Prosecution Insights
Last updated: April 19, 2026
Application No. 17/597,351

METHODS FOR THE TREATMENT OF EPILEPSY

Final Rejection §103§DP
Filed
Jan 04, 2022
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Centre National De La Recherche Scientifique
OA Round
2 (Final)
70%
Grant Probability
Favorable
3-4
OA Rounds
2y 3m
To Grant
99%
With Interview

Examiner Intelligence

Grants 70% — above average
70%
Career Allow Rate
39 granted / 56 resolved
+9.6% vs TC avg
Strong +40% interview lift
Without
With
+40.5%
Interview Lift
resolved cases with interview
Typical timeline
2y 3m
Avg Prosecution
50 currently pending
Career history
106
Total Applications
across all art units

Statute-Specific Performance

§101
5.8%
-34.2% vs TC avg
§103
34.0%
-6.0% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
33.1%
-6.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 56 resolved cases

Office Action

§103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Claims 1-2,5-6,8-11,13-17,28-30, and 39, previously withdrawn from consideration as a result of a restriction requirement, have been cancelled by Applicant. As a result, the election requirement is now moot. Status of Claims Claims 1-2,5-6,8-11,13-17,28-30, and 39 have been cancelled. Claims 40-49 are newly added. Claim 35 is amended. Claims 35, 37-38, and 40-49 are under consideration. Response to Arguments Applicant’s arguments, filed 12/11/25, with respect to: §103 rejections have been fully considered and are persuasive. The rejection of claims 35 and 37-38 has been withdrawn because Applicants point that the cited prior art of He is not prior art on account of the publication date of the applied art. The provisional statutory double patenting rejections of claims 35 and 37-38 over claims 35-38 of copending Application No. 17810022; nonstatutory double patenting rejections of claims 35 and 37-38 over claims 223-224, 227, 230, 232, 234, -235, 237, and 240 of copending Application No. 18289921 and over claims 163 and 165 of copending Application No. 18154241 in view of Khvorova (US 20050255487), are withdrawn in view of amendments made to instant as well as in the copending applications. All previous rejections have been withdrawn in view of applicants’ amendments and / or arguments. However, new rejections in view of IDS are being made in this Office Action. Information Disclosure Statement Applicant's submission of an information disclosure statement under 37 CFR 1.97(c) with the timing fee set forth in 37 CFR 1.17(p) on 12/11/2025 prompted the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 609.04(b). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 35, 37-38, 40-43, and 47-49 are rejected under 35 U.S.C. 103 as being unpatentable over Crepel (US 2016022843) in view of Hornstein (WO 2016/157175 A1) and Bofill-De Ros (Methods. 2016 July 1; 103: 157–166), all cited in IDS dated 12/11/2025. Claim Interpretation: A. Grik2 is used synonymously with GIuK2 (GIuK2 (Grik2) mRNA sequences may be found in NCBI Gene ID NO: 2898, specification Pg. 8, line 24). B. The guide sequence and the passenger sequence of a recombinant antisense oligonucleotide are the antisense and sense (complementary to antisense) strand of an siRNA duplex, respectively (specification Pg. 7, lines 5-24). Regarding claim 35, Crepel teaches a compound which is an antagonist of Grik2 or an inhibitor of Grik2 expression for use in the treatment or the prevention of epilepsy (GluK2/GluK5 receptor, abstract). An embodiment of such a compound is Antisense oligonucleotides (Small inhibitory RNAs (siRNAs) can also function as inhibitors, [0048]). Crepel further teaches antisense oligonucleotides useful as inhibitors of Grik2 can be prepared by known methods [0048]. See pertinent recitation from this para: GluK2/GluK5 receptor gene expression can be reduced by contacting a subject or cell with a small double stranded RNA (dsRNA), or a vector or construct causing the production of a small double stranded RNA, such that GluK2/GluK5 receptor gene expression is specifically inhibited (i.e. RNA interference or RNAi). Methods for selecting an appropriate dsRNA or dsRNA-encoding vector are well known in the art for genes whose sequence is known. Crepel teaches the compound can be in a pharmaceutical composition, where the compound is mixed with suitable carriers or excipients [0066]. Crepel does not teach wherein the guide sequence that comprises the recombinant antisense oligonucleotide that targets a Grik2 mRNA comprises a polynucleotide sequence identical to the nucleic acid sequence of Applicant’s SEQ ID NO: 14. Hornstein teaches a method of treating motor neuron disease (MND), such as epilepsy, the method comprising administering an agent that downregulates GRIK2 (title and abstract). Hornstein teaches method of treatment of a subject having epilepsy comprises administering a nucleic acid inhibitor of Grik2 (MND selected from:… epilepsy, downregulate Grik2 receptor, title, abstract, pg. 4 3rd para, claim 10). Hornstein experimentally validate Grik2 as a target for epilepsy (Example 2, pg. 63-64; claims 3-4). Hornstein teaches antisense polynucleotides such as small inhibitory RNAs (siRNAs) function as inhibitors of Grik2 and can be prepared by known methods and provide guidance on how to do so (pg. 17-18). Hornstein teaches miRNAs suppress target sequences in a manner similar to siRNAs (pg. 2 2nd para). Further, Hornstein teaches obtaining such siRNAs from commercial sources. See pertinent recitation from pg. 19: PNG media_image1.png 200 400 media_image1.png Greyscale Hornstein provide the Genbank accession nos. for GRIK2 (pg. 13-14). Hornstein also teaches the design and synthesis of inhibitory polynucleotides is well within the capabilities of one skilled in the art and can be accomplished via established methodologies as detailed in, for example: Sambrook, J. and Russell, D. W. 25 (2001)…, (pg. 38). Hornstein also teaches the availability of algorithms for identifying sequences of high binding affinity (pg. 20, last para), and in vitro assays for the same (pg. 21 first para). Thus, Hornstein state: the generation of highly accurate antisense design algorithms and a wide variety of oligonucleotide delivery systems, enable an ordinarily skilled artisan to design and implement antisense approaches suitable for downregulating expression of known sequences without having to resort to undue trial and error experimentation (pg. 21 second para). Hornstein teach: To express the antisense polynucleotide, a nucleic acid sequence encoding the polynucleotide of the present invention is preferably ligated into a nucleic acid construct. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner (pg. 42). Finally, Hornstein teach administering the inhibitory polynucleotide to the patient per se or as part of a pharmaceutical composition, where it is mixed with suitable carriers or excipients (pg. 46). Hornstein does not teach wherein the guide sequence that comprises the recombinant antisense oligonucleotide that targets a Grik2 mRNA comprises a polynucleotide sequence identical to the nucleic acid sequence of Applicant’s SEQ ID NO: 14. However, before the effective filing date of Applicant’s invention, Bofill-De had taught small inhibitory RNAs of 21 to 22 nucleotides were known to cause potent knockdown (introduction). Bofill-De further taught step-by-step guidelines for RNAi design specifically for an antisense oligonucleotide (guide and passenger strand) that is obtained by expressed shRNA (title, abstract, pgs. 10-11). Three pertinent guidelines are here: First, with respect to target RNA sequence: Bofill-De teaches for stable and efficient binding of the antisense oligonucleotide to its target RNA sequence the target sequences need to be located in a structurally opened area along any part of the mRNA sequence often surrounded by AU -rich sequences (pg. 8: last para and last line of third to the last para and pg. 9 first para). The same can be easily determined (“Accessibility of target sites can be measured experimentally or estimated by software based on minimum free energy of secondary structure which is often correlated with the AU-richness of surrounding sequences.”, pg. 9, first para). Second, with respect to guide RNA sequence: Bofill-De teaches that near-perfect complementarity between a 21 nucleotide long guide strand and target critically influence knockdown efficiency (pg. 5, Fig. 2A, pgs. 8-9), asymmetrical nucleotide content in the duplex comprising guide and passenger strands for increasing targeting, with more GC content at the 5′-end of the guide strand and more UU at the 3′-end (Fig. 4A). Finally, Bofill-De teaches that despite these time-tested design steps, off-target effects are still a challenge. Several strategies to overcome are suggested, one of which is using bioinformatics algorithms (pg. 9, middle paras). Therefore, one would need to experiment with various guide strands, which establishes the need to “try” several sequences to find optimal candidates. It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to try to make a guide sequence sufficiently similar to Applicant’s SEQ ID NO: 14 using the inhibitory RNA design guidelines taught by Bofill-De and using the Grik2 GenBank mRNA sequence provided by Hornstein. Crepel had taught that for a gene whose sequence is known, an inhibitory RNA sequence can be easily designed, Hornstein had taught the Grik2 GenBank mRNA sequence and many ways of arriving at an inhibitory RNA strand, and Bofill-De had emphasized a design need for nucleic acid sequences which can influence target gene suppression. Bofill-De had taught that siRNA targeting systems rely on a finite number of identified parameters such as target length, limited RNA nucleotides, combinations of nucleotides, and optimal nucleotide length, resulting in a finite number of identified, predictable sequences. The length of human Grik2 mRNA is ~5000 nucleotides long and optimal siRNA guides are 21 nucleotides long. Thus, there are ~4979 possible 21-mers that can target known RNA with 100% identity. As such, there are finite number of identified solutions evidenced by the GenBank sequences. The large, but finite number of possible solutions becomes much smaller and their function even more predictable once the skilled artisan makes use of the known design guidelines taught by Bofill-De. It would have been obvious to try to design and test guide sequences like SEQ ID NO: 14 to target a Grik2 because Bofill-De demonstrate that given a known target, guide sequences can be generated within their design system to influence gene expression with a measured and predictable outcome and because Bofill-De teaches even with computer design algorithms, off-target sequences can occur, further establishing the need to “try” the sequences to find optimal candidates. The skilled artisan would have had a reasonable expectation of success using Bofill-De’s guide sequence design to make sequences like SEQ ID NO: 14 from the Grik2 gene because Bofill-De teach the known parameters of successful gene targeting such as 21 nucleotide length and asymmetrical nucleotide content in the duplex with more GC content at the 5′-end of the sense strand and more UU at the 3′-end. Thus, Bofill-De’s guide sequence design system to generate sufficiently similar guide sequences to SEQ ID NO: 14 from a known target would yield a guide sequence which predictably inhibits the Grik2 gene. See MPEP 2143 I (E). Further, Hornstein had taught expressing the nucleic acid sequence encoding the inhibitory polynucleotide from a nucleic acid construct; both Crepel and Hornstein had taught that such an agent may be mixed with a pharmaceutical excipient. Therefore, one would have had reasonable expectation of success in incorporating the guide sequence obtained by trying a few different options, into an expression cassette and finally making it in to a pharmaceutical composition. See MPEP 2143 I (A). Regarding claim 37, the method of claim 35 is discussed above. Crepel further teaches wherein the epilepsy is temporal lobe epilepsy [0019, 0026]. Regarding claim 38, the method of claim 35 is discussed above. Crepel further teaches wherein the subject is human [0077]. Regarding claim 40, the method of claim 35 is discussed above. Crepel further teaches wherein the neuronal cell is a hippocampal cell [0027]. Regarding claim 41, the method of claim 35 wherein Bofill-De’s step-by-step guidelines for RNAi design specifically for an antisense oligonucleotide (guide strand) that is obtained by expressed shRNA was discussed for claim 35. Bofill-De had further taught that the enzyme that processes the inhibitory RNA inside the cell, Dicer, is a dsRNAse (pg.5, middle para). Therefore, the guide strand is prepared in conjunction with a passenger strand that is complementary to it (pgs. 10-11, section 7.1, Fig. 4). See pertinent recitation from section 7.1: the rest of passenger strand sequence (position 2 to 19) to have perfect complementary to the guide strand. Thus, after having arrived at SEQ ID NO: 14, one of skill in the art would have easily designed the passenger strand (complementary base pairing rules) for it. Regarding claim 42, the method of claim 35 wherein Bofill-De’s step-by-step guidelines for RNAi design specifically for an antisense oligonucleotide (guide strand) that is obtained by expressed shRNA was discussed for claim 35. Bofill-De further taught that the same could be expressed from an expression vector such as commercially available mammalian vectors (https://www.addgene.org/mammalianrnai/, pg. 10, last para). Regarding claim 43, the method of claim 42 is taught above. Specifically, Bofill-De taught that the antisense oligonucleotide could be expressed from an expression vector such as lentiviral or retroviral vector (pg. 10, last para). Regarding claim 47, the method of claim 35 wherein Bo-fill-De’s step-by-step guidelines for RNAi design specifically for an interfering oligonucleotide (guide strand) that is obtained by expressing shRNA was discussed for claim 35. Specifically, Bofill-De taught several advantages to having antisense polynucleotides designed as short hairpin RNA constructs for e.g., longer half-lives (1st para of introduction). Bofill-De teach the design of Pri-miRNA-like shRNA (“second generation”), based on the pri-mir-30a (Fig. 2 and legend). The shRNA sequence (from 5′ to 3′) will be in the order of passenger strand, loop, then guide strand., (pg. 10). Bofill-De disclose that miR-30a is a widely used backbone for shRNA production (pg. 5, first para; 2nd generation, Fig. 2 legend). Regarding claim 48, the method of claim 47 is taught above. Further, Bofill-De taught (c) the first flanking region and the second flanking regions are miR-30 flanking regions. See Fig. 2 and the following recitations. from pg. 4: A typical pri-miRNA contains three components: 1) A loop of variable size 2) A stem of three helical turns (33~35 bp) and 3) single-stranded regions flanking the hairpin. And legend for Fig. 2: B) Pri-miRNA-like shRNA (“second generation”), based on the pri-mir-30a (note incomplete flanking 5′ and 3′ regions). Regarding claim 49, the method of claim 48 is taught above. Further, Bofill-De taught wherein the promoter is (ii) U6 promoter. See Fig. 4. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have acted upon the advantage disclosed by Bofill-De and designed the polynucleotides according to the teachings of Bofill-De i.e., SEQ ID NOs: 2 and 14 and placed them in an expression cassette comprising: (a) a stem-loop sequence comprising, from 5' to 3': (i) a 5' stem-loop arm comprising a guide sequence having a nucleic acid sequence of SEQ ID NOs: 14; (ii) a loop region, wherein the loop region comprises a miR-30 loop sequence; (iii) a 3' stem-loop arm comprising a passenger sequence having a nucleic acid sequence of SEQ ID NOs: 2 (b) a first flanking region located 5' to the guide sequence; and a second flanking region located 3' to the passenger sequence, and arrive at a stem-loop design of an expression cassette of claim 16. See MPEP 2144 II. Claim(s) 44-46 are rejected under 35 U.S.C. 103 as being unpatentable over Crepel (US 2016022843) in view of Hornstein (WO 2016/157175 A1) and Bofill-De Ros (Methods. 2016 July 1; 103: 157–166), as applied to claims 35, 37-38, 40-43, and 47 above, and further in view of Greenberg (US 20180193414), all cited in IDS dated 12/11/2025. Regarding claim 44, the method of claim 43 is taught above. Neither Crepel, Hornstein, nor Bofill-De taught expression from an AAV vector. However, Greenberg taught an invention that provides vectors, compositions, and methods of using the same for treating neurological disorders (abstract, 1st line) such as epilepsy [0022]. The vectors comprise nucleic acid molecules [0012]. An embodiment of an oligonucleotide (polynucleotide) is an siRNA comprising guide (antisense) and passenger (sense) sequence [0229 -0230] to suppress relevant targets. An example of a target is Grik2 ([0196]). Greenberg further taught wherein the AAV vector that comprises the polynucleotide of the invention is an AAV9 vector [0095]. Regarding claim 45, the expression vector of claim 11 is taught above and incorporated in the rejection of claim 13 in further view of Greenberg above. Greenberg further teaches wherein the AAV vector comprises (i) an expression cassette comprising a transgene operably linked to one or more regulatory elements and flanked by ITRs, and (ii) an AAV capsid ([00300]). Regarding claim 46, the expression vector of claim 14 is taught above. Greenberg further teaches wherein the AAV vector comprises regulatory elements that comprise promoters ([00347]). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed the sense and antisense oligonucleotides targeting Grik2, made by the method of Crepel, Hornstein, and Bofill-De and the complement thereof (i.e., SEQ ID NOs: 2 and 14) in an AAV9 expression vector according to guidance from Greenberg. It would have merely amounted to a combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that introducing the Grik2 targeting polynucleotides into the AAV9 expression vector of Greenberg could be effective and work as predicted because 1) Greenberg teaches the construction of an expression vector using AAV (Example 1, Y731F); 2) Greenberg teaches that an expression vector in an AAV9 vector is effective in delivering its cargo to neurons (Gene Expression assay [00413]). See MPEP 2143 I (A). Claim(s) 48 is additionally rejected under 35 U.S.C. 103 as being unpatentable over Crepel (US 2016022843) in view of Hornstein (WO 2016/157175 A1) and Bofill-De Ros (Methods. 2016 July 1; 103: 157–166), as applied to claims 35, 37-38, 40-43, and 47 above, and further in view of Rao (US 9353373 B2). This rejection is directed to embodiments (a) the stem-loop sequence of (I) comprises a polynucleotide with the nucleic acid sequence of SEQ ID NO: 20 (f), the miR-30 loop sequence comprises a polynucleotide with the nucleic acid sequence of SEQ ID NO: 25. Regarding claim 48, the teachings of Crepel, Hornstein, and Bofill-De discussed in the rejection of claims 35, 37-38, 40-43, and 47 are incorporated herein. Neither Crepel, Hornstein, nor Bofill-De taught the sequence of miR30a, which is the additional element in SEQ ID NO: 20, outside of the antisense oligonucleotide. However, Rao taught the sequence of miR30a (4th line of bolded sequence within vector pGBI-129 [0167], no SEQ ID NO: is disclosed) and its use to construct a functional shRNA ([0040]). Rao taught that such an expression cassette is effective in knocking down its target ([0043], Fig. 11). It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed the miR30 sequence taught by Rao within the stem-loop design of an expression cassette of claim 47 of Crepel, Hornstein, and Bofill-De. It would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that introducing the sequence of miR30a as taught by Rao into the miR30 loop portion of the stem-loop design of Grik2 targeting polynucleotides within the expression cassette of Crepel, Hornstein, and Bofill-De could be effective and work as predicted because 1) Rao already teaches the construction of an expression cassette with miR30a backbone with the caveat that any miRNA backbone could be used; 2) Rao teaches that such an expression cassette is effective in knocking down its target. As seen in the alignment below, a portion of the miR30a sequence (depicted here as 25) introduced between SEQ ID NOs: 2 and 14 would result in SEQ ID NOs: 20 and 21. See MPEP 2143 I (B). PNG media_image2.png 911 731 media_image2.png Greyscale SEQ ID NO: 25 shown above is comprised within SEQID NO: 24. Thus, all the claim limitations are seen in the alignment above. Claim(s) 48 and 49 are additionally rejected under 35 U.S.C. 103 as being unpatentable over Crepel (US 2016022843) in view of Hornstein (WO 2016/157175 A1), and Bofill-De Ros (Methods. 2016 July 1; 103: 157–166), as applied to claims 35, 37-38, 40-43, and 47, above, and further in view of Xu (CN 103695327), evidenced by its English translation. This rejection is directed to embodiment (d) the first flanking region comprises a polynucleotide with the nucleic acid sequence of SEQ ID NO: 24, as recited in claim 48. Regarding claim 48, the teachings of Crepel, Hornstein, and Bofill-De discussed in the rejection of claim 47 are incorporated herein. Specifically, Crepel, Hornstein, and Bofill-De teach d) the passenger sequence is fully or partially complementary to the guide sequence (rejection of claims 35, 41, and 47); Bofill-De teaches the order of elements in a shRNA hairpin design. Neither Crepel, Hornstein, nor Bofill-De, teach wherein the expression cassette comprises d) the first flanking region comprises a polynucleotide having identity to the nucleic acid sequence of SEQ ID NO: 24. However, Xu teaches the sequence of hU6 promoter-shRNA-microRNA 30 (miR30) elements and its use as flanking regions in an expression cassette Claim 3; SEQ ID NO 5. Xu further taught that such an element is useful for targeting shRNA constructs to dendritic cells, i.e., human cells ([0014 – 0017]). As shown in the alignment below, the sequence taught by Xu is 100% identical to SEQ ID NO: 24. Query Match 100.0%; Score 121; Length 286; Best Local Similarity 100.0%; Matches 121; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TCGACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2 TCGACTAGGGATAACAGGGTAATTGTTTGAATGAGGCTTCAGTACTTTACAGAATCGTTG 61 Qy 61 CCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 62 CCTGCACATCTTGGAAACACTTGCTGGGATTACTTCTTCAGGTTAACCCAACAGAAGGCT 121 Qy 121 C 121 | Db 122 C 122 It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have combined the hU6 promoter-shRNA-microRNA 30 (miR30) element sequence taught by Xu within the stem-loop design of an expression cassette of Crepel, Hornstein, and Bofill-De further inserting the hU6 promoter-shRNA-microRNA 30 sequence taught by Xu as per the rationale discussed above. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that combining the hU6 promoter-shRNA-microRNA 30 (miR30) elements with the stem-loop design of Grik2 targeting polynucleotides within the expression cassette of Crepel, Hornstein, and Bofill-De could be effective and work as predicted because Xu already teaches the construction of an expression cassette with hU6 promoter-shRNA-microRNA 30 (miR30) element useful for targeting shRNA constructs to dendritic cells. See MPEP 2143 I (A). Conclusion No claims are allowed. Applicant's submission of an information disclosure statement under 37 CFR 1.97(c) with the timing fee set forth in 37 CFR 1.17(p) on 12/11/2025 prompted the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 609.04(b). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SHABANA S MEYERING/Examiner, Art Unit 1635 /SHABANA S MEYERING/Examiner, Art Unit 1635 /CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jan 04, 2022
Application Filed
Jul 13, 2025
Non-Final Rejection — §103, §DP
Dec 11, 2025
Response Filed
Feb 26, 2026
Final Rejection — §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12571038
DIGITAL COUNTING OF INDIVIDUAL MOLECULES BY STOCHASTIC ATTACHMENT OF DIVERSE LABELS
2y 5m to grant Granted Mar 10, 2026
Patent 12570979
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 10, 2026
Patent 12565651
OLIGONUCLEOTIDES COMPRISING SEGMENTED GAP STRUCTURES
2y 5m to grant Granted Mar 03, 2026
Patent 12565657
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 03, 2026
Patent 12565655
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
2y 5m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
70%
Grant Probability
99%
With Interview (+40.5%)
2y 3m
Median Time to Grant
Moderate
PTA Risk
Based on 56 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month