Prosecution Insights
Last updated: April 19, 2026
Application No. 17/594,154

ANGPTL2 ANTISENSE OLIGONUCLEOTIDES AND USES THEREOF

Non-Final OA §103
Filed
Oct 04, 2021
Examiner
PERSONS, JENNA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Roche Innovation Center Copenhagen A/S
OA Round
3 (Non-Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
2y 12m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
25 granted / 48 resolved
-7.9% vs TC avg
Strong +73% interview lift
Without
With
+73.4%
Interview Lift
resolved cases with interview
Typical timeline
2y 12m
Avg Prosecution
47 currently pending
Career history
95
Total Applications
across all art units

Statute-Specific Performance

§101
8.0%
-32.0% vs TC avg
§103
27.9%
-12.1% vs TC avg
§102
14.9%
-25.1% vs TC avg
§112
30.0%
-10.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 48 resolved cases

Office Action

§103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on December 22, 2025 has been entered. Improper Amended Claim Notation The amendments to the claims filed December 22, 2025 do not comply with the requirements of 37 CFR 1.121(c) because claim 60, which is amended, is identified as “Previously Presented.” Amendments to the claims filed on or after July 30, 2003 must comply with 37 CFR 1.121(c)(2), which states that “All claims being currently amended in an amendment paper shall be presented in the claim listing, indicate a status of “currently amended,” and be submitted with markings to indicate the changes that have been made relative to the immediate prior version of the claims.” Application Status In the interest of compact prosecution, the Examiner will consider the claim listing on its merits. Examiner reserves the right to send a PTOL-324 Notice of Non-Compliant Amendment in the event of more severe deficiencies, which may result in loss of patent term. Correctly annotated, claim 60 reads “60. (Currently Amended) The ASO of claim 1, wherein the contiguous nucleotide sequence consists of the sequence set forth in SEQ ID NO: 5.” Applicant’s remarks and amendments to the claims filed December 22, 2025 are acknowledged. Claims 1, and 59-60 were amended. Claims 1, 4, 9-10, 13, 15, 29, 33, 35, 40, and 59-64 are pending. Restriction/Election All claims to the non-elected invention identified in the action mailed October 29, 2024 have been cancelled. Claims 1, 4, 9-10, 13, 15, 29, 33, 35, 40, and 59-64, all of which are drawn to the elected invention, are under consideration hereinafter. Priority Applicant’s priority claims to Application Nos. 62/828,864 and PCT/US2020/026379 are acknowledged. Claims 1, 4, 9-10, 13, 15, 29, 33, 35, 40, and 59-64 find support in Application No. 62/828,864 and therefore, the effective filing date of the claims under examination is April 3, 2019. Withdrawn Rejections The § 103 rejections raised in the prior action over Moses, Hagedorn, NM_012098.2 and Gene ID: 23452, and the aforementioned references in further view of Frieden or Benizri, are withdrawn. The withdrawal is made because, as described below, the combination of Moses, Hagedorn, and NM_012098.2, or the aforementioned in further view of Frieden or Benizri, is sufficient to render the claims obvious. Accordingly, while Applicant’s remarks and amendments to the claims have been thoroughly reviewed, they are not persuasive to place the claims in condition for allowance for the reasons that follow. Notice to Joint Inventors This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim Rejections - 35 USC § 103 – Moses in view of Hagedorn and NM_012098.2 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 4, 9-10, 15, 29, 35, 40, 59-60, and 63-64 are rejected under 35 U.S.C. 103 as being unpatentable over Moses (Moses et al., 29 March 2007, US 2007/0072209 A1; of record) in view of Hagedorn (Hagedorn et al., January 2018, Drug Discovery Today, Vol. 23, Number 1, pg. 101-114; of record), and NM_012098.2 (Homo sapiens angiopoietin like 2 (ANGPTL2), mRNA NCBI Reference Sequence: NM_012098.2, available 17 June 2018; of record). The rejections that follow are new. Regarding claims 1, and 59-60, Moses teaches an antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence that is 100% complementary to a nucleic acid sequence within the ANGPTL2 transcript set forth in instant SEQ ID NO: 1 (Table 2, pg. 23, “ANGPTL2 AGCATGTCACGCACAGTGGCCTCAT (SEQ ID NO:33)”). See alignment of record. Moses teaches the ASO is capable of modulating expression of ANGPTL2 transcript (Example 3, [0227]-[0256]; Table 2). Moses also teaches design principles for antisense approaches ([0108]-[0114]). Moses teaches that “[a]ntisense approaches comprise the design of oligonucleotides (either DNA or RNA) that are complementary to the target gene sequence (e.g., mRNA) ([0110]). Moses teaches that “a certain degree of routine experimentation is required to select optimal anti-sense molecules for particular targets. To be effective, the antisense molecule preferably is targeted to an accessible, or exposed, portion of the target RNA molecule. Although in some cases information is available about the structure of target mRNA molecules, the current approach to inhibition using antisense is via experimentation” ([0112]). Moses teaches that “antisense nucleotides complementary to the coding region sequence of a mRNA are used in accordance with the invention…” ([0112]). Moses also teaches GenBank Accession Nos that provide ANGPTL2 transcripts, e.g., NM_012098.1 (Table 3, pg. 24). Moses does not teach antisense oligonucleotides comprising a contiguous nucleotide sequence consisting of the sequence set forth in either SEQ ID NO: 4 or SEQ ID NO: 5 as required of instant claims 1, and 59-60. However, NM_012098, referred to by Moses, teaches the coding sequence of an ANGPTL2 transcript. As shown in the attached alignment in Appendix I, SEQ ID NOs: 4 and 5 are 100% complementary to regions within NM_012098.2. Finally, a search of the prior art failed to uncover any structural information for ANGPTL2 mRNA. Regarding SEQ ID NOs: 4 or 5 required of the ASOs of instant claims 1, and 59-60, it would have been obvious to one of ordinary skill in the art before the effective filing of the claimed invention to have prepared additional ASOs to the transcribed ANGPTL2 sequence, using the sequence disclosed by NM_012098.2 in view of Moses, to arrive at ASOs comprising a contiguous nucleotide sequence consisting of either SEQ ID NO: 4 or 5. It would have amounted to choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success. Moses teaches that in the absence of structural information regarding the accessible sites in a target mRNA, “the current approach to inhibition using antisense is via experimentation.” Thus, it was known in the art that routine experimentation was necessary to design ASOs that inhibit a desired target. Moses also teaches that the coding sequence (i.e., exonic sequence) is a desirable ASO target. The coding sequence of ANGPTL2 is 3,572 nucleotides in length as evidenced by NM_012098.2. Moses’ exemplary ASO is 25nts in length, and 100% complementary to the ANGPTL2 transcript disclosed in NM_012098.2. See alignments of record. Applying the design principles of Moses’ exemplary ASO, there are 3,547 possible oligonucleotides 25nts in length and 100% complementary to the coding sequence of ANGPTL2 disclosed by NM_012098.2. Among these finite possibilities are ASOs comprising a contiguous nucleotide sequence consisting of SEQ ID NOs: 4 or 5, which are 19-nts and 16-nts in length, respectively. A skilled artisan could have pursued these finite, identified solutions with a reasonable expectation of success of producing effective ASOs that inhibit ANGPTL2 because I) Moses teaches an exemplary ASO with the same structural elements that produces an effect in vitro by targeting an ANGPTL2 transcript, and II) it was well within the capabilities of one of ordinary skill to design ASOs which are 100% complementary to a known sequence, and determine their effectivity as evidenced by Moses. Moses teaches that little is known about the influence of KSHV on cellular genes, and their impact on tumorigenesis in KS. Moses teaches that identifying KSHV-regulated cellular genes that are required for KSHV-induced proliferative and phenotypic/developmental changes could provide validated intervention targets for the inhibition of KSHV-induced cellular phenomena and the treatment of KSHV-induced hyperproliferative disorders such as cancer ([0007]). In an effort to produce additional, and potentially more effective, ASOs targeting a putative KSHV-regulated cellular gene, ANGPTL2, the skilled artisan would have been motivated to apply the design parameters taught by Moses to the known, coding ANGPTL2 sequence disclosed by NM_012098.2, because Moses teaches that experimental validation is necessary to design effective ASOs. Moses’ exemplary ASO is a PMO antisense molecule, which Moses teaches is not RNase H competent ([0190]). However, Moses teaches that antisense oligonucleotides which function through RNase H are also suitable for inhibiting a target sequence ([0109]). Moses teaches a variety of chemical modifications which the ASO may comprise, e.g., phosphorothioate linkages, 2’-O-methyl sugar moieties, etc. ([0092]-[0094]). However, Moses does not teach that the ASO is a gapmer. Hagedorn teaches a gapmer antisense oligonucleotide design (Fig. 1b), comprising a central region of DNA nucleosides flanked by one or more LNA nucleosides at the 5’ and 3’ ends. Hagedorn teaches that the ASO comprises one or more phosphorothioate linkages (Fig. 1b; pg. 104, left col.). Hagedorn teaches the LNA gapmer is suitable for RNase H activation, and results in degradation of the target RNA sequence (Fig. 1c). Hagedorn teaches that LNA exhibits “unprecedented high RNA-binding affinity” (pg. 102, right col.). Hagedorn provides many exemplary LNA gapmer structures which meet the structure disclosed in Hagedorn Fig. 1b, that are effective in vitro and in vivo (pg. 106-107). Regarding the gapmer structure required of the ASOs of claims 1, and 59-60, it would have been obvious to one of ordinary skill in the art before the effective filing of the claimed invention to have modified the chemical structure of the ASO rendered obvious above, to an LNA gapmer structure of Hagedorn. It would have amounted to a simple substitution of one known chemical structure, for another known chemical structure, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in substituting the chemical structures, because Moses teaches that RNase H competent ASOs are suitable for inhibiting a target sequence, i.e., ANGPTL2 transcript, and Hagedorn teaches a known chemical structure which is RNase H competent. Moses teaches that little is known about the influence of KSHV on cellular genes, and their impact on tumorigenesis in KS. Moses teaches that identifying KSHV-regulated cellular genes that are required for KSHV-induced proliferative and phenotypic/developmental changes could provide validated intervention targets for the inhibition of KSHV-induced cellular phenomena and the treatment of KSHV-induced hyperproliferative disorders such as cancer ([0007]). Given that RNase H mechanisms are suitable for inhibiting a target sequence based on Moses, and Hagedorn teaches that LNA exhibit “unprecedented high RNA-binding affinity,” the skilled artisan would have been motivated to substitute the chemical structures in an effort to produce additional ASOs that effectively inhibit the putative KSHV-regulated cellular gene identified by Moses, ANGPTL2. Regarding claims 4 and 15(i)-(iii), regarding product claims MPEP 2112.01(I) states that “When the structure recited in the reference is substantially identical to that of the claims, claimed properties or functions are presumed to be inherent. Where the claimed and prior art products are identical or substantially identical in structure or composition, or are produced by identical or substantially identical processes, a prima facie case of either anticipation or obviousness has been established. In re Best, 562 F.2d 1252, 1255, 195 USPQ 430, 433 (CCPA 1977).” The ASO rendered obvious above meets each structural limitation of the claims, and therefore, the functional characteristics recited in claims 4 and 15 (i)-(iii) are presumed to be inherent to the obvious ASO. Regarding claims 9-10, as stated above, Hagedorn teaches gapmer structured ASOs comprising one or more nucleoside analogs, wherein the one or more nucleoside analogs are affinity enhancing 2’ sugar modified nucleosides comprising a bicyclic nucleoside analog, i.e., LNA (“‘LNA’ refers to the bicyclic structure in which the flexibility of the parent furanose has been locked,” pg. 103, left col; Fig. 1b; pg. 104, left col.). Regarding claim 29, as stated above, Hagedorn teaches the gapmer structured ASO comprises one or more modified internucleoside linkages, wherein the one or more linkages are phosphorothioate linkages (Fig. 1b; pg. 104, left col.). Regarding claims 35, and 63-64, Moses teaches a pharmaceutical composition comprising the ASO and a pharmaceutically acceptable diluent ([0184]). Regarding claim 40, Moses teaches a kit comprising the ASO and instructions for use ([0132]). Claim Rejections - 35 USC § 103 - Moses, Hagedorn, and NM_012098.2, in further view of Frieden Claim 13 is rejected under 35 U.S.C. 103 as being unpatentable over Moses (Moses et al., 29 March 2007, US 2007/0072209 A1; of record), Hagedorn (Hagedorn et al., January 2018, Drug Discovery Today, Vol. 23, Number 1, pg. 101-114; of record), and NM_012098.2 (Homo sapiens angiopoietin like 2 (ANGPTL2), mRNA NCBI Reference Sequence: NM_012098.2, available 17 June 2018; of record) as applied to claims 1, 4, 9-10, 15, 29, 35, 40, 59-60, and 63-64, and in further view of Frieden (Frieden et al., 2003, Nucleic Acids Research, Vol. 13, No. 21, pg. 6365-6372; of record). The rejection that follows is new. The teachings of Moses, Hagedorn, and NM_012098.2 are described above and applied as to claims 1, 4, 9-10, 15, 29, 35, 40, 59-60, and 63-64. None of Moses, Hagedorn, or NM_012098.2 teach that the bicyclic nucleoside analog is an α-L-LNA. Frieden teaches that α-L-LNA, a diastereoisomer of LNA, is RNase H competent (“α-L-LNA still recruit RNase H”, Abstract; pg. 6366, left col.) and “shows superior stability against a 3’ exonuclease” (pg. 6371, right col.). Frieden teaches that use of α-L-LNA in the flanks of a gapmer results in “very potent oligonucleotides” (pg. 6369, right col.). It would have been obvious to one of ordinary skill in the art before the effective filing of the claimed invention to have substituted the generic LNA of the LNA gapmer ASO rendered obvious above, for a LNA gapmer ASO comprising α-L-LNA. It would have amounted to a simple substitution of a generic LNA, for a known diastereoisomer of LNA, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in substituting the LNAs in the gapmer because as evidenced by Frieden, it was within the purview of the skilled artisan to prepare gapmer ASOs comprising α-L-LNA, and because Frieden teaches that α-L-LNA is competent for RNase H and exhibits superior exonuclease stability. The skilled artisan would have been motivated to substitute the generic LNA for α-L-LNA because Frieden teaches that incorporation of α-L-LNA in a gapmer ASO results in a “very potent oligonucleotide[],” and increasing potency would likely enable the skilled artisan to more effectively inhibit ANGPTL2. Claim Rejections - 35 USC § 103 – Moses, Hagedorn, and NM_012098.2, in further view of Benizri Claims 33, and 61-62 are rejected under 35 U.S.C. 103 as being unpatentable over Moses (Moses et al., 29 March 2007, US 2007/0072209 A1; of record), Hagedorn (Hagedorn et al., January 2018, Drug Discovery Today, Vol. 23, Number 1, pg. 101-114; of record), and NM_012098.2 (Homo sapiens angiopoietin like 2 (ANGPTL2), mRNA NCBI Reference Sequence: NM_012098.2, available 17 June 2018; of record) as applied to claims 1, 4, 9-10, 15, 29, 35, 40, 59-60, and 63-64, in further view of Benizri (Benizri et al., 4 January 2019, Bioconjugate Chemistry, 2019, 30, pg. 366-383; of record). The rejections that follow are new. The teachings of Moses, Hagedorn, and NM_012098.2 are described above and applied as to claims 1, 4, 9-10, 15, 29, 35, 40, 59-60, and 63-64. Regarding claims 33, and 61-62, Moses also teaches a conjugate comprising the ASO, wherein the ASO is “chemically linked” to at least one non-nucleotide moiety, wherein the non-nucleotide moiety comprises a fatty acid chain (“Such moieties or conjugates include lipids such as cholesterol, cholic acid, thioether, aliphatic chains, phospholipids… palmityl moieties”, [0107]) or a peptide (“the oligonucleotide may include other appended groups such as peptides (e.g., for targeting host cell receptors in vivo”, [0107]). None of Moses, Hagedorn, or NM_012098.2 teach that the linkage between the ASO and non-nucleotide moiety is a covalent linkage. However, Benizri teaches that fatty acids, e.g., a palmityl moiety, can be covalently linked to an antisense oligonucleotide (pg. 372-373). Benizri teaches that an ASO-palmityl moiety conjugate is in clinical trials (pg. 372, right col.; Fig. 8). Benizri also teaches a peptide sequence (“Cell Penetrating Peptide (CPP)”) which may be covalently linked to an ASO (pg. 370-371; Fig. 6). Benizri teaches that covalent linkage of CPP to the ASO is beneficial (“Conventional formulations that carry oligonucleotides are composed of CPP via physical mixing, but the conjugation of these molecules to the oligonucleotide by a covalent bond provides additional benefits”, pg. 371, left col.). It would have been obvious to one of ordinary skill in the art before the effective filing of the claimed invention to have substituted the generic chemical linkage in the ASO conjugate taught by Moses, for a covalent linkage taught by Benizri. It would have amounted to a simple substitution of a generic chemical linkage, for a specific type of chemical linkage, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in substituting the linkages in the ASO conjugate because Benizri teaches substantially identical conjugates in which the linkage between the ASO and the conjugated moiety (e.g., peptide sequence or fatty acid) is a covalent linkage. Thus, it was well within the abilities of the skilled artisan to prepare an ASO conjugate in which the conjugated moiety is covalently linked. The skilled artisan would have been motivated to prepare the ASO conjugate with a covalent linkage because Benizri teaches that a covalent linkage is utilized in an ASO conjugate in clinical trials, and in the case of at least one peptide sequence, provides additional benefits to those achieved through conventional, physical mixing modes of attachment. Response to Remarks – 35 USC § 103 Applicant’s remarks regarding the prior art rejections raised in the previous action have been reviewed. Applicant refers to the amendments to the claims, i.e., “the contiguous nucleotide sequence consists of the sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 5,” and states that “amended claim 1 is non-obvious over the cited references” “[f]or at least the same reasons provided in Applicant’s Amendment and Reply filed on November 21, 2025.” The remarks made in the reply filed November 21, 2025 were addressed in the advisory action mailed December 5, 2025. The amended claims are still directed to ASOs which comprise SEQ ID NO: 4 or SEQ ID NO: 5 (“An antisense oligonucleotide (ASO) comprising a contiguous nucleotide sequence… wherein the contiguous nucleic sequence consists of the sequence set forth in SEQ ID NO: 4 or SEQ ID NO: 5…,” emphasis added). The amended claims are still not directed to ASOs consisting of the recited SEQ ID NOs, because the claimed ASOs may still have any number of, and sequence of, nucleotides outside of the sequence “consisting of” SEQ ID NO: 4 or 5. The amended claims have the same scope as the claims which were addressed in the December 2, 2025 advisory action, i.e., “a genus of ASOs 16-nt, 17-nt, 18-nt, 19-nt, 20-nt, 21-nt, 22-nt… etc., in length, wherein the ASO comprises either SEQ ID NO: 4 or SEQ ID NO: 5” (see pg. 2 of the advisory action). The new rejections rely on the same “obvious to try” rationale as the previous action, but do not include the Gene ID: 23452 reference. The new rejection, instead, relies on the sequence provided by NM_012098.2 (of record). This decreases the number of “finite, identified solutions” relative to the previous rejections, but does not otherwise modify the rationale used to arrive at the claimed invention. Because the claim scope and rationale upon which the rejections were made is effectively unchanged, the response to remarks provided in the advisory action mailed December 2, 2025 is applied hereinafter with respect to the new rejections above. The remarks remain unpersuasive for the reasons described in the advisory action, and therefore, are insufficient to overcome the § 103 rejections raised above. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JENNA L PERSONS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600
Read full office action

Prosecution Timeline

Oct 04, 2021
Application Filed
Mar 05, 2025
Non-Final Rejection — §103
Jun 11, 2025
Response Filed
Aug 13, 2025
Final Rejection — §103
Nov 21, 2025
Response after Non-Final Action
Dec 22, 2025
Request for Continued Examination
Dec 23, 2025
Response after Non-Final Action
Mar 19, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595484
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Apr 07, 2026
Patent 12570705
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12570975
COMPOSITION FOR DIAGNOSIS OR TREATMENT OF A CONDITION ASSOCIATED WITH INCREASED ACTIVITY OF EIF4E COMPRISING AN EIF4E INHIBITOR
2y 5m to grant Granted Mar 10, 2026
Patent 12570706
MODIFIED LIGAND-GATED ION CHANNELS AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12551573
COMPOSITIONS AND METHODS FOR THE TARGETING OF PCSK9
2y 5m to grant Granted Feb 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+73.4%)
2y 12m
Median Time to Grant
High
PTA Risk
Based on 48 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month