DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
This is in response to the papers filed July 11, 2025.
Claims 22, 24-27, 31-33, and 35-37 are pending in application. Claims 23. 28-30 and 34 have been canceled, claim 22, 25-26, 31-33 and 35 are amended and no new claims are added as set forth in the amendments filed 07/11/2025.
Claims 22, 24-27, 31-33, and 35-37 are pending in application and are examined on the merits.
Priority
This application is a 371 of PCT/CN2020/094751 filed June 15, 2020.
Applicant’s claim for the foreign priority of Chinese Patent Application 201910642804.4 filed July 16, 2019 is acknowledged.
Thus, the earliest possible priority for the instant application is July 16, 2019.
Response to arguments
Withdrawn objections/ Rejections in response to Applicants’ arguments or amendments
Claim Rejections - 35 USC § 112 (b)
The rejection of claims 22-37 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter is withdrawn.
Applicant’s amendments and arguments filed 07/11/2025 have been considered and are persuasive. In particular, Applicant has canceled claim 23, made each claim a singular sentence, amended to establish antecedent basis and deleted relative terminology.
Claim Rejections - 35 USC § 112 (d)
Claim 30 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim is withdrawn.
Applicant has canceled claim 30.
Maintained objections/ Rejections in response to Applicants’ arguments or amendments
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Claim 31 is not sequence compliant as the amino acid sequence recited does not have an SEQ ID NO associated with it as the CRF was not entered. CRF has not been accepted and found deficient in overcoming this objection as detailed in the Sequence Listing Report filed 07/14/2025, in particular
Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d).
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
In response to the filing of the CRF to overcome Sequence compliance issues,
The CRF was found deficient (CRFD) and not entered into the case record as detailed in the Sequence Listing Report filed 07/14/2025, in particular the format is incorrect for the filing date of the application.
Claim Rejections - 35 USC § 112 (a)
Claims 22, 24-27, 31-33, and 35-37 remain rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
This rejection has been modified as necessitated by Applicant’s arguments and amendments filed 07/11/2025.
In analyzing whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. To provide adequate written description and evidence of possession of a claimed genus, the specification must provide sufficient distinguishing identifying characteristics of the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combination thereof. The disclosure of a single species is rarely, if ever, sufficient to describe a broad genus, particularly when the specification fails to describe the features of that genus, even in passing. (see In re Shokal 113USPQ283(CCPA1957); Purdue Pharma L.P. vs Faulding Inc. 56 USPQ2nd 1481 (CAFC 2000).
The court explained that “reading a claim in light of the specification, to thereby interpret limitations explicitly recited in the claim, is a quite different thing from ‘reading limitations of the specification into a claim,' to thereby narrow the scope of the claim by implicitly adding disclosed limitations which have no express basis in the claim.” The court found that applicant was advocating the latter, i.e., the impermissible importation of subject matter from the specification into the claim.). See also In re Morris, 127 F.3d 1048, 1054-55, 44 USPQ2d 1023, 1027-28 (Fed. Cir. 1997).
Claim 22 reads on an oncolytic virus selected from a large list of viruses with a first regulatory element comprising a tumor-specific promoter selected from the long list of promoters, a nucleic acid sequence which expresses a protease (also chosen from a list of proteases) in a tumor cell, and a second regulatory element comprising a specific cleavage site which is recognized and cleaved by the protease. The second element is located between the first and second codons.
The claim is extremely broad as it encompasses a laundry list of type of virus with any tumor specific promoter chosen from the laundry list of promoters with any protease chosen from a laundry list of proteases and its corresponding cleavage site, wherein any gene can be expressed.
The specification provides disclosure of viruses in the following matter on page 6:
“Oncolytic virus is selected from the group consisting of herpes simplex virus (such as herpes simplex virus type 1), adenovirus, vaccinia virus, newcastle disease virus, poliovirus, coxsackie virus, measles virus, mumps virus, vesicular stomatitis virus, and influenza virus. It should be noted that virus types applied to the present disclosure are not limited to those mentioned above. In other embodiments, those skilled in the art can select a suitable oncolytic virus based on needed. But as long as it has the ability to infect and selectively tumor cells, no matter which virus is selected, it belongs to the protection scope of the present disclosure.”
The working examples demonstrate only herpes simplex virus constructs (oHSV-BJs) compared to that of wild-type HSV (KOS) (Figure 1, 3, 4, Example 1).
Therefore, the specification does not reasonably provide the vast genus encompassing any virus. The invention is only directed towards HSV as the virus.
The specification does not provide guidance for the breadth of “regulatory element.” In Example 1, the first regulatory element is located downstream the essential gene of ICP27 and comprises: hTERT promoter, CMV enhancer, nucleic acid encoding HRV-3C protease, and BGH poly (A). (p. 14, (1)). The second regulatory element is located between the first and second codons of the ORF of the essential gene of ICP27 and comprises: a nucleic acid sequence encoding interferon a2 signal peptide and a nucleic acid sequence encoding the cleavage site wherein the nucleic acid sequence encoding the cleavage site is TTAGAAGTTCTTTTTCAAGGTCCT (amino acid sequence of the cleavage site is LEVLFQGP) (p. 15, (2)).
Therefore, the invention is limited to these disclosures for the regulatory element.
The specification does provide some disclosure of promoters on page 6:
Promoter: “telomerase reverse transcriptase (hTERT), human epidermal growth factor receptor-2 (HER-2), E2F1, osteocalcin, carcinoembryonic antigen, survivin and ceruloplasmin promoters. Of course, the tumor-specific promoters applied to the present disclosure are not limited to those mentioned above. In some other embodiments, those skilled in the art can select a suitable promoter that can specifically drive the expression of downstream genes in tumor cells as required. No matter which tumor-specific promoter is selected, it belongs to the protection scope of the present disclosure.”
The working examples only provide for hTERT as the promoter of HSV-BJ (p. 14).
Therefore, there is only adequate written description for hTERT as the promoter of the oncolytic virus.
The specification does provide some disclosure of proteases on page 4:
“The specific protease is selected from the group consisting of human rhinovirus 3Cprotease (HRV 3C protease), thrombin, factorXa protease, tobacco etch virus protease (TEV protease) or recombinant PreScission protease.”
With their respective cleavage sites on pages 4-5:
“When the specific protease is human rhinovirus 3C protease, the amino acid sequence of the specific cleavage site is: LEVLFQGP.
When the specific protease is thrombin, the amino acid sequence of the specific cleavage site is: LVPRGS.
When the specific protease is factor Xa protease, the amino acid sequence of the specific cleavage site is: IE/DGR (IEDGR or IDGR).
When the specific protease is tobacco etch virus protease, the sequence of the specific cleavage site is: ENLYFQG.
When the specific protease is recombinant PreScission protease, the sequence of the specific cleavage site is: LEVLFQGP.”
However, the working examples only provide for human rhinovirus 3C (HRV-3C) protease as shown in SEQ ID NO: 5 and its cleavage site LEVLFQGP (Figure 1, Example 1, p. 15).
Therefore, there is only adequate written description for HRV-3C and its cleavage site.
Without a correlation between structure and function, the claim does little more than define the claimed invention by function. That is not sufficient to satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (“definition by function … does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is”).
Accordingly, this limited information is not deemed sufficient to reasonably convey to one skilled in the art that the applicant is in possession of the enormously vast genus of type of virus in Claim 22 with a regulatory element with a number of different elements within said regulatory element, with any tumor specific promoter listed in claim 22 with any protease and its corresponding cleavage site listed in claim 22, wherein any essential gene can be expressed that necessarily and predictably have the functional property of driving expression in a tumor cell listed in claim 22.
Thus, for the reasons outlined above, it is concluded that the claims do not meet the requirements for written description under 35 U.S.C. 112, first paragraph.
MPEP 2163 - 35 U.S.C. 112(a) and the first paragraph of pre-AIA 35 U.S.C. 112 require that the “specification shall contain a written description of the invention ....” This requirement is separate and distinct from the enablement requirement. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1340, 94 USPQ2d 1161, 1167 (Fed. Cir. 2010) (en banc)
Dependent claims are included in the basis of the rejection because they do not correct the primary deficiencies of the independent claim(s).
In response to Applicant’s arguments and amendments filed 07/11/2025 regarding the 112a Written Description rejection,
Applicant’s arguments and amendments are considered however they are not persuasive. Applicant argues that claim 22 has been amended to overcome the rejection and further specify what the invention believes to be the invention.
Examiner disagrees. Based upon the working examples, only specific species from the laundry lists amended into claim 22 are the invention of the oncolytic virus adequately described.
As previously set forth in the rejection:
The working examples demonstrate only herpes simplex virus constructs (oHSV-BJs) compared to that of wild-type HSV (KOS) (Figure 1, 3, 4, Example 1).
The working examples demonstrate only herpes simplex virus constructs (oHSV-BJs) compared to that of wild-type HSV (KOS) (Figure 1, 3, 4, Example 1).
The working examples only provide for hTERT as the promoter of HSV-BJ (p. 14). the working examples only provide for human rhinovirus 3C (HRV-3C) protease as shown in SEQ ID NO: 5 and its cleavage site LEVLFQGP (Figure 1, Example 1, p. 15).
The working examples show the first regulatory element is located downstream the essential gene of ICP27 and comprises: hTERT promoter, CMV enhancer, nucleic acid encoding HRV-3C protease, and BGH poly (A). (p. 14, (1)). The second regulatory element is located between the first and second codons of the ORF of the essential gene of ICP27
Therefore, the invention is only directed towards HSV as the virus, hTERT as the promoter of the oncolytic virus, and HRV-3C protease and its cleavage site.
Double Patenting
Claims 22, 24-27, 31-33, and 35-37 remain provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 17-20, 26 and 27 of copending Application No. 17/597,649 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because:
Application ‘649 is a genus to the present application’s species.
Regarding claim 22, Application ‘649 recites a virus for specifically killing tumor cells wherein the virus is a recombinant oncolytic virus (i.e. oncolytic adenovirus) comprising an exogenous promoter to drive expression of a gene (Claim 17). The exogenous promoter is a tumor specific promoter located upstream from the gene (Claim 18). As Claim 17 utilizes comprising, the entirety of Claim 22 can be encompassed into the breadth of the claim.
Regarding claim 26, Application ‘649 recites an enhancer located between the tumor-specific promoter and the regulated gene (Claim 19).
Regarding claim 28, Application ‘649 recites wherein the tumor specific promoter is any one of telomerase reverse transcriptase promoter, human epidermal growth factor receptor-2 promoter, E2F1 promoter, osteocalcin promoter, carcinoembryonic antigen promoter, survivin promoter and ceruloplasmin promoter (Claim 27).
Regarding claims 33 and 34, Application ‘649 recites “wherein an additional copy of the regulated essential gene is further inserted into the genome or more than one, gene is regulated. The exogenous promoter and the enhancer are accordingly inserted into the genome and located upstream each regulated essential gene” (Claim 20).
Regarding claim 36-37, Application ‘649 recites “a drug comprising the virus for specifically killing tumor cells of claim 17” (Claim 26). As previously established, claim 17 of Application ‘649 encompasses the present invention of claim 22 and therefore the drug of 26 would be a genus for the drug of claim 36.
Therefore claim 22 and its dependent claims are encompassed by, or overlap in scope significantly with, the claims of 17/597,649.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
In response to Applicant’s arguments filed 07/11/2025 regarding the Double Patenting rejection,
Applicant’s request to hold the double patenting rejection in abeyance as both applications are co-pending is denied and the rejection is maintained.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA CONNORS whose telephone number is (571)272-7010. The examiner can normally be reached Monday - Friday (9AM-5PM).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MARIA LEAVITT can be reached on (571) 272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALEXANDRA F CONNORS/Examiner, Art Unit 1634
/MARIA G LEAVITT/Supervisory Patent Examiner, Art Unit 1634