DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 11/24/2025. Claims 1-8, 11-16, 21-28, 30, 35-37, 42-43, 45-49, 51, and 54-58 are pending. Claims 26 and 30 have been amended. Claims 9-10, 17-20, 29, 31-34, 38-41, 44, 50, and 52-53 have been cancelled. Claims 1-7, 11-12, 15-16, 21-23, 46, 48-49, 51, 56, and 58 are currently under examination. Claims 8, 13-14, 24-28, 30, 35-37, 42-43, 45, 47, 54-55, and 57 are withdrawn from consideration, as they are directed to a non-elected invention group.
Any rejection of record in the previous office actions not addressed herein is withdrawn. New grounds of rejection are presented herein that were not necessitated by applicant’s amendment of the claims since the office action mailed 8/25/2025. Therefore, this action is not final.
Election/Restrictions
The Applicant has elected Invention Group I, drawn to claims 1-5, 16, 48, 51, and 56. Upon further consideration of the original requirement for restriction, the requirement has been partially withdrawn. The present rejection encompasses Applicant’s elected invention group (Group I, claims 1-5, 16, 48, 51, and 56) where additional claims 6-7, 11-12, 15-16, 21-23, 46, 49, and 58 have also been examined. The restriction is modified with the new invention groups as follows:
Group I – Claims 1-7, 11-12, 15-16, 21-23, 46, 48-49, 51, 56, and 58, drawn to nucleic acid sequences comprising methylation protectable elements
Group II – Claim 8 and 13-14, drawn to nucleic acid constructs comprising methylase switch elements M.Osp807II and M.Sen0738I, and maintenance/excision-type design elements
Group III - claims 24-28, 30, 35-37, 42-43, 45, 47, 54-55, and 57, drawn to methods of DNA assembly.
Product claims 8 and 13-14 remain as separate invention group, as such products comprise distinct features compared with the generic nucleic acid recited in claim 1 as discussed in the restriction requirement mailed 8/25/2025.
Claims 8, 13-14, 24-28, 30, 35-37, 42-43, 45, 47, 54-55, and 57 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 11/24//2025. The Applicant argues that the art used in breaking unity of invention does not apply to instant claim 1. This argument is not persuasive, as the naturally occurring E. coli genome broadly reads on instant claim 1 (please see 101 and 102 rejections, below for further details).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 2, 6-7, 11-12, 15, 21-23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claim 2, claim 2 recites “the type IIS restriction enzyme recognition sequence of the methylation-protectable restriction element.” This lacks clear antecedent basis because claim 2 depends from claim 1, where claim 1 recites two methylation-protectable restriction elements. It is unclear if the limitations recited in claim 2 are meant to apply to one or both of the methylation restriction elements.
Regarding claim 6, claim 6 recites “the methylation-protectable restriction element.” However, claim 6 depends from claim 1, which recites two methylation-protectable restriction elements. Claim 6 is therefore unclear, as it is unclear to which of the two elements is being referred, or if both methylation-protectable restriction elements of claim 1 are meant to comprise the limitations of claim 6.
Furthermore, claim 6 recites that the switch methylation comprises the type IIS restriction element of (i) of claim 1, but also that it is different from the methylation recognition sequence of (ii) of claim 1. This claim language is confusing because claim 1 recites that the type IIS restriction comprises or is identical to the methylation recognition sequence (elements (i) and (ii) of claim 1). It is unclear how the elements are recited to be both identical to each other/encompass each other but also be different.
Claims 7 depend from claim 6 and do not resolve this 112(b) issue; these claims are therefore also rejected.
Regarding claim 7, claim 7 recites “the base modified by the by the switch DNA methylase” which lacks proper antecedent basis because no “base” is previously recited in the claims. Furthermore, claim 7 recites that the methylation “blocks” the overlapping recognition sequence, however, it is unclear as to what is being blocked or how (i.e., blocked from digestion by the restriction enzyme?).
Regarding claim 11, claim 11 recites an “opposing methylation protectable restriction element.” Claim 11 depends from claim 1, which recites “two” methylation protectable restriction elements. It is unclear if the two methylation-protectable restriction elements are meant to be “opposing” one another, or if indeed a third methylation-protectable restriction element is meant to be introduced in claim 11. Note that claim 1 was originally not drawn to “two” methylation-protectable restriction elements, where “two” elements were added after amendments (i.e., this 112(b) issue may the result of an issue resulting from the updated amendment). It is unclear if these “two” methylation restriction elements in claim 1 are the “opposing” each other, or if an additional methylation-protectable element is required.
Claims 12 and 15 depend from claim 11 and do not resolve this 112(b) issue and are therefore also rejected.
Regarding claims 15, this claim recite “the nucleic acid according to any of claim 11.” The dependency of this claim is therefore unclear, as it is unclear from which claim it is meant to depend.
Regarding claim 21, claim 21 recites “(and methylates).” This claim language is unclear because it is unclear if this parenthetical statement is a required element of the claim. Furthermore, claim 21 recites “the methylation-protectable restriction element” which lacks clear antecedent basis because two such elements are recited in claim 1, form which claim 21 ultimately depends. It is unclear which element is being referred in claim 21, or if both of the elements are meant to referred.
Regarding claim 22, claim 22 has identical 112(b) issues as claim 21, where claim 22 recites “(and methylates)” and also unclear language lacking antecedent basis with regards to the element “the switch DNA methylase recognition sequence,” as no “switch DNA methylase recognition sequence” of the methylation-protectable element is recited in claim 1.
Regarding claim 23, claim 23 recites “associated guide nucleic acid where necessary,” which is unclear because it is unclear how the term “where necessary’ limits the claim. The term “where necessary” is exemplary language, and it renders the claim indefinite, as it is unclear if and when the guide nucleic acid is necessary, where furthermore such necessity is subjective dependent upon an individual practitioners’ interpretation.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-7, 11-12, 15-16, 21-23, 46, 48-49, 51, 56, and 58 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by GenBank U00096 (‘096, GenBank Accession number U00096, published 11/15/2013, E. coli genome, of record). The rejection is further evidenced by Nelles (Nelles DA et al. Bioessays. 2015 Jul;37(7):732-9), New England Biolabs (NEB Product brochure for restriction nucleases, published 2026), and Grainger (Grainger DC et al. Nucleic Acids Res. 2007;35(1):269-78).
Claim Interpretation:
Claim 1 is drawn to a nucleic acid sequence comprising two methylation-protectable restriction elements which comprise a type IIS restriction site, a methylase recognition sequence which is overlapping and identical to the type IIS restriction site (i.e., the same site/sequence), and a recognition sequence for a DNA-binding protein which overlaps the methylase recognition sequence. Claim 1 further recites that the two methylation-protectable restriction elements are separated by a DNA sequence which comprises an identical restriction site as the methylation-protectable sequence, where the methylation-protectable sequences are not methylated but the sequence between the methylation-protectable sequence is methylated. The specification recites that GGTCTC, the BsaI recognition sequence, is one such methylation-protectable restriction element (page 5, second paragraph). Thus, claim 1 broadly reads on a nucleic acid comprising three such GGTCTC sequences, where two of such methylation-protectable sequences are methylated and encompass a third GGTCTC sequence which is not methylated, as the methylase sequence is recited to be identical to the methylation-protectable restriction element sequence. Furthermore, regarding the limitations of the recognition sequence of a DNA-binding protein, such claim limitations do not add specific structural significance to the nucleic acid of claim 1 because DNA-binding proteins such as Cas nucleases can be designed with guide nucleic acids to bind to any sequence, as evidenced by Nelles (Abstract).
Regarding the structure of the nucleic acid claimed in claim 1, this claim language reads on the naturally occurring genome of E. coli. For instance, as taught by ‘096, the E. coli genome naturally comprises instances of GGTCTC:
TCAGCCATTTAAGGTCTCCTTAGCGCCTTATTGCGTAAGACTGCCGGAACTTAAATTTGCCTTCGCACAT – Page 143/873, line 10
CGCCAGGTCTCCGGAACACCCTGCAATCCCGAGCCACCCAGCGTTGTAACGTGTCGTTTTCGCATCTGGA – page 143/873, line 17
CGCGCAAACGCTCTGCTGCCTGTTCTGCGGTCAGGTCTCGCTGGGTCTCTGCCAGCATTTCATAACCAAC – page 149/873, line 62
Furthermore, regarding the limitation that the type IIS restriction enzyme recognition sequence between the two methylation-protectable restriction elements is methylated whereas the methylation-protectable restriction elements are not methylated, it is known in the art that BsaI restriction sites are methylated by the Dcm methylase naturally, where furthermore such methylases are naturally occurring in E. coli cells evidenced by New England Biolabs, where furthermore such methylation of GGTCTC sites can “block” the activity of the restriction enzyme (page 1, first paragraph and page 3, row 5 of New England Biolabs). Thus, Dcm methylase-positive E. coli cells naturally methylate GGTCTC sites (New England BioLabs, page 3, row 5). Given that the E. coli genome comprises multiple GGTCTC sites, and that Dcm methylase-positive strains of E. coli can methylate these sites rendering the sites resistant BsaI restriction (page 1 of New England Biolabs, first paragraph and page 3, row 5), and furthermore that the E. coli genome is circular, the methylation of any single GGTCTC site within the E. coli genome necessarily reads on claim 1, as such a methylated site would be flanked by two GGTCTC sites, depending on how the circular genome is being viewed. Additionally, the methylases Dcm which occur in E. coli can be viewed as DNA-binding proteins, as such methylases necessarily bind with DNA in order to methylate DNA sites.
Additionally, note that New England Biolabs teaches that resident methylases such as Dcm methylate some restriction sites, they do not methylate all restriction sites, where such variations in methylation patterns can lead to variable digestion patterns (e.g., page 1 of New England Biolabs, paragraph 4). Thus, it is reasonable to conclude given the teachings of New England Biolabs concerning methylation patterns that, of the numerous GGTCTC sites within the bacterial genome, some are methylated while some are not, which would yield methylation patterns such as those presently recited (New England Biolabs, page 1, fourth paragraph, and all of section entitled “Prokaryotic Methylation”).
Note that, while New England Biolabs is post-filing art, the above rationale for rejection under 102 is consistent with a rejection made based upon inherency of a product (see MPEP 2112, sections I-III). New England Biolabs’ post-filing publication is used to explain inherent characteristics of E. coli cell and its genome characteristics, such as Dcm methylases and their methylation targets which can overlap BsaI sites. Thus, claim 1 is most broadly drawn to the genome of a naturally occurring Dcm-methylase positive E. coli cell.
In addition, note that claim 1 is only drawn to a nucleic acid sequence.
Regarding claim 2, as discussed above, ‘096 teaches that the restriction site can be GGTCTC.
Regarding claim 3, as discussed above, ‘096 inherently teaches the BsaI restriction site GGTCTC. Furthermore, the specification teaches that BsaI cuts with a 4 bp overhang (page 23, third paragraph).
Regarding claims 4-5, claim 4 is directed to a nucleic acid sequence. As discussed above, Nelles teaches that DNA binding proteins such as Cas proteins can be engineered to bind to DNA sequences (Abstract). Thus, the nucleic acid sequence of the E. coli genome reads on claims 4-5. With regards to the limitation in claim 5, that the RNA-guided DNA nuclease is deactivated, this does not affect the structure of the DNA sequence itself, and relates only to the properties of the endonuclease, where the claims are drawn not to the protein/nuclease itself but to a nucleic acid sequence.
Regarding claim 6, as discussed in the above 112(b) rejection, the exact structure claimed in claim 6 is unclear. For the present rejection, claim 6 is being interpreted to simply comprise the restriction sequence as described in claim 1. As such, claim 6 is rejected for the same reasons as those given for claim 1, above.
Regarding claim 7, as discussed above in the rejection of claims 1 and 6, the switch DNA methylase recognition sequence and type IIS restriction enzyme recognition sequence are recited to be the same, and is therefore anticipated for the same reasons outlined in the rejection of claim 6. Furthermore, claim 7 recites limitations involving active modification (“the base modified by the switch DNA methylase”). However, the claim is drawn only to the sequence, and the claim therefore broadly encompasses recited sequence. Claim 7 is therefore rejected for the reasons given for the rejection of claims 1 and 6.
Regarding claims 11-12, as discussed in the 112(b) rejection above, the exact structure of the nucleic acid being recited is unclear. For the purposes of this rejection, the two methylation-protectable restriction sequences recited in claim 1 are being interpreted to be the “opposing” restriction sequences, where the two sequences “oppose” each other. As such, claim 11 is rejected for the same reasons as claim 1. Additionally, claim 12 recites that the type IIS restriction elements are the same; this limitation is addressed in the rejection of claim 1, where two “GGTCTC” restriction sites are present within the E. coli genome.
Regarding claim 15, as discussed in the rejection of claim 1, DNA inserts exist within the E. coli genome of ‘096, as such GGGTCTC sequences are separated by stretches of DNA between the methylation-protectable restriction element and its opposing element, where such sequences are broadly interpreted as functional, as they are components of the architecture of the E. coli genome itself.
Regarding claim 16, the E. coli genome of ‘096 is reasonably interpreted to be a vector, as it is a nucleic acid sequence encoding genes as well as insertion sites to act as a recipient of other genetic material.
Regarding claims 21-22, the E. coli genome of ‘096 is naturally derived from a bacterial strain. Furthermore, as evidenced by New England Biolabs, E. coli naturally expresses Dcm methylases which can target the restriction sites (page 1 of New England Biolabs, and page 3, fifth row).
Regarding claim 23, E. coli naturally expresses Dcm methylases, which are DNA-binding proteins (New England Biolabs, page 1).
Regarding claim 46, as discussed above, E. coli naturally expresses a DNA methylase which recognizes the DNA methylase recognition sequence of (ii) (i.e., Dcm methylase, New England Biolabs, page 1). Furthermore, such a methylase is a sequence-specific binding protein (New England Biolabs, page 1). In addition, an E. coli naturally encodes sequence-specific DNA binding proteins such as transcription factors, as evidenced by Grainger (Introduction, first paragraph). Furthermore, recitation of “modified” does not add any structural significance to the claim since no specific modifications are claimed.
Regarding claim 48, as discussed above, E. coli naturally comprises the nucleic acids recited in claim 1, and encodes methylases/switch methylases such as Dcm as evidenced by New England Biolabs (page 1, first paragraph). Furthermore, as evidenced by Grainger, E. coli naturally encodes sequence-specific DNA binding proteins such as transcription factors (Introduction, first paragraph). Note that none of the elements (e.g., methylases, DNA-binding proteins) are recited with any specific structural or functional requirements in claim 48, and are merely required to be present. Thus, a naturally occurring E. coli cell reads on the presently recited limitations.
Regarding claim 49, each of these claim elements are addressed in the rejections of claim 1 and claim 46, where claim 49 is broadly drawn to a naturally occurring E. coli cell (a “modified” bacterial cell according to claim 46, see rejection above). Furthermore, as discussed in the rejection of claim 1, such a naturally occurring E. coli cells comprises the recited nucleic acid sequence within its genome (see rejection of claim 1), and further comprises sequence-specific DNA binding proteins such as transcription factors (Grainger, Introduction, first paragraph). Furthermore, as evidenced by New England Biolabs (page 1, first paragraph), the E. coli genome/vector itself is methylated by methylase enzymes such as Dcm. Furthermore, the sequence-specific DNA binding protein recited is not recited with a specific functionality because the binding protein recited in part A) of the claim is not recited with any association to the nucleic acid sequence or part (iii) of the claim (i.e., the presence of any DNA binding protein, such as a transcription factor, sufficiently reads on the claim).
Regarding claim 51, as discussed in the rejection of claim 1, the nucleic acid is housed within the E. coli genome, and therefore resides within a host cell (see rejection of claim 1, ‘096, which is an E. coli genome which is reasonably within an E. coli cell).
Regarding claim 56, as discussed above in the rejection of claim 1, ‘096 teaches the naturally occurring E. coli genome, which comprises a nucleic acid which reads on claim 1 (‘096, see rejection of claim 1). Furthermore, as evidenced by New England Biolabs, E. coli cells further naturally comprise Dcm methylases, a type of sequence specific DNA-binding protein, which binds to a sequence which overlaps with methylation recognition sequence (i.e., it binds with the methylation recognition sequence, New England Biolabs, page 1, first paragraph, page 3, row 5).
Regarding claim 58, as evidenced by New England Biolabs, E. coli naturally encodes a methylase (Dcm methylases) which recognizes DNA methylase recognition sequences (page 1, first paragraph, see rejection of claim 1). Furthermore, E. coli also naturally encodes sequence-specific DNA binding proteins such as transcription factors (see Grainger, Introduction, first paragraph). Thus, claim 58 reads on a naturally occurring E. coli cell, such as that taught by ‘096.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-7, 11-12, 15-16, 21-23, 46, 48-49, 51, 56, and 58 rejected under 35 U.S.C. 101 because the claimed invention is directed to a naturally occurring product of nature without significantly more. The rejection is evidenced by GenBank U00096 (‘096, GenBank Accession number U00096, published 11/15/2013, E. coli genome, of record), Nelles (Nelles DA et al. Bioessays. 2015 Jul;37(7):732-9), New England Biolabs (NEB Product brochure for restriction nucleases, published 2026), and Grainger (Grainger DC et al. Nucleic Acids Res. 2007;35(1):269-78).
Claim interpretation:
Claim 1 is drawn to a nucleic acid sequence comprising two methylation-protectable restriction elements which comprise a type IIS restriction site, a methylase recognition sequence which is overlapping and identical to the type IIS restriction site (i.e., the same site/sequence), and a recognition sequence for a DNA-binding protein which overlaps the methylase recognition sequence. Claim 1 further recites that the two methylation-protectable restriction elements are separated by a DNA sequence which comprises an identical restriction site as the methylation-protectable sequence, where the methylation-protectable sequences are not methylated but the sequence between the methylation-protectable sequence is methylated. The specification recites that GGTCTC, the BsaI recognition sequence, is one such methylation-protectable restriction element (page 5, second paragraph). Thus, claim 1 broadly reads on a nucleic acid comprising three such GGTCTC sequences, where two of such methylation-protectable sequences are methylated and encompass a third GGTCTC sequence which is not methylated, as the methylase sequence is recited to be identical to the methylation-protectable restriction element sequence. Furthermore, regarding the limitations of the recognition sequence of a DNA-binding protein, such claim limitations do not add specific structural significance to the nucleic acid of claim 1 because DNA-binding proteins such as Cas nucleases can be designed with guide nucleic acids to bind to any sequence, as evidenced by Nelles (Abstract).
Regarding the structure of the nucleic acid claimed in claim 1, this claim language reads on the naturally occurring genome of E. coli. For instance, as taught by ‘096, the E. coli genome naturally comprises instances of GGTCTC:
TCAGCCATTTAAGGTCTCCTTAGCGCCTTATTGCGTAAGACTGCCGGAACTTAAATTTGCCTTCGCACAT – Page 143/873, line 10
CGCCAGGTCTCCGGAACACCCTGCAATCCCGAGCCACCCAGCGTTGTAACGTGTCGTTTTCGCATCTGGA – page 143/873, line 17
CGCGCAAACGCTCTGCTGCCTGTTCTGCGGTCAGGTCTCGCTGGGTCTCTGCCAGCATTTCATAACCAAC – page 149/873, line 62
Furthermore, regarding the limitation that the type IIS restriction enzyme recognition sequence between the two methylation-protectable restriction elements is methylated whereas the methylation-protectable restriction elements are not methylated, it is known in the art that BsaI restriction sites GGTCTC are methylated by the Dcm methylase naturally in E. coli cells, where furthermore such methylases are naturally occurring in E. coli cells as evidenced by New England Biolabs, where furthermore such methylation of GGTCTC sites can “block” the activity of the restriction enzyme (page 1, first paragraph and page 3, row 5 of New England Biolabs). Thus, Dcm methylase-positive E. coli cells naturally methylate GGTCTC sites (New England BioLabs, page 3, row 5, and page 1, first paragraph). Given that the E. coli genome comprises multiple GGTCTC sites, and that Dcm methylase-positive strains of E. coli can methylate these sites rendering the sites resistant to BsaI restriction (page 1 of New England Biolabs, first paragraph and page 3, row 5), and furthermore that the E. coli genome is circular, the methylation of any single GGTCTC site within the E. coli genome necessarily reads on claim 1, as such a methylated site would be flanked by two GGTCTC sites, depending on how the circular genome is being viewed. Additionally, the methylases Dcm which occur in E. coli can be viewed as DNA-binding proteins, as such methylases necessarily bind with DNA in order to methylate DNA sites.
Additionally, note that New England Biolabs teaches that resident methylases such as Dcm methylate some restriction sites, they do not methylate all restriction sites, where such variations in methylation patterns can lead to variable digestion patterns (e.g., page 1 of New England Biolabs, paragraph 4). Thus, it is reasonable to conclude that, of the numerous GGTCTC sites within the bacterial genome, some are methylated while some are not, which would yield methylation patterns such as those presently recited (New England Biolabs, page 1, fourth paragraph, and all of section entitled “Prokaryotic Methylation”).
Thus, claim 1 is most broadly drawn to the genome of a naturally occurring Dcm methylase positive E. coli cell, and therefore recites a naturally occurring product of nature (Step 2A, prong 1 of Subject Matter Eligibility Test, MPEP 2106).
Claim 1 is only drawn to a nucleic acid sequence. Claim 1 therefore does not recite any additional limitations which integrate the judicial exception into a practical application, and furthermore does not recite additional elements which render markedly different characteristics unto the product or transform it to significantly more than the judicial exception (Steps 2A, prong 2 and 2B). Claim 1 is therefore not subject matter eligible.
Regarding claim 2, as discussed above, ‘096 teaches that the restriction site can be GGTCTC. Claim 2 does not recite additional elements which render it subject matter eligible.
Regarding claim 3, as discussed above, ‘096 inherently teaches the BsaI restriction site GGTCTC. Furthermore, the specification teaches that BsaI cuts with a 4 bp overhang (page 23, third paragraph). Claim 3 does not recite additional elements which render it subject matter eligible.
Regarding claims 4-5, claim 4 is directed to a nucleic acid sequence. As discussed above, Nelles teaches that DNA binding proteins such as Cas proteins can be engineered to bind to DNA sequences (Abstract). Thus, the nucleic acid sequence of the E. coli genome reads on claims 4-5, as no such binding protein is required in the claim (i.e., claims 4-5 are directed only to a nucleic acid sequence). With regards to the limitation in claim 5, that the RNA-guided DNA nuclease is deactivated, this does not affect the structure of the DNA sequence itself, and relates only to the properties of the endonuclease, where the claims are drawn not to the protein/nuclease itself but to a nucleic acid sequence. Claims 4-5 do not recite additional elements which render it subject matter eligible.
Regarding claim 6, as discussed in the above 112(b) rejection, the exact structure claimed in claim 6 is unclear. For the present rejection, claim 6 is being interpreted to simply comprise the restriction sequence as described in claim 1. As such, claim 6 is rejected for the same reasons as those given for claim 1, above.
Regarding claim 7, as discussed above in the rejection of claims 1 and 6, the switch DNA methylase recognition sequence and type IIS restriction enzyme recognition sequence are recited to be the same, and is therefore rejected for the same reasons outlined in the rejection of claim 6. Furthermore, claim 7 recites limitations involving active modification (“the base modified by the switch DNA methylase”). However, the claim is drawn only to the sequence, and the claim therefore broadly encompasses the recited sequence. Claim 7 is therefore rejected for the reasons given for the rejection of claims 1 and 6 and is not subject matter eligible.
Regarding claims 11-12, as discussed in the 112(b) rejection above, the exact structure of the nucleic acid being recited is unclear. For the purposes of this rejection, the two methylation-protectable restriction sequences recited in claim 1 are being interpreted to be the “opposing” restriction sequences, where the two sequences “oppose” each other. As such, claim 11 is rejected for the same reasons as claim 1. Additionally, claim 12 recites that the type IIS restriction elements are the same; this limitation is addressed in the rejection of claim 1, where two “GGTCTC” restriction sites are present within the E. coli genome. Thus, claims 11-12 are drawn to a naturally occurring product of nature without additional limitations required by the claims. The claims are therefore not subject matter eligible.
Regarding claim 15, as discussed in the rejection of claim 1, DNA inserts exist within the E. coli genome of ‘096, as such GGGTCTC sequences are separated by stretches of DNA between the methylation-protectable restriction element and its opposing element, where such sequences are broadly interpreted as functional, as they are components of the architecture of the E. coli genome itself (see ‘096 sequences discussed in rejection of claim 1, ‘096). Claim 15 is therefore drawn to a naturally occurring product of nature (i.e., the E. coli genome), without additional limitations to distinguish the judicial exception. Claim 15 is therefore not subject matter eligible.
Regarding claim 16, the E. coli genome of ‘096 is reasonably interpreted to be a vector, as it is a nucleic acid sequence encoding genes as well as insertion sites to act as a recipient of other genetic material. Thus, claim 16 is broadly drawn to a naturally occurring product of nature without additional limitations which render markedly different characteristics, or transform the claim into significantly more than the judicial exception. Claim 16 is therefore not subject matter eligible.
Regarding claims 21-22, the E. coli genome of ‘096 is naturally derived from a bacterial strain. Furthermore, as evidenced by New England Biolabs, E. coli naturally expresses Dcm methylases which can target the restriction sites (page 1 of New England Biolabs, and page 3, fifth row).
Regarding claim 23, E. coli naturally expresses Dcm methylases, which are DNA-binding proteins (New England Biolabs, page 1).
Regarding claim 46, as discussed above, E. coli naturally expresses a DNA methylase which recognizes the DNA methylase recognition sequence of (ii) (i.e., Dcm methylase, New England Biolabs, page 1). Furthermore, such a methylase is a sequence-specific binding protein (New England Biolabs, page 1). In addition, an E. coli naturally encodes sequence-specific DNA binding proteins such as transcription factors, as evidenced by Grainger (Introduction, first paragraph). Furthermore, recitation of “modified” does not add any structural significance to the claim since no specific modifications are claimed. Claim 46 does not recite additional elements, and is therefore directed a judicial exception, and is therefore not subject matter eligible.
Regarding claim 48, as discussed above, E. coli naturally comprises the nucleic acids recited in claim 1, and encodes methylases/switch methylases such as Dcm as evidenced by New England Biolabs (page 1, first paragraph). Furthermore, as evidenced by Grainger, E. coli naturally encodes sequence-specific DNA binding proteins such as transcription factors (Introduction, first paragraph). Note that none of the elements (e.g., methylases, DNA-binding proteins) are recited with any specific structural or functional requirements in claim 48, and are merely required to be present. Thus, a naturally occurring E. coli cell reads on the presently recited limitations. Claim 48 is therefore not subject matter eligible.
Regarding claim 49, each of these claim elements are addressed in the rejections of claim 1 and claim 46, where claim 49 is broadly drawn to a naturally occurring E. coli cell (a “modified” bacterial cell according to claim 46, see rejection above). Furthermore, as discussed in the rejection of claim 1, such a naturally occurring E. coli cells comprises the recited nucleic acid sequence within its genome (see rejection of claim 1), and further comprises sequence-specific DNA binding proteins such as transcription factors (Grainger, Introduction, first paragraph). Furthermore, as evidenced by New England Biolabs (page 1, first paragraph), the E. coli genome/vector itself is methylated by methylase enzymes such as Dcm. Furthermore, the sequence-specific DNA binding protein recited is not recited with a specific functionality because the binding protein recited in part A) of the claim is not recited with any association to the nucleic acid sequence or part (iii) of the claim (i.e., the presence of any DNA binding protein, such as a transcription factor, sufficiently reads on the claim). Thus, claim 49 is drawn to a naturally occurring E. coli cell.
Claim 49 recites the additional limitation of “kit,” however such a limitation does not add structural meaning to the claim, where the claim is simply drawn to any such arrangements of the recited elements, for instance, within a naturally occurring E. coli cell. Thus, claim 49 does not recite additional elements which render markedly different characteristics onto the subject matter or transform the claim into significantly more than the judicial exception. Claim 49 is therefore not subject matter eligible/
Regarding claim 51, as discussed in the rejection of claim 1, the nucleic acid is housed within the E. coli genome, and therefore resides within a host cell (see rejection of claim 1, ‘096, which is an E. coli genome which is reasonably within an E. coli cell). Claim 51 is therefore drawn to a naturally occurring product, namely, an E. coli cell. Claim 51 does not recite any additional elements which render markedly different characteristics or transform the claim into significantly more than the judicial exception. Claim 51 is therefore not subject matter eligible.
Regarding claim 56, as discussed above in the rejection of claim 1, ‘096 teaches the naturally occurring E. coli genome, which comprises a nucleic acid which reads on claim 1 (‘096, see rejection of claim 1). Furthermore, as evidenced by New England Biolabs, E. coli cells further naturally comprise Dcm methylases, a type of sequence specific DNA-binding protein, which binds to a sequence which overlaps with methylation recognition sequence (i.e., it binds with the methylation recognition sequence, New England Biolabs, page 1, first paragraph, page 3, row 5). Claim 56 is therefore drawn to a naturally occurring E. coli cell which comprises the nucleic acid sequence of claim 1 and expresses naturally occurring Dcm methylases (New England Biolabs, page 1, first paragraph and page 3, row 5). Claim 56 is therefore not subject matter eligible.
Regarding claim 58, as evidenced by New England Biolabs, E. coli naturally encodes a methylase (Dcm methylases) which recognizes DNA methylase recognition sequences (page 1, first paragraph, see rejection of claim 1). Furthermore, E. coli also naturally encodes sequence-specific DNA binding proteins such as transcription factors (see Grainger, Introduction, first paragraph). Thus, claim 58 reads on a naturally occurring E. coli cell, such as that taught by ‘096. Claim 58 is therefore drawn to a product of nature, where no additional elements are recited which render markedly different characteristics, integrate the claim into a practical application, or transform the claim into significantly more than the judicial exception. Claim 58 is therefore not subject matter eligible.
Response to Arguments
The Applicant’s arguments filed 11/24/2025 have been considered but are not persuasive. The Applicant argues that the recited subject matter is not a naturally occurring product of nature, as such methylation patterns do not naturally occur within E. coli. This argument is not persuasive, as BsaI sites is naturally methylated by naturally occurring Dcm methylases within E. coli, where furthermore New England Biolabs teaches that, while some restriction sites are methylated by Dcm, not all restriction sites are methylated (page 1, “Prokaryotic Methylation”). Therefore, the present methylation pattern recited in the claim appears to read on the naturally occurring E. coli genome within an E. coli cell, as some restriction sites would be methylated while others would not be (New England Biolabs, page 1, section entitled “Prokaryotic Methylation”). The Applicant appears to concede in the arguments that such methylation can be stochastic; the presence of any two GGTCTC sites within E. coli which are unmethylated therefore read on the claims, provided that even a single restriction GGTCTC site is methylated, as the E. coli genome is circular, and the methylated site would necessarily be flanked by unmethylated sites in such a case. Given the teachings of New England Biolabs surrounding the differential methylation patterns of restriction sites, such a methylation pattern as that recited reasonably exists within the E. coli genome.
In addressing applicants’ arguments that a further discussion focusing on methylation patterns within the E. coli genome was warranted, with additional references from the art, the Office is making the current rejection as a non-final office action. .
Furthermore, the Office has reconsidered the original restriction requirement and applicants’ argument and modified the restriction requirement as discussed above. .
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Prosecution Insights