Prosecution Insights
Last updated: October 01, 2026
Application No. 17/597,995

NDUFS2 SUBUNIT KNOCKOUT HUMAN CELL LINE

Non-Final OA §103§112
Filed
Feb 01, 2022
Priority
Oct 01, 2019 — provisional 62/908,849 +1 more
Examiner
WHITEMAN, BRIAN A
Art Unit
1600
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Virginia Polytechnic Institute and State University
OA Round
3 (Non-Final)
68%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
85%
With Interview

Examiner Intelligence

Grants 68% — above average
68%
Career Allowance Rate
801 granted / 1169 resolved
+8.5% vs TC avg
Strong +17% interview lift
Without
With
+16.7%
Interview Lift
resolved cases with interview
Typical timeline
2y 8m
Avg Prosecution
57 currently pending
Career history
1205
Total Applications
across all art units

Statute-Specific Performance

§101
6.8%
-33.2% vs TC avg
§103
30.4%
-9.6% vs TC avg
§102
19.5%
-20.5% vs TC avg
§112
25.8%
-14.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1169 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . The examiner of your application in the PTO has changed. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Brian Whiteman, Art Unit 1636. Response to Arguments Applicant’s arguments, see pages 3-9, filed 11/21/25, with respect to the rejection(s) of claim(s) 1-4 and 6-10 under 112(a) and (b) and 103 have been fully considered and are persuasive. Therefore, the rejection has been withdrawn. However, upon further consideration, a new ground(s) of rejection is made in view of newly discovered prior art. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 7 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 7 recites the limitation "The recombinant HEK cell line of claim 6" in line 1. There is insufficient antecedent basis for this limitation in the claim. Clam 6 was cancelled in the amendment filed on 11/21/25. Claim Rejections - 35 USC § 103 The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action. Claims 1, 2, 7, and 10 are rejected under 35 U.S.C. 103 as being unpatentable over The Children’s Hospital of Philadelphia (WO2020006321, EFD 6/27/18) and Bauer (Journal of Visualized Experiments, 83(e52118), pages 1-10, 2014, of record) and BC008868.2(Homo Sapiens NADH dehydrogenase (ubiquinin) Fe-S protein 2, 49 kDa (NADH-coenzyme Q reductase) mRNA (cDNA clone MGC: 15322 IMAGE:4131430, complete cds, 7/15/06, pages 1-2, of record). ‘321 discloses compositions and methods for treatment of mitochondrial respiratory chain dysfunction and other mitochondrial disorders (abstract). Also disclosed are screening assays having the utility to identify agents which modulate the phenotype associated with mitochondrial respiratory chain dysfunction in simple model animals and in human cells. Genetic alterations that can be studied include a gene selected from NDUFS2, NUBPL, FBXL4, C12ORF65 and DLDH. ‘321 teaches using CRISPR-Cas technology knocking out NDUFS2 (pages 1-8, 52-53, and 72-80). One mutation p.R290K for NDUFS2 was known in the prior art (page 8). ‘321 contemplates using HEK293 cells in a secondary screening method to study a cellular parameter associated with mitochondrial dysfunction, wherein the cells comprise a mutation in NDUFS2 gene (page 75). ‘321 does not specifically making a recombinant HEK cell line having an inactivation mutation in the nucleotide sequence comprising SEQ ID NO: 11 (a NDUFS2 gene) using a CRISPR-Cas9 system comprising a sgRNA selected from SEQ ID NOs: 6, 7, 8, or 9. However, Bauer teaches methods for generating genomic deletions in mammalian cell lines by using CRISPR/Cas9 (abstract). Bauer teaches "simple methodology for CRISPR design, cloning, and delivery for the production of genomic deletions" (abstract). Bauer teaches that the strategy relies on cellular delivery of a pair of chimeric single guide RNAs to create two double strand breaks (DSBs) at a locus to delete the intervening DNA segment by non-homologous end joining (NHEJ) repair (abstract). Bauer teaches that this approach is useful for “efficient loss-of-function studies of genes and genetic elements in mammalian cell lines (abstract).” A human nucleotide sequence encoding NDUFS2 reading on the nucleotide sequence set forth in instant SEQ ID NO: 11 was well known in the prior art as exemplified by BC008868.2. Thus, one of ordinary skill in the art would possess the knowledge that SEQ ID NO: 11 is found in a human cell. See MPEP 2141(II)(C): Rationales to support rejections under 35 U.S.C. 103 recites, “Prior art is not limited to the references being applied, but includes the understanding of one of ordinary skill in the art.” It is noted that the specification teaches using the guide RNAs set forth in SEQ ID NOs: 6-9 in CRISPR plasmids to transfected HEK cells (see specification on pages 20-21). The specification teaches that SEQ ID NOs: 6 and 7 have targeting sequences that target the 970 bp site of NDUFS2, while SEQ ID NOs: 8 and 9 target the 1002 bp site of NDUFS2 (see SEQ ID NO: 4 and 5 on page 21, first paragraph). The specification further teaches making cell clones that lack NDUFS2 protein expression and designating these clones as HEK293ANDUFS2 (page 22, paragraph 2). Accordingly, for the purposes of this rejection, the limitations for making the recombinant HEK cell line recited in the instant claims are interpreted as referring to the process by which the claimed recombinant cell is made. MPEP 2113 states: "Product- by-process claims are not limited to the manipulations of the recited steps, only the structure implied by the steps" and that "determination of patentability is based on the product itself". The broadest reasonable interpretation of the claims reciting that the claimed recombinant HEK cell line is made by using sgRNAs comprising SEQ ID NOs: 6-9 does not distinguish the claimed recombinant HEK cell line from any HEK cell line having an inactivation mutation at nucleotide 970 or nucleotide 1002 of SEQ ID NO: 11. In addition, there is no requirement in the claims that the claimed cell possess the instant sgRNAs. However, the amended claims now require that the cell line comprises an inactivated NADH gene resulting from cleavage with sgRNAs targeting the 970 bp site or the 1002 bp site (instant SEQ ID NO: 6, 7, 8, or 9). It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘321 taken with Bauer and BC008868.2, namely to arrive at the claimed invention. ‘321 suggest using HEK293 cells comprising an inactivation mutation in NDUFS2 gene to study mitochondrial dysfunction and using CRISPR-Cas9 system to inactivate the gene. BC008868.2 discloses a nucleotide sequence that would contain the regions (SEQ ID NO: 4 and 5 as disclosed in the specification) targeted by instant SEQ ID NOs: 6-9 as shown below: BC008868.2 946 GGGCACAGTGGATCCGAGTGCTGTTTGGA 973 SEQ ID NO 5 5' CAGTGGATCCGAGTGCTGTT 3' SEQ ID NO 6 5' CACCgCAGTGGATCCGAGTGCTGTT 3' SEQ ID NO 7 3' cGTCACCTAGGCTCACGACAACAAA 5' BC008868.2 971 GGAGAAATCACACGTTTGTTGAACCACATCATGGCTGTGA 1010 SEQ ID NO 4 5' ACGTTTGTTGAACCACATCA 3' SEQ ID NO 8 5' CACCgACGTTTGTTGAACCACATC 3' SEQ ID NO 9 3' cTGCAAACAACTTGGTGTAGTCAAA 5' BC008868.2 indicates that the coding sequence is from 449-1840 and therefore the alignment indicates that SEQ ID NO: 4 and 5 align to the coding sequence within this region. The downstream PAM sequence NGG is underlined and bolded in BC008868.2 Regarding the sequences that do not align with BC008868.2, the teaching of Bauer makes obvious these additional nucleotides. Bauer provide instructions for cloning into the pSPCas9(88) plasmid and pX458 (Addgene plasmid ID 48138) including adding CACC before the 20-mer guide sequence and “AAAC” before the guide reverse complement for cloning. See page 2, CRISPR Design, step 4, part 1. Bauer further teaches adding a G nucleotide after the CACC sequence before the 20-mer if the first position of the 20-mer is not G. The expression of sgRNA from the U6 promoter of the pX330 vector is enhanced by the inclusion of as G nucleotide after the CCAC sequence. Adding a C at the 3’ end of the reverse complement oligo (e.g., sgRNA-A in table 4). The resultant oligos would be 25-mer oligos. See page 2 of CRISPR design, step 4, part 2. These disclosures account for the nucleotide(s) with the underline in the alignments above. Bauer further teaches to ensure that guide sequence consist of a 20-mer upstream of an NGG sequence and to design two sgRNAs located within exons to create a loss of function (page 2, CRISPR Design, step 1). It further would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to try using SEQ ID NOs 6, 7, 8 or 9 as sgRNA for use in a CRISPR/Cas9 complex for cutting and deletion of the NDUFS2 gene in the recombinant human cell line as discussed above. Also, there are a finite number of possible sgRNA target sites in SEQ ID NO: 11. In addition, applying Bauer's instruction to target sequences that precede the Cas9 PAM sequence NGG and to target exons would have further narrowed down the potential candidate target sequences to a number that would have been easily traversable. In addition, the additional modifications to the 5' and/or 3' ends of SEQ ID NOs 4 and 5 to arrive at SEQ ID NOs 6-9 simply follow the same directions as taught by Bauer as discussed above. SEQ ID NOs 6-9 are 25 nucleotides in length, which is also taught by Bauer. Given the guidance provided by Bauer in designing, synthesizing, and testing sgRNAs having 25 nucleotides in length, one of ordinary skill in the art could have pursued the sgRNA target sequences with a reasonable expectation of success. Accordingly, it would have required no more than routine experimentation to have designed and made SEQ ID NOs 6-9 for the deletion of the NDUFS2 gene in the recombinant human cell line (HEK). With respect to the new limitation ‘wherein the recombinant HEK cell line does not express a functional NDUFS2 protein translated from an mRNA having the nucleotide sequence of SEQ ID NO: 11’ in instant claim 1, the product made obvious by the cited prior art would inherently read on the HEK cell line not expressing the functional NDUFS2 protein encoded by SEQ ID NO: 11 because a human cell would comprise SEQ ID NO: 11 since it is the nucleotide sequence for human NDUFS2. The ‘wherein’ clause in instant claim 2 would be a function of the cell line made obvious by ‘321, Bauer and BC008868.2, when one of ordinary skill in the art carries out the method steps for making the HEK cell line. Regarding claim 10 (it was rejected under 112(b) for depending on a cancelled claim, but to expedite prosecution of the instant application, the claim will be considered to be dependent on claim 1), ‘321 describes using HEK293T cells to study a cellular parameter associated with mitochondrial dysfunction, wherein the cells comprise a mutation in a human gene (NDUFS2). It would have been obvious to one of ordinary skill in the art to use a culture or growth medium comprising the HEK cell line to successfully carry out the method steps to make the HEK cell line. Therefore, the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Conclusion See attached PTO-326 for disposition of claims. The art made of record and not relied upon is considered pertinent to applicant's disclosure. CN11304258 (published 2/4/20) discloses a point mutation of a murine NDUFS2 using CRISPR/Cas9 technology. With respect to the number of NGG PAM sites in the human NDUFS2 sequence set forth in SEQ ID NO: 11 (which is around 2K). One of ordinary skill in the art would understand that there are approximately “”GG” dinucleotides every 42 bases in the human genome. See Integrated DNA technologies Frequently asked questions: What is the average frequency of the CRISPR-Cas9 PAM sequence in the mammalian genome? page 1, retrieved on-line 9/14/26. Thus, there is a finite number of predictable and identifiable PAM sites in the nucleotide sequence set forth in instant SEQ ID NO: 11. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Feb 01, 2022
Application Filed
Apr 24, 2025
Non-Final Rejection mailed — §103, §112
May 15, 2025
Response Filed
Aug 22, 2025
Non-Final Rejection mailed — §103, §112
Nov 21, 2025
Response Filed
Sep 17, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12742169
RNAi CONSTRUCTS AND METHODS FOR INHIBITING LPA EXPRESSION
4y 3m to grant Granted Sep 22, 2026
Patent 12735707
RUNX1 Inhibition for Treatment of Proliferative Vitreoretinopathy and Conditions Associated with Epithelial to Mesenchymal Transition
3y 2m to grant Granted Sep 15, 2026
Patent 12716065
ANTAGONISM AS A THERAPY FOR TDP-43 PROTEINOPATHIES
4y 1m to grant Granted Aug 25, 2026
Patent 12709754
REGULATION OF VON WILLEBRAND FACTOR (VWF)
4y 0m to grant Granted Aug 18, 2026
Patent 12708119
METHODS OF REDUCING OR PREVENTING CLOSTRIDIOIDES DIFFICILE COLONIZATION
3y 10m to grant Granted Aug 18, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
68%
Grant Probability
85%
With Interview (+16.7%)
2y 8m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 1169 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month