGGGGTGGA 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2059 TGGTAAGCCAGTGTTTCTACACTCCTTAGCCTTGTTGCTGTGTGTATAGTGTGGGGTGGA 2000 Qy 1621 TTTGTTTTTGCTGTTCTTTTTTCTTTTTTCTACCCTCTACTTCAGTGGTGCACGGTTAGA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1999 TTTGTTTTTGCTGTTCTTTTTTCTTTTTTCTACCCTCTACTTCAGTGGTGCACGGTTAGA 1940 Qy 1681 AATCTTGTGGCGTCTGGCACGGTGGTATAATTCCTTCCATGCTCTTGGGTGAGGAAATAA 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1939 AATCTTGTGGCGTCTGGCACGGTGGTATAATTCCTTCCATGCTCTTGGGTGAGGAAATAA 1880 Qy 1741 GTTTGCTCATTGCTGCTCATCAGTCTGTTTCACTTGCTCCCAGATGGTGACCTTCTCGTC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1879 GTTTGCTCATTGCTGCTCATCAGTCTGTTTCACTTGCTCCCAGATGGTGACCTTCTCGTC 1820 Qy 1801 CCATTCTTGCTTGTTTTAACATTATTCTGACACCTATTTTCTTTCATTGTCCCCTTAACC 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1819 CCATTCTTGCTTGTTTTAACATTATTCTGACACCTATTTTCTTTCATTGTCCCCTTAACC 1760 Qy 1861 ACTCTAATTGAATAATGATTTCTGTAATTTCCATTTGGAACACAACCAGCTTCCTGGTTC 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1759 ACTCTAATTGAATAATGATTTCTGTAATTTCCATTTGGAACACAACCAGCTTCCTGGTTC 1700 Qy 1921 CTTTTATTGGCCCACATCCTGTCTTCTAGTTCATTGCTTCAGATTTGAGCCAAATCATCA 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1699 CTTTTATTGGCCCACATCCTGTCTTCTAGTTCATTGCTTCAGATTTGAGCCAAATCATCA 1640 Qy 1981 AATAAAAATACGTAACTGAAAAAAATGTTTATTGCAGTGGCCTCCTCTAGCATGGCAACA 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1639 AATAAAAATACGTAACTGAAAAAAATGTTTATTGCAGTGGCCTCCTCTAGCATGGCAACA 1580 Qy 2041 ATGAGAGTTTTCCTTTCTTATTGCTAAACATGTTATATCTGTCTCATGATTTCATACTGT 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1579 ATGAGAGTTTTCCTTTCTTATTGCTAAACATGTTATATCTGTCTCATGATTTCATACTGT 1520 Qy 2101 CTCTCCTGGCCTCATTTACTGCTTGACCTTTAAAAGAAATGACTCAAAGATATTTTTGTA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1519 CTCTCCTGGCCTCATTTACTGCTTGACCTTTAAAAGAAATGACTCAAAGATATTTTTGTA 1460 Qy 2161 GTTCTGTAAGCATTTCTCTAGTTCTTGTTCTTCACCTTTAGTTCTTAACAGTAGTTTTGT 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1459 GTTCTGTAAGCATTTCTCTAGTTCTTGTTCTTCACCTTTAGTTCTTAACAGTAGTTTTGT 1400 Qy 2221 CTGCTACACTGACGTGGCTGTGAGGACTTTCCTTCAGAAACTGGCGTCTGATACTGATTC 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1399 CTGCTACACTGACGTGGCTGTGAGGACTTTCCTTCAGAAACTGGCGTCTGATACTGATTC 1340 Qy 2281 AAACTGGTCTCCATTGTGGCCTACATGTCCAGCTGTCTCCATGTAACGCCACTGAAATAC 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1339 AAACTGGTCTCCATTGTGGCCTACATGTCCAGCTGTCTCCATGTAACGCCACTGAAATAC 1280 Qy 2341 AGTGAAGCCAGCCTTTTTTTCCCCCTTATGGTTCAAAGCAACTGAATTTCAGTCAGAGTA 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1279 AGTGAAGCCAGCCTTTTTTTCCCCCTTATGGTTCAAAGCAACTGAATTTCAGTCAGAGTA 1220 Qy 2401 ATTTTGGTTTGGGTATCAATACTAATTGTAGTCTTAGACCTTTTAATTATTACTTGTTTG 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1219 ATTTTGGTTTGGGTATCAATACTAATTGTAGTCTTAGACCTTTTAATTATTACTTGTTTG 1160 Qy 2461 CATTTTACAGAAGACATTGGTCCTTCTCAAAAGCAGAGATGAAACCTGTAGTATTTTGTG 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1159 CATTTTACAGAAGACATTGGTCCTTCTCAAAAGCAGAGATGAAACCTGTAGTATTTTGTG 1100 Qy 2521 TGTAGTTTTCCTCTGCTGGTTGCCCTGTAACTATTCAGTTCCTGTAAGGAAGCACAGCTG 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1099 TGTAGTTTTCCTCTGCTGGTTGCCCTGTAACTATTCAGTTCCTGTAAGGAAGCACAGCTG 1040 Qy 2581 CTTCATAAGCTACCTTAGGCTGACAGCAGTCTCCTGAAAGAAAGAGTTCAAGAAAGAAAC 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1039 CTTCATAAGCTACCTTAGGCTGACAGCAGTCTCCTGAAAGAAAGAGTTCAAGAAAGAAAC 980 Qy 2641 ATTTAAAAATAAAAATGGGGAGGGGTCCAAGTAGTATTTGAAGCCATGAAATATCTTGAA 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 979 ATTTAAAAATAAAAATGGGGAGGGGTCCAAGTAGTATTTGAAGCCATGAAATATCTTGAA 920 Qy 2701 TATAGTTTGCTTTTTTGTTTTGTTTTGTCTGTCTGTCTGTCCGATGTAGCTTTGGCCATA 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 919 TATAGTTTGCTTTTTTGTTTTGTTTTGTCTGTCTGTCTGTCCGATGTAGCTTTGGCCATA 860 Qy 2761 TCAACCAGGCTGTCCTTGAACTCACAGAAATCCACCTGCCTCCGCCTCCCAAGTGCTGGA 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 859 TCAACCAGGCTGTCCTTGAACTCACAGAAATCCACCTGCCTCCGCCTCCCAAGTGCTGGA 800 Qy 2821 TGCACCACCATGCCAGCTAGTTTGCTTTTTAGAGCATCTCATCTGCTGCTCACAGCCCTG 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 799 TGCACCACCATGCCAGCTAGTTTGCTTTTTAGAGCATCTCATCTGCTGCTCACAGCCCTG 740 Qy 2881 GTGCTTTATGGGATTTGTTTGGGGAACATGATGAGCTCTATATTTATTGTAGCTTTAAAT 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 739 GTGCTTTATGGGATTTGTTTGGGGAACATGATGAGCTCTATATTTATTGTAGCTTTAAAT 680 Qy 2941 GGACAGCGGTTATTGACTGTCAGCTTAGTCTTTAAAATCTATAATCACATTGTACCTAAT 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 679 GGACAGCGGTTATTGACTGTCAGCTTAGTCTTTAAAATCTATAATCACATTGTACCTAAT 620 Qy 3001 TGTCAACCTTCATGTTTTTTAATTATGAAAAAAACTGAGAACATTAATTTTTATGTTATC 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 619 TGTCAACCTTCATGTTTTTTAATTATGAAAAAAACTGAGAACATTAATTTTTATGTTATC 560 Qy 3061 TTGTTATTGACTTTATTGAAATACTACAGAAAATTTTGGTTTGAGGCTTTTCCATAATTT 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 559 TTGTTATTGACTTTATTGAAATACTACAGAAAATTTTGGTTTGAGGCTTTTCCATAATTT 500 Qy 3121 ACCCTTACACCTCACACCCCTTCCATAAACATGTGCAGTTAAAATTGAATTGTTCGGGCA 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 499 ACCCTTACACCTCACACCCCTTCCATAAACATGTGCAGTTAAAATTGAATTGTTCGGGCA 440 Qy 3181 CTTCTACCTTGATACCTGGCCTACAGTGGGAAAGGTCTGTCTTTCTTTGGAATAAGCCCA 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 439 CTTCTACCTTGATACCTGGCCTACAGTGGGAAAGGTCTGTCTTTCTTTGGAATAAGCCCA 380 Qy 3241 TCAGTGGCCTTGTGTACATTCTGTATTTTTGTTGTTTGTTATTACTGTTTTTTACTTGGG 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 379 TCAGTGGCCTTGTGTACATTCTGTATTTTTGTTGTTTGTTATTACTGTTTTTTACTTGGG 320 Qy 3301 ACTAATAATCTGTTTGAAACTGACTGAGATAGAAAGATGTGATGTTCCTTCCCACTCACT 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 319 ACTAATAATCTGTTTGAAACTGACTGAGATAGAAAGATGTGATGTTCCTTCCCACTCACT 260 Qy 3361 CCGGATTTTGATAGAAGACTTGTTTTATTTATTTCCAAAATTATATCCGCAGGAAACAAG 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 259 CCGGATTTTGATAGAAGACTTGTTTTATTTATTTCCAAAATTATATCCGCAGGAAACAAG 200 Qy 3421 CTGTTTAAATTCAGATTATGCTGAAGCAAAATGGTCCTGGTATGAGAAGCAACGTGCTGT 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 199 CTGTTTAAATTCAGATTATGCTGAAGCAAAATGGTCCTGGTATGAGAAGCAACGTGCTGT 140 Qy 3481 TTTACGAGCACAGAGTCCCTTTTCTCATAACTGATTGATAGTAAATATTTTCCTGAAGAA 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 139 TTTACGAGCACAGAGTCCCTTTTCTCATAACTGATTGATAGTAAATATTTTCCTGAAGAA 80 Qy 3541 TTATTGCCAACCATGAACAGTGCAACTGTTTCACTTTTTTTCCGTGCTACTTGCTGTACC 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 79 TTATTGCCAACCATGAACAGTGCAACTGTTTCACTTTTTTTCCGTGCTACTTGCTGTACC 20 Qy 3601 AGCCATTGTCGGTAATTAA 3619 ||||||||||||||||||| Db 19 AGCCATTGTCGGTAATTAA 1 100% identity of SEQ ID NO: 35 to claimed SEQ ID NO: 3 Query Match 100.0%; Score 1114; Length 1114; Best Local Similarity 100.0%; Matches 1114; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GATCTGAAGTTTGGATCTGCAGAACCCACACAAAGGCCTACGGGCTTAGTAGTGTACCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1114 GATCTGAAGTTTGGATCTGCAGAACCCACACAAAGGCCTACGGGCTTAGTAGTGTACCTG 1055 Qy 61 CAATTTCAGCACTTGGAAGGCTGAGAAAGGATCCCAAGGGCAGCTGGCTAGCTAGGCTAG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1054 CAATTTCAGCACTTGGAAGGCTGAGAAAGGATCCCAAGGGCAGCTGGCTAGCTAGGCTAG 995 Qy 121 TGTTAGCTGAGAGCTCTGGGTTCGTGGAGCGACTCTGGTTCAGTGAATAAGATAGAGAGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 994 TGTTAGCTGAGAGCTCTGGGTTCGTGGAGCGACTCTGGTTCAGTGAATAAGATAGAGAGT 935 Qy 181 GACATCAGCTTTGGGCTTCCACAGCAAATGAGCTCACTTGCATGCAAACAGAAATGCAAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 934 GACATCAGCTTTGGGCTTCCACAGCAAATGAGCTCACTTGCATGCAAACAGAAATGCAAA 875 Qy 241 CACATGCACAAAGCAAAACAAAAGGAACACAGGCCAAAGGTGGGTCATTCCTATACCATC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 874 CACATGCACAAAGCAAAACAAAAGGAACACAGGCCAAAGGTGGGTCATTCCTATACCATC 815 Qy 301 CCCTCAGCAGGGTGCAGTCCCCACACCCTGACCCAGTTCCCTCATGATGTTAGAGAAAAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 814 CCCTCAGCAGGGTGCAGTCCCCACACCCTGACCCAGTTCCCTCATGATGTTAGAGAAAAT 755 Qy 361 AACTTTGCCCCCTTCAACGAACATTTCAGCTCCAGAGAACCTGGCCCACTTTGAAAGCTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 754 AACTTTGCCCCCTTCAACGAACATTTCAGCTCCAGAGAACCTGGCCCACTTTGAAAGCTT 695 Qy 421 TAATTAGAAATGTGCAATTACCCGGAACAGATGTCTGTTGTGATTGTGGAGACATAGGTT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 694 TAATTAGAAATGTGCAATTACCCGGAACAGATGTCTGTTGTGATTGTGGAGACATAGGTT 635 Qy 481 AAAGAATCACACAGCAGTTTGCGTGGTTACAGAAAGGTTGCAAGTAACTTTAAAACACAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 634 AAAGAATCACACAGCAGTTTGCGTGGTTACAGAAAGGTTGCAAGTAACTTTAAAACACAG 575 Qy 541 TTTTTGGTAAGTCTCCAACATGTTACCTAACATAGCATGGCCTCGATTACATGTAAGCAG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 574 TTTTTGGTAAGTCTCCAACATGTTACCTAACATAGCATGGCCTCGATTACATGTAAGCAG 515 Qy 601 TGAGTCTCCGGCTGCCTGGTTTGTGAGGGTAATGTACTTCAGCAATAGTGCTGAGGCTGT 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 514 TGAGTCTCCGGCTGCCTGGTTTGTGAGGGTAATGTACTTCAGCAATAGTGCTGAGGCTGT 455 Qy 661 ACAGTGAGTGACTCATCACCCTAAAAAAGTATCGAATTCCAGTCTTCAGAGTTAGCTTTC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 454 ACAGTGAGTGACTCATCACCCTAAAAAAGTATCGAATTCCAGTCTTCAGAGTTAGCTTTC 395 Qy 721 AGTAAAACCAAGTCAGTGGTGAAATGGCTCAGTAGGTAAGGGCACCCGCTGCCAAGCCCA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 394 AGTAAAACCAAGTCAGTGGTGAAATGGCTCAGTAGGTAAGGGCACCCGCTGCCAAGCCCA 335 Qy 781 AGACCTGTGTCCTGTCCCTGGGATCCAGTTGGTGGAAAGAGAGAACGGACTCCTGCAAGG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 334 AGACCTGTGTCCTGTCCCTGGGATCCAGTTGGTGGAAAGAGAGAACGGACTCCTGCAAGG 275 Qy 841 TGGCCTCTGACCTACATGCCTGAATTCTGCCAGACATTAAGTAAAAACAAACGCAAAAAG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 274 TGGCCTCTGACCTACATGCCTGAATTCTGCCAGACATTAAGTAAAAACAAACGCAAAAAG 215 Qy 901 GGAAGTGGGCTCACGCATAAGGCACTCACTGGACTCTACTCTTCTACTCTGTGGTTACTT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 214 GGAAGTGGGCTCACGCATAAGGCACTCACTGGACTCTACTCTTCTACTCTGTGGTTACTT 155 Qy 961 TTTGGTGTTCAAGCATACCATACCTTGATCTACATGATTTTTACTCCAAAGACACAGCCA 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 154 TTTGGTGTTCAAGCATACCATACCTTGATCTACATGATTTTTACTCCAAAGACACAGCCA 95 Qy 1021 GGGTAATGTTGTGTGATGGATCAGTCTTATTTGTTACTTGTTTACTAGTACTTACTGAGA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 94 GGGTAATGTTGTGTGATGGATCAGTCTTATTTGTTACTTGTTTACTAGTACTTACTGAGA 35 Qy 1081 TTGTCGATGGCTTTAATGTCAACATGAGTGTGGA 1114 |||||||||||||||||||||||||||||||||| Db 34 TTGTCGATGGCTTTAATGTCAACATGAGTGTGGA 1 100% identity of SEQ ID NO: 36 to claimed SEQ ID NO: 4 Query Match 97.4%; Score 1085; Length 1108; Best Local Similarity 99.8%; Matches 1107; Conservative 0; Mismatches 0; Indels 2; Gaps 2; Qy 6 GAAGTTTGGATCTGCAGAACCCACACAAAGGCCTACGGGCTTAGTAGTGTACCTGCAATT 65 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GAAGTTTGGATCTGCAGAACCCACACAAAGGCCTACGGGCTTAGTAGTGTACCTGCAATT 60 Qy 66 TCAGCACTTGGAAGGCTGAGAAAGGATCCCAAGGGCAGCTGGCTAGCTAGGCTAGTGTTA 125 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TCAGCACTTGGAAGGCTGAGAAAGGATCCCAAGGGCAGCTGGCTAGCTAGGCTAGTGTTA 120 Qy 126 GCTGAGAGCTCTGGGTTCGTGGAGCGACTCTGGTTCAGTGAATAAGATAGAGAGTGACAT 185 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 GCTGAGAGCTCTGGGTTCGTGGAGCGACTCTGGTTCAGTGAATAAGATAGAGAGTGACAT 180 Qy 186 CAGCTTTGGGCTTCCACAGCAAATGAGCTCACTTGCATGCAAACAGAAATGCAAACACAT 245 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CAGCTTTGGGCTTCCACAGCAAATGAGCTCACTTGCATGCAAACAGAAATGCAAACACAT 240 Qy 246 GCACAAAGCAAAACAAAAGGAACACAGGCCAAAGGTGGGTCATTCCTATACCATCCCCTC 305 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCACAAAGCAAAACAAAAGGAACACAGGCCAAAGGTGGGTCATTCCTATACCATCCCCTC 300 Qy 306 AGCAGGGTGCAGTCCCCACACCCTGACCCAGTTCCCTCATGATGTTAGAGAAAATAACTT 365 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AGCAGGGTGCAGTCCCCACACCCTGACCCAGTTCCCTCATGATGTTAGAGAAAATAACTT 360 Qy 366 TGCCCCCTTCAACGAACATTTCAGCTCC-AGAGAACCTGGCCCACTTTGAAAGCTTTAAT 424 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Db 361 TGCCCCCTTCAACGAACATTTCAGCTCCAAGAGAACCTGGCCCACTTTGAAAGCTTTAAT 420 Qy 425 TAGAAATGTGCAATTACCCGGAACAGATGTCTGTTGTGATTGTGGAGACATAGGTTAAAG 484 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TAGAAATGTGCAATTACCCGGAACAGATGTCTGTTGTGATTGTGGAGACATAGGTTAAAG 480 Qy 485 AATCACACAGCAGTTTGCGTGGTTACAGAAAGGTTGCAAGTAACTTTAAAACACAGTTTT 544 |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| Db 481 AATCACACAGCAGTTTGCGTGGTTACAG-AAGGTTGCAAGTAACTTTAAAACACAGTTTT 539 Qy 545 TGGTAAGTCTCCAACATGTTACCTAACATAGCATGGCCTCGATTACATGTAAGCAGTGAG 604 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 540 TGGTAAGTCTCCAACATGTTACCTAACATAGCATGGCCTCGATTACATGTAAGCAGTGAG 599 Qy 605 TCTCCGGCTGCCTGGTTTGTGAGGGTAATGTACTTCAGCAATAGTGCTGAGGCTGTACAG 664 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 600 TCTCCGGCTGCCTGGTTTGTGAGGGTAATGTACTTCAGCAATAGTGCTGAGGCTGTACAG 659 Qy 665 TGAGTGACTCATCACCCTAAAAAAGTATCGAATTCCAGTCTTCAGAGTTAGCTTTCAGTA 724 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 660 TGAGTGACTCATCACCCTAAAAAAGTATCGAATTCCAGTCTTCAGAGTTAGCTTTCAGTA 719 Qy 725 AAACCAAGTCAGTGGTGAAATGGCTCAGTAGGTAAGGGCACCCGCTGCCAAGCCCAAGAC 784 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 720 AAACCAAGTCAGTGGTGAAATGGCTCAGTAGGTAAGGGCACCCGCTGCCAAGCCCAAGAC 779 Qy 785 CTGTGTCCTGTCCCTGGGATCCAGTTGGTGGAAAGAGAGAACGGACTCCTGCAAGGTGGC 844 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 780 CTGTGTCCTGTCCCTGGGATCCAGTTGGTGGAAAGAGAGAACGGACTCCTGCAAGGTGGC 839 Qy 845 CTCTGACCTACATGCCTGAATTCTGCCAGACATTAAGTAAAAACAAACGCAAAAAGGGAA 904 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 840 CTCTGACCTACATGCCTGAATTCTGCCAGACATTAAGTAAAAACAAACGCAAAAAGGGAA 899 Qy 905 GTGGGCTCACGCATAAGGCACTCACTGGACTCTACTCTTCTACTCTGTGGTTACTTTTTG 964 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 900 GTGGGCTCACGCATAAGGCACTCACTGGACTCTACTCTTCTACTCTGTGGTTACTTTTTG 959 Qy 965 GTGTTCAAGCATACCATACCTTGATCTACATGATTTTTACTCCAAAGACACAGCCAGGGT 1024 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 960 GTGTTCAAGCATACCATACCTTGATCTACATGATTTTTACTCCAAAGACACAGCCAGGGT 1019 Qy 1025 AATGTTGTGTGATGGATCAGTCTTATTTGTTACTTGTTTACTAGTACTTACTGAGATTGT 1084 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1020 AATGTTGTGTGATGGATCAGTCTTATTTGTTACTTGTTTACTAGTACTTACTGAGATTGT 1079 Qy 1085 CGATGGCTTTAATGTCAACATGAGTGTGG 1113 ||||||||||||||||||||||||||||| Db 1080 CGATGGCTTTAATGTCAACATGAGTGTGG 1108 97.4% identity of SEQ ID NO: 46 to claimed SEQ ID NO: 4 Response to Arguments: Applicants argued that the present application has an effective filing date of August 14, 2019, which is earlier than the effective filing date of Feb 18, 2021, for the 17/801,038 Application. Consequently, pursuant to M.P.E.P. § 1490(VI)(D) this rejection should be withdrawn. It is submitted that according to MPEP 804(I)(B)(1)(b)(i) and MPEP 1490(VI)(D)(2)(a), a provisional nonstatutory double patenting rejection is only withdrawn when it is the only rejection remaining in an application having the earliest effective U.S. filing date (taking into account any benefit under 35 U.S.C. 120, 121, 365(c), or 386(c) ) with respect to the conflicting claims); at which point the "provisional" nonstatutory double patenting rejection in the other (later filed) application(s) will be converted into a nonstatutory double patenting rejection when the application with the earliest U.S. effective filing date issues as a patent. PNG media_image1.png 18 19 media_image1.png Greyscale Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JAGAMYA VIJAYARAGHAVAN whose telephone number is (703)756-5934. The examiner can normally be reached 9:00a-5:00p. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher M. Babic can be reached at 571-272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JAGAMYA NMN VIJAYARAGHAVAN/Examiner, Art Unit 1633 /CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633
Read full office action

Prosecution Timeline

Show 1 earlier event
May 23, 2025
Non-Final Rejection mailed — §112, §OTHER
Oct 20, 2025
Response Filed
Nov 25, 2025
Final Rejection mailed — §112, §OTHER
Jan 23, 2026
Response after Non-Final Action
Apr 01, 2026
Request for Continued Examination
Apr 03, 2026
Response after Non-Final Action
Apr 21, 2026
Non-Final Rejection mailed — §112, §OTHER
Jul 17, 2026
Response Filed

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12681006
METHODS OF GENERATING HUMAN ENDOMETRIAL STROMAL FIBROBLASTS AND THREE-DIMENSIONAL MULTI-LAYERED HUMAN ENDOMETRIAL TISSUE COMPOSITIONS
4y 2m to grant Granted Jul 14, 2026
Patent 12667621
RNA FORMULATIONS SUITABLE FOR THERAPY
4y 6m to grant Granted Jun 30, 2026
Patent 12637700
NOVEL METABOLIC PATHWAY FOR PRODUCING ITACONIC ACID AND METHOD FOR PRODUCING ITACONIC ACID USING SAME
2y 5m to grant Granted May 26, 2026
Patent 12618045
AUTOMATED METHOD FOR PREPARING RETINAL PIGMENT EPITHELIUM CELLS
4y 4m to grant Granted May 05, 2026
Patent 12612432
AAV CAPSID VARIANTS FOR GENE THERAPY
4y 2m to grant Granted Apr 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
62%
Grant Probability
99%
With Interview (+46.2%)
3y 8m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 34 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month