DETAILED ACTION
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 3/17/2026 has been entered.
Priority
The priority date for this application is the date of the provisional application: 03/28/2019.
Status of the Claims
This action is in response to papers filed 17th March 2026 in which claims 64-65, 79, and 84 were amended, claims 78 and 83 were canceled, and new claims 90-92 were added. Claims 66 and 77 were previously cancelled.
Election/Restrictions
Applicant's election without traverse of group II and species (ivacaftor) in the reply filed on 4/3/2025 was previously acknowledged and is made Final.
Claims 84 - 89 were withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim, and continues to be maintained. New claims 90-92 are added to withdrawn group as they encompass claims dependent on independent claim 84. Election was made without traverse in the reply filed on 4/3/2025.
Accordingly, claims 64-65, 67-76, and 79-82 are being examined.
Amendments and Arguments
All of the amendments have been thoroughly reviewed and entered.
Applicant has:
Cancelled claims 78 and 83 to overcome the 112 rejections; the 112 rejections of previous claims 78 and 83 re Markush grouping are withdrawn.
Amended claims and argue persuasively to overcome the 103 rejection; the 103 rejection of previous claims 64 – 83 are withdrawn.
However, a new §103 rejection of all claims including claims with amendments is presented in this Office Action. This includes a withdrawal of previously indicated allowability of claim 65.
Arguments applicable to newly applied rejections to amended claims are addressed below. Arguments that are no longer relevant are not addressed.
Objections and Rejections not reiterated here are withdrawn.
Claim Objections
Claim 69 is objected to because of the following informality:
a constrained ethyl (cET) backbone in line 5 has the abbreviated form capitalized. It is common in the art to write it this way: a constrained ethyl (cEt) backbone.
Claim 76 and 82 are objected to because of the following informalities:
Translational Read-Through recited in line 3 has the first letters of the words capitalized. It is common in the art to write it this way: translational read-through.
Appropriate correction is required.
Claim Interpretation
Claim 64 as amended reads:
A synthetic antisense oligonucleotide comprising a 14 to 25 nucleotide sequence that targets and is complementary to the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR)-pre-mRNA wherein said synthetic antisense oligonucleotide is chemically modified.
No limiting definition for antisense is provided. Therefore, it will be given the BRI to mean complementary.
No limiting length of the oligonucleotide is provided. Therefore, this claim is being interpreted as: the length of the oligonucleotide isn’t limiting as long as it comprises a 14 to 25 nucleotide sequence that targets and is complementary to the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR)-pre-mRNA.
Claim 79 is similarly recited. Therefore, this claim is being interpreted as discussed for claim 64.
Regarding the recitation of “kit” in claim 79, the specification, does not define this term, and so it is being interpreted to encompass any collection of reagents that includes all of the elements of the claims. Any further interpretation of the word is considered an intended use and does not impart any further structural limitation of on the claimed subject matter.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 64, 67, and 79 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Eggerding (Eggerding et al., HUMAN MUTATION 5:153-165 (1995)).
Regarding claims 64 and 79, Eggerding teach allele-specific oligonucleotides that detect the W1282X mutation (abstract, Table 2: row 4). Three probes (one common and two allelic probes) were needed for analysis of each mutation; for detection of the W1282X mutation, one common and one mutant probe would be needed. Eggerding teach ligation of a mutant probe with the common probe results in a single oligonucleotide (Fig. 1; covalently joined by DNA ligase, legend Fig. 1). Put together the ligated oligonucleotide is at least 46 ntds long. Eggerding teach that the common probe is 5'-phosphorylated and fluorescently labeled at the 3'-end with the fluorescein dye FAM (legend for Table 2). Thus, Eggerding’s ligated oligonucleotide reads on instant oligonucleotide comprising a 14 to 25 nucleotide sequence that targets the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR)-pre-mRNA and is chemically modified. See alignment below with a 17-nucleotide sequence comprising W1282X, known in the art, bolded T indicating the mutation, * indicates chemical modification at 3’-end.
Alignment 1:
Mutantprobe TATCACTCCAAAGGCTTTCCTT-------------- 22
Commonprobe ----------------------CACTGTTGCAAAGTTATTGAATCC* 24
W1282X -------------GCTTTCCTTCACTGTTG------ 17
Eggerding’s ligated oligonucleotide is complementary to the target as seen in this alignment with instant SEQ ID NO: 6.
Alignment 2:
RESULT 1
Mutpluscommon
Query Match 100.0%; Score 20; DB 1; Length 46;
Best Local Similarity 60.0%;
Matches 12; Conservative 8; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CUUUCCUUCACUGUUGCAAA 20
|:::||::|||:|::|||||
Db 15 CTTTCCTTCACTGTTGCAAA 34
Regarding claim 67, Eggerding teach the oligonucleotide comprises 17 to 22 bases. See Alignment 1 above.
Thus, Eggerding anticipates instant claims 64, 67, and 79.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 64-65, 67-69, and 71-75 are rejected under 35 U.S.C. 103 as being obvious over Fajac (Fajac & Boeck, Pharmacology & Therapeutics, Volume 170, 2017, Pages 205-211, ISSN 0163-7258, previously cited) in view of Aartsma-Rus (Molecular Therapy vol. 17 no. 3 mar. 2009) and Accola (US Patent No. 7312033, previously cited).
Regarding claims 64-65, Fajac reviewed the state of the art in CF treatment. Fajac taught various classes of CFTR mutations exist. Class I mutations include W1282X mutations and a therapeutic approach to the same would be read-through agents or using oligonucleotides. See Fig. 2, and §7 Strategies using oligonucleotides to treat at the CFTR gene or mRNA level, on pg. 209. Fajac taught correcting oligonucleotides may be administered to treat patients carrying abnormal CFTR genes. See recitation from pg. 209:
PNG
media_image1.png
200
400
media_image1.png
Greyscale
Fajac taught a single-stranded antisense RNA based oligonucleotide sequence is in a phase I proof-of-concept study in CF patients (§ 7.3).
Regarding claim 71, Fajac taught correcting oligonucleotides may be administered to treat patients (pg. 209). This implies the oligonucleotide is in a pharmaceutical composition.
Regarding claims 72-73, Fajac taught oligonucleotides are poorly suited for oral or systemic delivery. Therefore, treatment via aerosol (inhalation) (§ 7.3) is an option. Fajac taught a randomized, double-blind, placebo controlled, multi-center phase IIb trial including 140 patients with CF, received a monthly inhalation of a plasmid DNA encoding the CFTR cDNA complexed with a liposomal vector for 1 year (pg. 209, § 7.1). Since the oligonucleotide is being inhaled it must be in a composition for nasal administration.
Regarding claims 74-75, Fajac taught, the potentiator ivacaftor (VX-770) (pg. 208, first 2 lines) and the corrector, VX-440 (pg. 208, middle of right column), and a read-through drugs (abstract), are compositions used in the treatment of CF.
quoting abstract:
To obtain robust correction of CFTR expression at the cell membrane, combinations of correctors with additive efficacy are under investigation. Combinations of these therapies can be anticipated. The pipeline of corrective strategies under clinical investigation is increasing continuously and a rising number of pharmaceutical companies are entering the field.
Thus, Fajac taught combination therapies in the treatment of CF (Fajac abstract). Further, Fajac taught potentiators and correctors were successfully tested in clinical trials (pg. 208).
Fajac taught quoting abstract again:
The first 2 drugs have reached the clinic: a CFTR potentiator to augment CFTR channel function, and the combination of this potentiator with a corrector to increase CFTR expression at the cell membrane. Other mutation type-specific treatments under clinical investigation are premature stop codon-read through drugs and antisense oligonucleotides that correct the basic defect at the mRNA level. Combinations of these therapies can be anticipated.
Fajac did not teach examples or how to design oligonucleotides that may overcome premature stop codon mutations such as W1282X mutations (claim 64).
However, before the effective filing date of instant invention, Aartsma-Rus had taught guidelines for Antisense Oligonucleotide design (pg. title). Specifically, Aartsma-Rus teaches Antisense oligonucleotides (AONs) are useful tools to modulate gene expression in a sequence-specific manner requiring stable and efficient binding of the oligonucleotide to its target RNA sequence (“Each antisense mechanism requires stable and efficient binding of the AON to its target sequence”, pg. 548, right col.). ASO can modulate splicing; i.e., exon-skipping or read-through. For splice-modulating AONs in particular, what is need is availability of splice sites in the region that must be spliced, for which there are a number of freely available programs on the internet. See recitation from pg. 549:
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Aartsma-Rus teaches AONs are generally only 17–25-nucleotides long (pg. 548, right col.).
Neither Fajac nor Aartsma-Rus provide a synthetic antisense oligonucleotide that is chemically modified, as recited in claim 64 comprising a 14 to 25 nucleotide sequence that targets and is complementary to the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR)-pre-mRNA
However, before the effective filing date of instant invention, Accola had taught a kit comprising synthetic target sequences and nucleic acids to screen samples for the presence of any one of a collection of mutations in the CFTR gene associated with cystic fibrosis. One such synthetic target nucleic acid sequence, SEQ ID NO: 58, is perfectly complementary to the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR)-pre-mRNA.
See alignment:
RESULT 16 US-10-371-913-58/c Sequence 58, US/10371913 Patent No. 7312033 GENERAL INFORMATION APPLICANT: Accola, Molly APPLICANT: Kwiatkowski, Dr., Robert W. APPLICANT: Tevere, Vincent APPLICANT: Ip, Hon S. APPLICANT: Wigdal, Susan S. APPLICANT: Mast, Andrea L. APPLICANT: Bartholomy, Christian T. TITLE OF INVENTION: CFTR Allele Detection Assays FILE REFERENCE: FORS-07803 CURRENT APPLICATION NUMBER: US/10/371,91 CURRENT FILING DATE: 2003-02-21 PRIOR APPLICATION NUMBER: 60/426,144 PRIOR FILING DATE: 2002-11-14 NUMBER OF SEQ ID NOS: 87 SEQ ID NO 58 LENGTH: 59 TYPE: DNA
Query Match 32.7%; Score 51; DB 1; Length 59;
Best Local Similarity 76.5%;
Matches 39; Conservative 12; Mismatches 0; Indels 0; Gaps 0;
Qy 106 GAUUCAAUAACUUUGCAACAGUGAAGGAAAGCCUUUGGAGUGAUACCACAG 156
||::|||:|||:::|||||||:|||||||||||:::||||:||:|||||||
Db 1 GATTCAATAACTTTGCAACAGTGAAGGAAAGCCTTTGGAGTGATACCACAG 51
Accola teaches this nucleic acid can be used to detect CFTR allele with the W1282X mutation in CFTR gene. The nucleic acid is chemically modified (A nucleic acid of the present invention may comprise modifications in the structure of the backbone, including but not limited to phosphorothioate residues, phosphonate residues, 2' substituted ribose residues (e.g., 2'-O-methyl ribose) and alternative sugar (e.g., arabinose) containing residues, col 15).
In fact, Accola’s nucleic acid comprises instant SEQ ID NO: 6, albeit with deoxyribonucleotides:
RESULT 1
58/c
Query Match 100.0%; Score 20; DB 1; Length 59;
Best Local Similarity 60.0%;
Matches 12; Conservative 8; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CUUUCCUUCACUGUUGCAAA 20
|:::||::|||:|::|||||
Db 31 CTTTCCTTCACTGTTGCAAA 12
The ESE finder site taught by Aartsma-Rus shows that the region around the mutation is abundant with exonic Splice enhancers. See Appendix titled ESE. The mutation region is identified in the Appendix by a red rectangle. The lower part of the Appendix shows the abundance of ESEs.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to look for ESEs within the oligonucleotide taught by Accola using the software programs taught by Aartsma-Rus and find the abundance of ESEs around the mutagenic region as shown in the appendix, then test ~20ntd regions for their effectiveness as an exon-skipping antisense oligonucleotide. One of ordinary skill in the art would have been motivated to combine the teachings of Accola and Aartsma-Rus and make an antisense oligonucleotide out of the probe because Accola teach that the nucleic acid is specific for a particular allele of CFTR (the W1282X mutation in CFTR gene). One would then try an exon skipping oligo sufficiently similar to Applicant’s SEQ ID NO: 4-11 using Aartsma-Rus’s guidelines. Exon skipping oligos rely on a finite number of identified parameters such as target length, limited RNA nucleotides, combinations of nucleotides, and nucleotide length ideally between 17 and 25nt, with a finite number of identified, predictable sequences. The length of the nucleic acid taught by Accola is 51 ntds. Thus, there are 32 possible oligos of 20 ntds length that comprises (target) the mutation site with 100% identity. Thus, there are a finite number of identified solutions that can be “tried” to find optimal candidates. See MPEP 2143 I E.
With respect to the length of the oligonucleotides (comprising 14 – 25 nucleotides), this is a matter of design choice. See MPEP 2144.05 II and In re Williams, 36 F.2d 436, 438, 4 USPQ 237 (CCPA 1929) ("It is a settled principle of law that a mere carrying forward of an original patented conception involving only change of form, proportions, or degree, or the substitution of equivalents doing the same thing as the original invention, by substantially the same means, is not such an invention as will sustain a patent, even though the changes of the kind may produce better results than prior inventions.").
Thus, Fajac in view of Aartsma-Rus and Accola make obvious instant claims 64-65.
Regarding claim 67, the oligonucleotide made obvious by Fajac in view of Aartsma-Rus and Accola is ~20 ntds. However, Accola teach that the oligonucleotide according to the invention preferably has a length of 17–25-nucleotides long (pg. 548, right col.). This reads on comprises 17 to 22 nucleotides.
Regarding claim 68 - 69, the oligonucleotide made obvious by Fajac in view of Aartsma-Rus and Accola has sugar and backbone modifications (including but not limited to phosphorothioate residues, phosphonate residues, 2' substituted ribose residues ( e.g., 2'-O-methyl ribose) and alternative sugar (e.g., arabinose) containing residues, col 15 3rd para).
Thus, Fajac in view of Aartsma-Rus and Accola make obvious instant claims 64-65, 67-69, and 71-75.
Claim 70 is rejected under 35 U.S.C. 103 as being obvious over Fajac (Fajac & Boeck, Pharmacology & Therapeutics, Volume 170, 2017, Pages 205-211, ISSN 0163-7258) in view of Aartsma-Rus (Molecular Therapy vol. 17 no. 3 mar. 2009) and Accola (US Patent No. 7312033, previously cited) as applied to claims 64-65, 67-69, and 71-75 above and further in view of Seth (Seth PP et al., Journal of Medicinal Chemistry, Vol 52, Issue 1, 10 - 13, 2008, previously cited).
Regarding claim 70, the oligonucleotide was made obvious by Fajac in view of Aartsma-Rus and Accola.
Neither Fajac nor Aartsma-Rus nor Accola teach the specific modifications recited in claim 70.
However, before the effective filing date of instant invention, Seth had taught modified oligos. See recitation from introductory para:
PNG
media_image3.png
200
400
media_image3.png
Greyscale
Seth administered their modified oligos in vivo and demonstrated mitigation of hepatotoxicity in mice administered the modified oligos. See Seth Fig. 2 and Table 2, at least.
It would have been prima facie obvious to a person of ordinary skill in the art at the time the effective filing date to incorporate MOE modifications as taught by Seth, namely to arrive at the claimed invention. Seth had already demonstrated that a 14-20-mer antisense oligo is more potent and less toxic than a similar unmodified oligo. One of ordinary skill in the art would have been motivated to modify the sequence by incorporating the modifications with proven higher potency and less toxicity as taught by Seth. One would have expected the ASO targeting the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR)-pre-mRNA to be reasonably as potent as or more potent than Seth’s experimental sequences “without producing hepatotoxicity” because Seth does not teach that the modifications are sequence specific and Seth had administered their modified oligos in vivo. See MPEP 2144. II.
Thus, Fajac, Aartsma-Rus, and Accola in view of Seth makes obvious instant claim 70.
Claims 79-81 are rejected under 35 U.S.C. 103 as being obvious over Fajac (Fajac & Boeck, Pharmacology & Therapeutics, Volume 170, 2017, Pages 205-211, ISSN 0163-7258, previously cited) in view of Aartsma-Rus (Molecular Therapy vol. 17 no. 3 mar. 2009) and Accola (US Patent No. 7312033, previously cited).
Regarding claim 79, the preamble of this claim recites a “kit.” The specification, however, does not define this term, and so it is being interpreted to encompass any collection of reagents that includes all of the elements of the claims. Any further interpretation of the word is considered an intended use and does not impart any further structural limitation of on the claimed subject matter.
With respect to the limitation, that targets and is complementary to the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR) pre-mRNA, that form part of the kit, this was discussed in the rejection of claims 64-65 and similarly apply.
Regarding claim 80-81, these limitations were discussed in the rejection of claims 74-75 and similarly apply.
Thus, Fajac in view of Aartsma-Rus and Accola instant claims 79-81.
Claims 76 and 82 are rejected under 35 U.S.C. 103 as being unpatentable over Fajac (Fajac & Boeck, Pharmacology & Therapeutics, Volume 170, 2017, Pages 205-211, ISSN 0163-7258, previously cited) in view of Aartsma-Rus (Molecular Therapy vol. 17 no. 3 mar. 2009) and Accola (US Patent No. 7312033, previously cited) as applied to claims 64-65, 67-69, and 71-75 above and further in view of Du (Du et al., PNAS, February 12, 2008, vol. 105, no. 6, pgs 2064–2069) and evidenced by Rowe (Rowe et al., J Mol Med (Berl). 2011 November ; 89(11): 1149–1161).
The rejection of claims 64-65, 67-69, and 71-75 made obvious by Fajac in view of Aartsma-Rus and Accola is incorporated herein.
Fajac had taught, the potentiator ivacaftor (QBW251) (pg. 208, , right col, first 2 lines) and the corrector, VX-440 (pg. 208, middle of right column), and read-through drugs (abstract), are compositions used in the treatment of CF.
Neither Fajac nor Aartsma-Rus nor Accola taught the specific read-through agents recited in claims 76 and 82.
However, before the effective filing date of instant invention, Du had taught PTC124 is an orally bioavailable compound that promotes suppression of the human CFTR-G542X nonsense allele in a CF mouse model (title); i.e., is a read-through agent in the treatment of CF. Du experimentally determine that the read-through agent is not specific for a particular mutation, rather works across nonsense mutation-mediated diseases. See relevant citation from pg. 2064, right col, 2nd para:
PNG
media_image4.png
200
400
media_image4.png
Greyscale
As evidenced by Rowe, PTC124 is now known as Ataluren. See Rowe pg. 3, middle of 2nd para.
It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have employed Ataluren as taught by Du, as the read-through agent targeting W1282X mutation in the composition comprising the oligonucleotide of Fajac, Aartsma-Rus, and Accola, for the advantage of overcoming the premature stop-codon created by the mutation. It would have merely amounted to a simple substitution of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that substituting the read-through agent that Fajac had taught, which may be combined with other agents in treatment options for CF, with Ataluren as taught by Du but targeting W1282X mutation could be effective and work as predicted because 1) Du taught that read-through agents work irrespective of the sequence/mutation; 2) Fajac taught a combination of agents is a treatment option for CF. See MPEP 2143 I (B).
Thus, Fajac, Aartsma-Rus, and Accola in view of Du make obvious instant claims 76 and 82.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art at the time of the effective filing date.
Response to Arguments
Applicant's arguments filed 36 regarding the §103 rejections have been fully considered and they are persuasive.
Applicants argue: 1. Regarding claim 64, the results of instant application are superior over the reference of Hastings (2016) because while Hastings oligonucleotide targets exon 23, it is not complementary to the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR) pre-mRNA, and further causes splicing of exon 23 irrespective of the presence of the mutation on the exon. Instant claim 64 recites targets and is complementary to the W1282X mutation in exon 23 of the cystic fibrosis transmembrane conductance regulator (CFTR) pre-mRNA.
The argument is persuasive. The §103 rejection of claim 64 and dependent claims are withdrawn.
2. Regarding dependent claims, Applicants argue that because the independent claim is not obvious over the applied art, the dependent claims are free of the art too.
3. Regarding claim 79, Applicants argue that the amendment for claim 79 is similar to claim 64. Therefore, like for claim 64, claim 79 is not obvious over the applied art, therefore free of the art too.
Applicant’s argument in 2 and 3 above have been fully considered and are persuasive. The §103 rejection of these claims has been withdrawn. However, a new 102 and 103 rejection has been made for these claims addressing amendments, primarily the amendment made to independent claims.
Examiner Suggestion
Applicant’s claims recite “comprises 17-22 bases”. The recitation of “comprises 17-22” bases allows additional bases in the oligonucleotide. If Applicant wants to limit the length of the oligo, then the claims needs to recite something like “wherein said antisense oligonucleotide is 17-22 bases in length” or “wherein the length of the oligonucleotide is 17-22 bases”.
Conclusion
Claims 64-65, 67-76, and 79-82 are rejected.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
SHABANA S. MEYERING, Ph.D.
Examiner
Art Unit 1635
/SHABANA S MEYERING/ Examiner, Art Unit 1635
/CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Prosecution Insights