Prosecution Insights
Last updated: October 01, 2026
Application No. 17/596,186

SYSTEM AND METHOD FOR COMBATING MYCOBACTERIUM TUBERCULOSIS INFECTIONS

Final Rejection §112
Filed
Dec 03, 2021
Priority
Jun 06, 2019 — IN 201921022522 +1 more
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Tata Group
OA Round
4 (Final)
58%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
118 granted / 203 resolved
-1.9% vs TC avg
Strong +65% interview lift
Without
With
+65.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
72 currently pending
Career history
262
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
32.8%
-7.2% vs TC avg
§102
13.7%
-26.3% vs TC avg
§112
30.3%
-9.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 203 resolved cases

Office Action

§112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status and Withdrawn Rejections Applicant’s amendment filed August 6, 2026, amending claim 1 and 20 is acknowledged. Claims 1-2, 4-5, 7-10, 15 and 20 are pending and under examination. Applicant’s amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for the reasons that follow. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-2, 4-5, 7-10, 15 and 20 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a modified rejection, necessitated by amendment. MPEP 2163.II.A3.(a).(i) states, “whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention.” For claims drawn to a genus, MPEP 2163.II.A3.(a).(ii) states, “written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species” where “representative number of species' means that the species which are adequately described are representative of the entire genus. Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.” Claims 1 and 20 recite “a method [system] for combatting infections due to Mycobacterium tuberculosis comprising… identifying a set of nucleotide repeat sequences in the sequenced DNA which are occurring in the Mycobacterium Tuberculosis… identifying conserved nucleotide repeat elements on Mycobacterium tuberculosis genome… identifying the set of nucleotide repeat sequence present in multiple copies at distant locations on the bacterial genome as the set of nucleotide repeat sequences, wherein the set of nucleotide repeat sequences comprises one or more nucleotide sequences matching the pattern of a Sequence ID 001 or a complement of the Sequence ID 001… preparing and administering an engineered polynucleotide construct… comprising… one or more guide sequences capable of hybridizing to the set of nucleotide repeat sequences present in multiple copies at distant locations in genomes of Mycobacterium tuberculosis, wherein the set of nucleotide repeat sequences comprises one or more nucleotide sequence matching the pattern of a Sequence ID 001, and reverse complement of the Sequence ID 001”. SEQ ID NO 1 is cagacrcrnaancncnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnngngnttnygygtctg, where positions 32-46 may be absent or present, where r = a or g, y = c or t, and n = a, c, g or t. Therefore, SEQ ID NO 1 is actually a genus of sequences that comprises over 6 x 1024 unique sequences. “A set of nucleotide repeat sequences present in multiple copies at distant locations on the bacterial genome” is interpreted as the collection of sequences wherein “a single sequence species within the genus of SEQ ID NO 1 is repeated at more than once in the genome” since the claim requires the repeat sequences in the set to be present in multiple copies. This interpretation is consistent with the definition in the Specification [022]: “The expression "nucleotide repeat sequences" or "repeated nucleotide sequences" or "the set of nucleotide repeats" or "repeated sequence regions" or "repeat element" or "target sequences" or "target sites" or "similar sequence stretches" or "target nucleotide repeat sequence" or "conserved stretch of nucleotide sequences" in the context of the present disclosure refers to nucleotide sequences which have been repeated multiple times in a sequence of DNA.” For the reasons recited below, it was not predictable that a M. tuberculosis strain had “a set of nucleotide repeat sequences” that is representative of the diversity of the genus of SEQ ID NO 1, and as such the skilled artisan would not have reasonably concluded that Applicant was in procession of the invention as claimed. As indicated above, SEQ ID NO 1 encompasses a set of over 1024 unique sequences. The Specification provides the coordinates in the genome of several M. tuberculosis strains for sequences that fit the pattern of SEQ ID NO 1 (pages 29-32). However, the Specification does not provide the actual sequences from the genome so that it is known whether the coordinates are actually “repeat sequences” such that they are 100% identical to each other. Using the publicly available genome sequence of strain H37Rv from GenBank accession number CP003248.2, available at least as early as October 2014, the following sequences were found for the provided coordinates in the Specification (page 29). Sequence Coord. in Spec Clustl # cagacgcagaatcgcccatttggtagcccaaatgggcgattctgcgtctg 234449-234499 1 cagacgcaaaatcgcccaatttcgtgccgaattgggcgattttgcgtctg 279539-279589 2 cagacgcaaaatcgcacggtttgcggttgattcgtgcgattttgtgtctg 456207-456257 3 cagacgcggaatcgcactgcgcggacctcacgcgtgcgattccgcgtctg 459393-459443 4 cagacgcaaaagcacccttttgcggcgcaaaagtggcgcttttgcgtctg 558825-558875 5 cagacgcagaatcgcacaaaatcagcgattttgatgcgattctgcgtctg 663397- 663447 6 cagacgcataagcccccgcacgcacggcgtgtcgggggcttatgcgtctg 736240-736290 7 cagacgcagaatcgcacgcgaaatgcctgcgcgatgcgattctgcgtctg 767332-767382 8 cagacgcgtaagcgcccaatgtcgtgccgaaatgggcgcttatgcgtctg 829714-829764 9 cagacgcataagcgcccaatttcgtgtcgaaatgggcgcttatgcgtctg 842310-842360 10 cagacgcaaaagccccctaaaccggcaggtattaggggcttttgcgtctg 1000779-1000829 11 cagacgcataagcccccgcacgctcggcgtgtcgggggcttatgcgtctg 1064061-1064111 12 cagacgcaaaatcccctcgacacgccggttgcgaggggattttgcgtctg 1133273-1133323 13 cagacgcaaaatcgcccattttcgtgtcgaaatgggggcttttgcgtctg 1182330-1182380 14 cagacgcgaaagcaccccaaaaccgccggtttgggggcttctgcgtctg 1205248-1205297 15 cagacacagaatcgcactgcgccggcccggcgcgtgcgattctgtgtctg 1224319-1224369 16 cagacacagaatcgcccatttcggcacgaaattgggcgattctgcgtctg 1357075-1357125 17 cagacgcaaaatcgccctggaacgcacggttcagggcgattttgcgtctg 1363449-1363499 18 cagacgcagaatcgcctaaacccgcacgggtttaggcgattctgcgtctg 1488095-1488145 19 cagacgcagaatcgcacgcggaaaggcttccgcgtgcgattctgcgtctg 1568057-1568107 20 cagacgcaaaatcgcccatttcgtacccgaaatgggcgattttgcgtctg 1828811-1828861 21 cagacgcagaatcgcaccgccacgcccgtcggcgtgcgattctgcgtctg 1872581-1872631 22 cagacacagaatcgcacgcggcaggctcctcggatgcgattgtgtgtctg 2075544-2075594 23 cagacgcagaatcgcactgcgcggggtcccgcgcatgcgattctgcgtctg 2317115-2317166 24 cagacgcggaatcgcatcggcggggcccacacggtgcgattccgcgtctg 2466978-2467028 25 cagacgcagaatcgcacgcgcgaggtccgcgccgtgcgattctgcgtctg 2522185-2522235 26 cagacgcaaaatcgcccaaattcgggccgaaatgggcgattttgcgtctg 2700483-2700533 27 cagacacagaatcgcacgaaatcagcccgcccaatgcgattctgcgtctg 2907766-2907816 28 cagacgcaaaatcgcctcatttcggcacgaaatgggcgattttgcgtctg 3059805-3059855 29 cagacgcagaatcgcattaatcgcgcccggtttgtgcgattctgcgtctg 3075393-3075443 30 cagacgcaaaagcccccatttcgggcccgaaatgggggcttttgcgtctg 3104993-3105043 31 cagacgcaaaatcgcccatttcgagacgaaattgggcgattttgcgtctg 3348495-3348545 32 cagacgcaaaatcgcccgaaaccgatggctttcgggcgattttgcgtctg 3590632-3590682 33 cagacgcaaaatcgcccttttcgtcatgaaaatgggcgattttgcgtctg 3628088-3628138 34 cagacgcaaaatcgcccgaaaaccagtggttttgggcgattttgcgtctg 3707747-3707797 35 cagacgcaaaatcgcccatttcggcacgaaattgggcgattttgcgtctg 3724729-3724779 36 cagacgcaaaatcgcccaatttcgtgccgaattgggcgattttgcgtctg 3804038-3804088 37 cagacgcagaatcgcccatttcggcacgaaattgggcgattctgcgtctg 3909942-3909992 38 cagacgcaaaatcgcccaacacgcccgcaaaatgggcgattttgcgtctg 4008838-4008888 39 cagacgcagaatcgcatgatttgagctcaaatcatgcgattctgcgtctg 4021577-4021627 40 cagacgcaaaagcaccccaaatcgggcgattttgggggcttttgcgtctg 4246708-4246758 41 As provided in the Clustl Omega sequence alignment and Percent Identity Matrix, only two of the disclosed coordinates have identical sequences: 279539-279589 and 3804038-3804088 (See OA Appendix in the previous office actions, pages 2 and 4). The other 39 provided coordinates are not identical to any of the other coordinates and some share only 50% identity to other sequences (See OA Appendix, page 4). As such, only one of the provided coordinates are “repeat sequences present in multiple copies at distant locations”. Thus, there is only one disclosed pair of disclosed coordinates that meets the claimed “a set of nucleotide repeat sequences with multiple copies dispersed at distant locations in genomes of M. tuberculosis”, and in this case the “set” consists of a single item/sequence and “multiple copies” consists of two instances. This single sequence does not adequately represent the diversity of the 1024 unique sequences that fall within the genus of SEQ ID NO 1. A BLAST search of the sequence at coordinates 279539-279589, returned hits from various M. tuberculosis strains. Most strains had two copies of the sequence, but some strains like 22/2010 and 397/2013 only have one copy of the sequence (See OA Appendix in the previous office actions, pages 5-17). Thus, the sequence would not be considered a “nucleotide repeat sequences with multiple copies dispersed in multiple copies at distant locations” in the genomes of all M. tuberculosis strains. It is also noted that Applicant does not attempt to design or make “an engineered polynucleotide construct comprising one or more guide sequences capable of hybridizing to the identified set of nucleotide repeat sequence with multiple copies dispersed in the genome” along with a first enzyme capable of nicking and cleaving” multiple copies of SEQ ID NO 1 species. As such, Applicant provides no guidance as to what the engineered polynucleotide sequence of the guide sequence should be. Because Applicant has only disclosed a single sequence within genus of SEQ ID NO 1 that is present more than once in a M. tuberculosis genome, the skilled artisan would conclude that Applicant did not possess a set of nucleotide repeats, either identified in the Mycobacterium genome, or used in an engineered polynucleotide, that represented multiple copies in genomes and fits within the genus of SEQ ID NO 1 as claimed. The prior art discloses several types of repeat sequences in M. tuberculosis genomes. For instance, Gordon teaches insertion sequences (ISs) that are present many times in the M. tuberculosis strain H37Rv (Gordon et al., Microbiology (1999), 145: 881-892; of record, Abstract). Gordon teaches the IS elements generally encode a transposase enzyme flanked on either by tandem repeats that are either direct repeats or inverted repeats (page 883, Table 3). It is noted that the species within SEQ ID NO 1 comprise inverted repeats since cagacrcrnaanc------gnttnygygtctg constitutes an inverted repeat when each R is a guanine and each Y is a cytosine. Gordon teaches that some ISs, such as IS6110, are present multiple times in the mycobacterium genome (page 881, ¶1); however, as IS6110 is quite large, it is not within the genus of SEQ ID NO 1. In fact, none of the inverted or direct repeat sequences of the IS elements in Gordon fit the pattern of SEQ ID NO 1. It is noted that one half of an inverted sequence included in SEQ ID NO 1, CAGACGCAAAATC, is present in M. tuberculosis genomes at a higher frequency than would be expected by random chance. For instance, the inverted repeat sequence found in variant bovis strain Mb0486 genome thirty times, whereas by random change it should only be present once in the 4 MB genome (See OA Appendix, page 12-18). Additionally, given the close proximity and inverted nature of many of the sites, it is likely the sequence is present in a miniature transposable element. However, as the claims require the entirety of SEQ ID NO 1 to be a “repeat” and no indication in the Specification that SEQ ID NO 1 is related to IS sequences, the repetitiveness of CAGACGCAAAATC in an M. tuberculosis genome does not provide predictability for finding repeats of sequences with SEQ ID NO 1 within M. tuberculosis genomes. Supply teaches the presence and sequence of Mycobacterial Interspersed Repetitive Units (MIRUs) that are intercistronic (Supply et al., Molecular Microbiology (1997), 26: 991-1003; of record Abstract). Supply teaches the MIRUs are between about 45 and 100 base pairs in length and exist 40-50 times in a genome (Abstract). However, the sequences disclosed in Supply do not fit within the genus of SEQ ID NO 1 or have the inverted repeat sequence of SEQ ID NO 1. Upon further search of the features of SEQ ID NO 1 (i.e., inverted repeats which form a hairpin structure), is evident that sequences that fit the pattern of SEQ ID NO 1 have been disclosed previously. In 2008, Cozzuto reported on the systematic identification of step-loop containing sequence families in bacterial genomes (BMC genomics (2008), 9:20, pages 1-17 and Supplemental Material; of record). Cozzuto discovered 10 families of stem-loop forming sequences (SLSs) in Mycobacterium tuberculosis (Table 3). The sequences of the Myt-1 family of SLSs are reported in the Supplementary Material and are included in the attached copy of the article provided in the previous office action. Each of the sequences in the Myt-1 family fit the pattern of SEQ ID NO: 1, although they do not appear to match with 100% identity to the sequences provided by the coordinates above. Importantly, there is no evidence in Cozzuto that any of the Myt-1 sequences are present more than once in the Mycobacterium genome. Thus, although the sequences fit the pattern of SEQ ID NO 1, they are not covered by the claimed invention because they are not “nucleotide repeat sequence with multiple copies dispersed in the nucleotide sequence of genomes of Mycobacterium tuberculosis.”. Again, the claims require that all 48-63 nucleotides are present more than once in the genome in order to be considered a “repeat”. The claims do not recite just a portion of SEQ ID NO 1, like the “inverted repeat section” to be repeated. Even though the Myt-1 sequences of Cozzuto fit the pattern of SEQ ID NO 1, none of the sequences disclosed in Cozzuto fit the required feature of the claimed nucleotide repeat sequences. Because the prior art has no evidence of a sequence fitting within the genus of SEQ ID NO 1 repeated and dispersed throughout the genome of M. tuberculosis genome, there is very little predictability in the art about what sequences would make up “a set of nucleotide repeat sequence with multiple copies dispersed… in the genomes of M. tuberculosis” that also fit within the genus of SEQ ID NO 1. Given that 1) the Specification discloses only 1 sequence within the genus of SEQ ID NO 1 that is repeated a single time in a subset of M. tuberculosis strains, and 2) no additional disclosures in the prior art of sequences within the genus of SEQ ID NO 1 with multiple copies dispersed in the M. tuberculosis genome, the skilled artisan would conclude that Applicant did not possess a set of nucleotide repeat sequence with multiple copies dispersed in the genomes of M. tuberculosis that is representative of the large genus of SEQ ID NO 1 as claimed. Claims 2, 4-5, 7-10, 15 and 20 do not limit the size and diversity of the genus of sequences within SEQ ID NO 1 or recite further limitations on the sequence of the nucleotide repeats. As such, the skilled artisan would conclude that Applicant did not possess a set of nucleotide repeat sequence with multiple copies dispersed in the genomes of M. tuberculosis as claimed in the dependent claims. Response to Arguments Applicant states the rejection of record and summarizes Examiner’s remarks in the Advisory Action (Remarks, pages 10-14). Applicant then reviews the amendments of the claims and provides citations for their support in the Specification (pages 14-19). Applicant then argues that claim 1 does not require that every theoretical sequence encompassed by SEQ ID NO: 1 be possess or identified because, as amended, claim 1 is directed to a method in which nucleotide repeat sequence are identified through a sequence-analysis workflow. Applicant argues that claim 1 is limited to nucleotide repeat sequence that are actually identified by the recited alignment process (page 19, ¶2-4). This argument has been fully considered but is not persuasive. First, the claims are not merely directed to method of repeat identification because the preamble of the claims still recite “a method for combating infections” in which an engineered polynucleotide comprising one or more guide sequence capable of hybridizing the identified set of nucleotide repeat sequences present in multiple copies is administered. The disclosure only provides a single sequence that is encompassed by the claimed “nucleotide sequence matching the pattern of SEQ ID NO 1” and is also present in “multiple copies”. And as indicated in the rejection above, not all M. tuberculosis strains even have multiple copies of that sequence. As such, for those strains, the method would not even be enabled since no sequence that 1) fits the pattern of SEQ ID NO 1 and 2) is present in multiple copies is identified that could be used to design the engineered polypeptide. Second, although the claim recites the method to identify such sequences, it is not evident that sequences filling all the requirements could even be identified. Thus, it does not appear that Applicant possessed even two representative species that fit the breadth of SEQ ID NO 1. Applicant argues that the claims are defined by the combination of 1) M. tuberculosis, 2) identification using the recited sequence-stretch selection and alignment process, 3) present in multiple copies, 4) occurrence at distinct genome locations, and 5) exclusion of sequences having similar matches in other species/strains. Applicant argues that the five elements substantially narrow the claim scope (page 19, ¶5). This argument is fully considered but is not persuasive. First, identified sequences still must have the pattern of SEQ ID NO 1. Second, there are no sequences disclosed in the Specification that actually fit all elements and only a pair of coordinates that indicate a single species that fits all 5 elements, and only in some M. tuberculosis strains. Examiner agrees that the functional requirements are truly very narrow (present in multiple copies at distinct locations), however, the structure of possible sequences that fit the pattern is still quite large > 1024 sequences. Thus, there is not a predictable structure-function relationship available for the skilled artisan to predict what other sequences also fit the functional requirements of being present in multiple copies at distinct locations. Applicant argues that the claims no longer recite “repeated more than 10 times”, which removes the former numerical repat threshold (page 20, ¶1-2). This argument has been considered and is persuasive as it applies to the current claims. However, the claims still recite the repeat sequence at “multiple copies”, such that the numerical threshold is 2. As indicated in the rejection above, only one sequence was identified that was present more than 1 time and only in some strains. Thus “the set of identified repeats” is still a set of a single sequence. And some strains, the set is a null set. Applicant argues that the CRISPR system is capable of cleaving the “identified nucleotide repeat sequences” and removing flanking genes in the “identified nucleotide sequences” (page 20, ¶4). This argument has been fully considered but is not persuasive because it is not evident that more than one repeat nucleotide sequence that fits the pattern of SEQ ID NO 1 could be identified. As indicated the rejection above, Applicant only discloses a single sequence that is present twice and the art is completely devoid of any teachings of SEQ ID NO 1 that also repeat. Applicant argues that the conserved nature of the 5’ and 3’ end sequences (i.e., the inverted repeats) are conserved and guides designed to align with the conserved segments ensure stable and specific recognition of the repeat despite mismatches (¶ spanning pages 20-21). This argument has been fully considered, but as far as it is persuasive, there is no recitation of this language in the Specification to specifically target the “conserved regions”. The Specification provides no guidance as to the portion of SEQ ID NO 1 that should be targeted by the CRISPR guide RNAs. Applicant summarizes that the amendments that address Examiner’s concerns (page 21, ¶2). This argument has been fully considered but is still not persuasive because the crux of the rejection is still what are the sequences that fit the pattern of SEQ ID NO 1 and are present multiple times. The Specification provides the coordinates of a single sequence in a single strain that fits all the required features (structural and functional) and the sequence is not a “repeat” in all strains. If the sequence is truly the only one that actually exists out of the possible 1024 sequences, then Applicant should claim that precise sequence, and not the large genus of possible 1024 sequences that fit the “pattern” of SEQ ID NO 1. Conclusion No claims are allowable. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Show 2 earlier events
Dec 24, 2025
Response Filed
Jan 26, 2026
Final Rejection mailed — §112
Apr 10, 2026
Response after Non-Final Action
Apr 24, 2026
Request for Continued Examination
Apr 29, 2026
Response after Non-Final Action
May 22, 2026
Non-Final Rejection mailed — §112
Aug 06, 2026
Response Filed
Sep 01, 2026
Final Rejection mailed — §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723277
LINKED TARGET CAPTURE
4y 9m to grant Granted Sep 01, 2026
Patent 12698477
METHODS OF PRECONDITIONING VASCULAR CELLS FOR TRANSDUCTION, METHODS OF TRANSDUCTION AND METHODS OF PRESERVING TRANSDUCED CELLS
4y 8m to grant Granted Aug 04, 2026
Patent 12698504
Methods for Making and Using Genomically Recoded Cells
3y 2m to grant Granted Aug 04, 2026
Patent 12686865
COMPOSITIONS AND METHODS OF NUCLEIC ACID-TARGETING NUCLEIC ACIDS
4y 11m to grant Granted Jul 21, 2026
Patent 12678517
MIRI26-5P FOR TREATING MOTOR NEURON DISEASES
5y 8m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+65.0%)
3y 9m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 203 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month