Prosecution Insights
Last updated: July 17, 2026
Application No. 17/596,186

SYSTEM AND METHOD FOR COMBATING MYCOBACTERIUM TUBERCULOSIS INFECTIONS

Non-Final OA §112
Filed
Dec 03, 2021
Priority
Jun 06, 2019 — IN 201921022522 +1 more
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Tata Group
OA Round
3 (Non-Final)
59%
Grant Probability
Moderate
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
112 granted / 191 resolved
-1.4% vs TC avg
Strong +65% interview lift
Without
With
+65.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
67 currently pending
Career history
247
Total Applications
across all art units

Statute-Specific Performance

§101
1.4%
-38.6% vs TC avg
§103
45.6%
+5.6% vs TC avg
§102
4.1%
-35.9% vs TC avg
§112
10.9%
-29.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 191 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on April 24, 2026 has been entered. Application Status and Withdrawn Rejections Applicant’s amendment filed April 24, 2026, canceling claim 13 is acknowledged. Claims 1-2, 4-5, 7-10, 15 and 20 are pending and under examination. Cancellation of claim 13 overcomes the §112(b) rejection recited in the previous office action. Applicant’s amendments and arguments have been thoroughly reviewed, but are not persuasive to place the claims in condition for allowance for the reasons that follow. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-2, 4-5, 7-10, 15 and 20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a modified rejection to address comments made in Applicant’s Remarks and newly discovered prior art. MPEP 2163.II.A3.(a).(i) states, “whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention.” For claims drawn to a genus, MPEP 2163.II.A3.(a).(ii) states, “written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species” where “representative number of species' means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.” Claims 1 and 20 recite “a method [system] for combatting infections due to Mycobacterium tuberculosis comprising… identifying a set of nucleotide repeat sequence in the sequenced DNA which are occurring a predefined number of times in the Mycobacterium Tuberculosis… identifying the set of nucleotide repeat sequence repeating more than 10 times at distant locations on the bacterial genome as the set of nucleotide repeat sequence, wherein the set of nucleotide repeats sequence with repeats comprising of one or more of a Sequence ID 001 or a complement of the Sequence ID 001… preparing and administering an engineered polynucleotide construct… comprising… one or more of a set of nucleotide repeat sequences with multiple copies dispersed in nucleotide sequence of genome of Mycobacterium tuberculosis, wherein the set of nucleotide repeat sequences comprises one or more of a Sequence ID 001, and reverse complement of the Sequence ID 001”. SEQ ID NO 1 is cagacrcrnaancncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngngnttnygygtctg, where positions 32-46 may be absent or present, where r = a or g, y = c or t, and n = a, c, g or t. Therefore, SEQ ID NO 1 is actually a genus of sequences that comprises over 6 x 1024 unique sequences. “A set of nucleotide repeat sequences repeating more than 10 times at distant locations on the bacterial genome” is interpreted as “a single sequence species within the genus of SEQ ID NO 1 is repeated at least 11 times in the genome” since the claim requires the repeat sequences in the set to repeat more than 10 times. This interpretation is consistent with the definition in the Specification [022]: “The expression "nucleotide repeat sequences" or "repeated nucleotide sequences" or "the set of nucleotide repeats" or "repeated sequence regions" or "repeat element" or "target sequences" or "target sites" or "similar sequence stretches" or "target nucleotide repeat sequence" or "conserved stretch of nucleotide sequences" in the context of the present disclosure refers to nucleotide sequences which have been repeated multiple times in a sequence of DNA.” For the reasons recited below, it was not predictable that a M. tuberculosis strain had “a set of nucleotide repeat sequences” that is representative of the diversity of the genus of SEQ ID NO 1, and as such the skilled artisan would not have reasonably concluded that Applicant was in procession of the invention as claimed. As indicated above, SEQ ID NO 1 encompasses a set of over 1024 unique sequences. The Specification provides the coordinates in the genome of several M. tuberculosis strains for sequences that fit the pattern of SEQ ID NO 1 (pages 29-32). However, the Specification does not provide the actual sequences from the genome so that it is known whether the coordinates are actually “repeat sequences” such that they are 100% identical to each other. Using the publicly available genome sequence of strain H37Rv from GenBank accession number CP003248.2, available at least as early as October 2014, the following sequences were found for the provided coordinates in the Specification (page 29). Sequence Coord. in Spec Clustl # cagacgcagaatcgcccatttggtagcccaaatgggcgattctgcgtctg 234449-234499 1 cagacgcaaaatcgcccaatttcgtgccgaattgggcgattttgcgtctg 279539-279589 2 cagacgcaaaatcgcacggtttgcggttgattcgtgcgattttgtgtctg 456207-456257 3 cagacgcggaatcgcactgcgcggacctcacgcgtgcgattccgcgtctg 459393-459443 4 cagacgcaaaagcacccttttgcggcgcaaaagtggcgcttttgcgtctg 558825-558875 5 cagacgcagaatcgcacaaaatcagcgattttgatgcgattctgcgtctg 663397- 663447 6 cagacgcataagcccccgcacgcacggcgtgtcgggggcttatgcgtctg 736240-736290 7 cagacgcagaatcgcacgcgaaatgcctgcgcgatgcgattctgcgtctg 767332-767382 8 cagacgcgtaagcgcccaatgtcgtgccgaaatgggcgcttatgcgtctg 829714-829764 9 cagacgcataagcgcccaatttcgtgtcgaaatgggcgcttatgcgtctg 842310-842360 10 cagacgcaaaagccccctaaaccggcaggtattaggggcttttgcgtctg 1000779-1000829 11 cagacgcataagcccccgcacgctcggcgtgtcgggggcttatgcgtctg 1064061-1064111 12 cagacgcaaaatcccctcgacacgccggttgcgaggggattttgcgtctg 1133273-1133323 13 cagacgcaaaatcgcccattttcgtgtcgaaatgggggcttttgcgtctg 1182330-1182380 14 cagacgcgaaagcaccccaaaaccgccggtttgggggcttctgcgtctg 1205248-1205297 15 cagacacagaatcgcactgcgccggcccggcgcgtgcgattctgtgtctg 1224319-1224369 16 cagacacagaatcgcccatttcggcacgaaattgggcgattctgcgtctg 1357075-1357125 17 cagacgcaaaatcgccctggaacgcacggttcagggcgattttgcgtctg 1363449-1363499 18 cagacgcagaatcgcctaaacccgcacgggtttaggcgattctgcgtctg 1488095-1488145 19 cagacgcagaatcgcacgcggaaaggcttccgcgtgcgattctgcgtctg 1568057-1568107 20 cagacgcaaaatcgcccatttcgtacccgaaatgggcgattttgcgtctg 1828811-1828861 21 cagacgcagaatcgcaccgccacgcccgtcggcgtgcgattctgcgtctg 1872581-1872631 22 cagacacagaatcgcacgcggcaggctcctcggatgcgattgtgtgtctg 2075544-2075594 23 cagacgcagaatcgcactgcgcggggtcccgcgcatgcgattctgcgtctg 2317115-2317166 24 cagacgcggaatcgcatcggcggggcccacacggtgcgattccgcgtctg 2466978-2467028 25 cagacgcagaatcgcacgcgcgaggtccgcgccgtgcgattctgcgtctg 2522185-2522235 26 cagacgcaaaatcgcccaaattcgggccgaaatgggcgattttgcgtctg 2700483-2700533 27 cagacacagaatcgcacgaaatcagcccgcccaatgcgattctgcgtctg 2907766-2907816 28 cagacgcaaaatcgcctcatttcggcacgaaatgggcgattttgcgtctg 3059805-3059855 29 cagacgcagaatcgcattaatcgcgcccggtttgtgcgattctgcgtctg 3075393-3075443 30 cagacgcaaaagcccccatttcgggcccgaaatgggggcttttgcgtctg 3104993-3105043 31 cagacgcaaaatcgcccatttcgagacgaaattgggcgattttgcgtctg 3348495-3348545 32 cagacgcaaaatcgcccgaaaccgatggctttcgggcgattttgcgtctg 3590632-3590682 33 cagacgcaaaatcgcccttttcgtcatgaaaatgggcgattttgcgtctg 3628088-3628138 34 cagacgcaaaatcgcccgaaaaccagtggttttgggcgattttgcgtctg 3707747-3707797 35 cagacgcaaaatcgcccatttcggcacgaaattgggcgattttgcgtctg 3724729-3724779 36 cagacgcaaaatcgcccaatttcgtgccgaattgggcgattttgcgtctg 3804038-3804088 37 cagacgcagaatcgcccatttcggcacgaaattgggcgattctgcgtctg 3909942-3909992 38 cagacgcaaaatcgcccaacacgcccgcaaaatgggcgattttgcgtctg 4008838-4008888 39 cagacgcagaatcgcatgatttgagctcaaatcatgcgattctgcgtctg 4021577-4021627 40 cagacgcaaaagcaccccaaatcgggcgattttgggggcttttgcgtctg 4246708-4246758 41 As provided in the Clustl Omega sequence alignment and Percent Identity Matrix, only two of the disclosed coordinates have identical sequences: 279539-279589 and 3804038-3804088 (See OA Appendix in the previous office action, pages 2 and 4). The other 39 provided coordinates are not identical to any of the other coordinates and some share only 50% identity to other sequences (See OA Appendix, page 4). As such none of the provided coordinates are “repeat sequences, repeating more than 10 times”. Even if the repeat sequence only needs to repeat once, there is only one disclosed pair of disclosed coordinates that meets the claimed “a set of nucleotide repeat sequences with multiple copies dispersed in nucleotides sequence of genomes of M. tuberculosis”, and in this case the “set” consists of a single item/sequence and “multiple copies” consists of two instances. This single sequence does not adequately represent the diversity of the 1024 unique sequences that fall within the genus of SEQ ID NO 1. A BLAST search of the sequence at coordinates 279539-279589, returned hits from various M. tuberculosis strains. Most strains had two copies of the sequence, but some strains like 22/2010 and 397/2013 only have one copy of the sequence (See OA Appendix in the previous office action, pages 5-17). Thus, the sequence would not be considered a “nucleotide repeat sequences with multiple copies dispersed in nucleotides sequence” in the genomes of all M. tuberculosis strains. It is also noted that Applicant does not attempt to design or make “an engineered polynucleotide construct comprising ‘one or more of the identified set of nucleotide repeat sequence with multiple copies dispersed in the genome’ along with a first enzyme capable of nicking and cleaving” multiple copies of SEQ ID NO 1 species. As such, Applicant provides no guidance as to what the engineered polynucleotide sequence of the guide sequence should be. Because Applicant has only disclosed a single sequence within genus of SEQ ID NO 1 that is present more than once in a M. tuberculosis genome, and the sequence is not present in “more than 10 times at distant locations” in the genome of M. tuberculosis strains, the skilled artisan would conclude that Applicant did not possess a set of nucleotide repeats, either identified in the Mycobacterium genome, or used in an engineered polynucleotide, that represented multiple copies in genomes and fits within the genus of SEQ ID NO 1 as claimed. The prior art discloses several types of repeat sequences in M. tuberculosis genomes. For instance, Gordon teaches insertion sequences (ISs) that are present many times in the M. tuberculosis strain H37Rv (Gordon et al., Microbiology (1999), 145: 881-892; of record, Abstract). Gordon teaches the IS elements generally encode a transposase enzyme flanked on either by tandem repeats that are either direct repeats or inverted repeats (page 883, Table 3). It is noted that the species within SEQ ID NO 1 comprise inverted repeats since cagacrcrnaanc------gnttnygygtctg constitutes an inverted repeat when each R is a guanine and each Y is a cytosine. Gordon teaches that some ISs, such as IS6110, are present multiple times in the mycobacterium genome (page 881, ¶1); however, as IS6110 is quite large, it is not within the genus of SEQ ID NO 1. In fact, none of the inverted or direct repeat sequences of the IS elements in Gordon fit the pattern of SEQ ID NO 1. It is noted that one half of an inverted sequence included in SEQ ID NO 1, CAGACGCAAAATC, is present in M. tuberculosis genomes at a higher frequency than would be expected by random chance. For instance, the inverted repeat sequence found in variant bovis strain Mb0486 genome thirty times, whereas by random change it should only be present once in the 4 MB genome (See OA Appendix, page 12-18). Additionally, given the close proximity and inverted nature of many of the sites, it is likely the sequence is present in a miniature transposable element. However, as the claims require the entirety of SEQ ID NO 1 to be a “repeat” and no indication in the Specification that SEQ ID NO 1 is related to IS sequences, the repetitiveness of CAGACGCAAAATC in an M. tuberculosis genome does not provide predictability for finding repeats of sequences with SEQ ID NO 1 within M. tuberculosis genomes. Supply teaches the presence and sequence of Mycobacterial Interspersed Repetitive Units (MIRUs) that are intercistronic (Supply et al., Molecular Microbiology (1997), 26: 991-1003; of record Abstract). Supply teaches the MIRUs are between about 45 and 100 base pairs in length and exist 40-50 times in a genome (Abstract). However, the sequences disclosed in Supply do not fit within the genus of SEQ ID NO 1 or have the inverted repeat sequence of SEQ ID NO 1. Upon further search of the features of SEQ ID NO 1 (i.e., inverted repeats which form a hairpin structure), is evident that sequences that fit the pattern of SEQ ID NO 1 have been disclosed previously. In 2008, Cozzuto reported on the systematic identification of step-loop containing sequence families in bacterial genomes (BMC genomics (2008), 9:20, pages 1-17 and Supplemental Material). Cozzuto discovered 10 families of stem-loop forming sequences (SLSs) in Mycobacterium tuberculosis (Table 3). The sequences of the Myt-1 family of SLSs are reported in the Supplementary Material and are included in the attached copy of the article. Each of the sequences in the Myt-1 family fit the pattern of SEQ ID NO: 1, although they do not appear to match with 100% identity to the sequences provided by the coordinates above. Importantly, there is no evidence in Cozzuto that any of the Myt-1 sequences are present more than once in the Mycobacterium genome. Thus, although the sequences fit the pattern of SEQ ID NO1, they are not covered by the claimed invention because they are not “nucleotide repeat sequence with multiple copies dispersed in the nucleotide sequence of genomes of Mycobacterium tuberculosis.”. Again, the claims require that all 48-63 nucleotides are present more than once in the genome in order to be considered a “repeat”. The claims do not recite just a portion of SEQ ID NO 1, like the “inverted repeat section” to be repeated. Even though the Myt-1 sequences of Cozzuto fit the pattern of SEQ ID NO 1, none of the sequences disclosed in Cozzuto fit the required feature of the claimed nucleotide repeat sequences. Because the prior art has no evidence of a sequence fitting within the genus of SEQ ID NO 1 repeated and dispersed throughout the genome of M. tuberculosis genome, there is very little predictability in the art about what sequences would make up “a set of nucleotide repeat sequence with multiple copies dispersed… in the genomes of M. tuberculosis” that also fit within the genus of SEQ ID NO 1. Given that 1) the Specification discloses only 1 sequence within the genus of SEQ ID NO 1 that is repeated a single time in a subset of M. tuberculosis strains, 2) there is no evidence of any single species fitting the pattern of SEQ ID NO 1 that is present more than 10 times in a Mycobacterium genome, and 3) no additional disclosures in the prior art of sequences within the genus of SEQ ID NO 1 with multiple copies dispersed in the M. tuberculosis genome, the skilled artisan would conclude that Applicant did not possess a set of nucleotide repeat sequence with multiple copies dispersed in the genomes of M. tuberculosis that is representative of the large genus of SEQ ID NO 1 as claimed. Claims 2, 4-5, 7-10, 15 and 20 do not limit the size and diversity of the genus of sequences within SEQ ID NO 1 or recite further limitations on the sequence of the nucleotide repeats. As such, the skilled artisan would conclude that Applicant did not possess a set of nucleotide repeat sequence with multiple copies dispersed in the genomes of M. tuberculosis as claimed in the dependent claims. Response to Arguments Applicant states the rejection of record and summarizes Examiner’s remarks in the Advisory Action (Remarks, pages 9-10 and 15-17). Applicant argues that the invention provides a set of sequences which fall into a pattern which occur more than once on all sequence Mycobacterial tuberculosis genomes, and that although there are mismatches in the middle, the terminal 18 residues match in all cases (¶ spanning pages 10-11). This argument has been fully considered but is not persuasive because argument addresses features that are not claimed. The claims require “a repeat sequence of SEQ ID NO 1”. The claims do not recite a portion or sub-section of SEQ ID NO 1. Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). The claims require a sequence that fits into the category of SEQ ID NO (i.e., a sequence that is 48-64 nucleotides long) to be repeated in the genome. Applicant argues that the invention is a multiplex assay with bipartite targeting architecture for detection and to provide guides that can help cleave the region which target residues 1-17 and 33-50 (¶ spanning ages 10-11). This argument has been fully considered but is not persuasive. The claims require administering “one or more of the identified set of nucleotide repeat sequences”. Thus, the claims require the entire 48-64 nucleotide sequence to be delivered, not just a guide that targets the inverted repeat sequences. Thus again, Applicant’s argument is directed to features that are not recited in the claims. Applicant provides evidence of one sequence that is repeated 3 times in the genome of strain H37Rv_CG and additional times with 1-2 mismatches which provides evidence for the “repeat sequences” (pages 11-12). This argument has been fully considered, but is not persuasive. First, the proffered sequence is the same sequence identified by Examiner and provided for in the previous and current §112(a) rejection of the single example of a sequence that is included in the genus of “a repeat sequence” with SEQ ID NO 1. Thus, Applicant provides no other example; the number of disclosed sequences that are actually “repeat sequences” out of the incredibly large genus is still one. It is noted, that the sequences with “mismatches” do not count as they are not interpreted as “repeat sequence with SEQ ID NO 1”. Although they fit the pattern of SEQ ID NO 1, the disclosed sequences and the “mismatched sequence” are not the same sequence. Again, to reiterate, according to the Specification, a repeat sequence is one in which the entire sequence occurs multiple times. None of the disclosed sequences from coordinates on pages 29-32 are the same sequence, except 1, the same sequence provided in Applicant’s Remarks. Applicant argues that the sequences that fit the pattern of SEQ ID NO 1 are unique to pathogenic Mycobacterium and as such a guide RNA targeting them would only target Mycobacterium. Applicant argues that because Cas9 and Cas12 systems only require 18 nucleotides of targeting, the unique sequences could be targeted (page 13, ¶1-2). This argument has been fully considered but is not persuasive because the sequences are not repetitive in the Mycobacterium genome, as required by the claims. Additionally, there is no section of the sequences of the disclosed coordinates in which at least 18 nucleotides are identical, which would be needed to design a guide RNA that would target the genomic sequence so that the enzymes could remove the set of flanking genes. Finally, as indicated above, the predictability of designing a 18-nt CRISPR spacer is moot since the claims require administering “a polynucleotide comprising on or more of the identified set of nucleotide repeat sequences” which is the entirety of the 48-64 oligonucleotide. Applicant also argues that designing TALENs to target a specific pair of sequences like the ends of SEQ ID NO 1 was routine in the art (¶ spanning pages 13-14). This argument has been fully considered but is not persuasive because the claims require delivering the nucleic sequence with the repeats, which don’t function with TALENs. If TALENs were used as the enzyme that nicks and cleaves then it would be confusing as to why the nucleotide sequences are also delivered, since they could potentially titrate the TALENs away from the genomic sequence, limiting the antimicrobial function of the TALENs. Furthermore, although TALENs can be easily designed, there is no instance in the prior art of using TALENs as an antimicrobial agent. The Specification does not even recite TALENs, and so could not clarify 1) the relationship between the TALEN and the “one or more of the identified sent of nucleotide repeat sequences” that must also be delivered, or 2) how to deliver TALENs and use them as an antimicrobial agent. Applicant argues that the claims are not limited to a single targeting modality and can also use LNA- or PNA-based systems (page 18, ¶3). This argument has been fully considered but is not persuasive. First, other than CRISPR systems, which are known to require a nucleic acid-based component (i.e., the guide RNA) and a protein component (i.e., an enzyme that is capable of nicking and cleaving, the Specification is completely silent on additional systems that can be used. Second, PNA and LNA-based systems do not require the administration of a “first enzyme capable of nicking and cleaving”. Thus, in the event that Applicant contemplated a nucleic acid portion that could hybridize to the repeats as being LNAs or PNAs, it would be completely unknown what purpose the cleaving enzyme would play. Finally, Applicant again argues that CRISPR-based systems are known in the art to allow mismatches between the guide sequence and the target such that a single guide RNA would target additional sequences other than a perfect match to the inverted portion of SEQ ID NO 1 (page 18, ¶4 through page 19). This argument has been fully considered but is not persuasive for the reasons addressed above. Namely, the argument does not address the merits of the rejection – i.e., the lack of written description and possession of sequences that are true “repeat sequences” – and that the argument is directed to features not claimed – i.e., the administration of only a portion of SEQ ID NO 1 to the infected area. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Dec 03, 2021
Application Filed
Sep 30, 2025
Non-Final Rejection mailed — §112
Dec 24, 2025
Response Filed
Jan 26, 2026
Final Rejection mailed — §112
Apr 10, 2026
Response after Non-Final Action
Apr 24, 2026
Request for Continued Examination
Apr 29, 2026
Response after Non-Final Action
May 22, 2026
Non-Final Rejection mailed — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12678517
MIRI26-5P FOR TREATING MOTOR NEURON DISEASES
5y 8m to grant Granted Jul 14, 2026
Patent 12673117
AAV-IDS VECTORS FOR TREATMENT OF MUCOPOLYSACCHARIDOSIS II
2y 9m to grant Granted Jul 07, 2026
Patent 12662663
USE OF A DEFICIENT FUSION PROTEIN FOR NUCLEASE ACTIVITY SO AS TO INDUCE MEIOTIC RECOMBINATIONS
3y 7m to grant Granted Jun 23, 2026
Patent 12630815
ARTIFICIAL GENE AND METHOD FOR MUTATING GENE
4y 3m to grant Granted May 19, 2026
Patent 12622931
COMPOSITIONS AND METHODS FOR TREATING ALPHA-1 ANTITRYPSIN DEFICIENCY
4y 9m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+65.0%)
3y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 191 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month