Prosecution Insights
Last updated: April 19, 2026
Application No. 17/601,522

AIM2 INHIBITORS AND USES THEREOF

Non-Final OA §103
Filed
Oct 05, 2021
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITY OF MASSACHUSETTS
OA Round
3 (Non-Final)
43%
Grant Probability
Moderate
3-4
OA Rounds
4y 2m
To Grant
98%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allow Rate
19 granted / 44 resolved
-16.8% vs TC avg
Strong +54% interview lift
Without
With
+54.4%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
55 currently pending
Career history
99
Total Applications
across all art units

Statute-Specific Performance

§101
6.5%
-33.5% vs TC avg
§103
30.5%
-9.5% vs TC avg
§102
14.1%
-25.9% vs TC avg
§112
35.3%
-4.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 44 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's amendments and remarks filed on January 6, 2026 are acknowledged. Claims 12, 17, 19-20, and 23-35 have been canceled. Claims 1, 13, and 14 were amended. Claims 1-11, 13-16, 18, 21, and 22 are pending. Claims 16, 18, 21, and 22 are withdrawn. Claims 1-11 and 13-15 are examined on the merits herein. Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on January 6, 2026 has been entered. Priority This application claims priority to PCT/US20/28535 filed on April 16, 2020 which claims priority to U.S. provisional application 62/972,831, filed on February 11, 2020 and U.S. provisional application 62/835,861 filed on April 18, 2019. Withdrawn Objections In view of Applicant’s amendments and response, the objection to the specification is withdrawn. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-11 and 13-15 are rejected under 35 U.S.C. 103 as being unpatentable over Kerr et al. (WO 2020/154645; reference previously cited by the Examiner) in view of Bhanot et al. (WO 2011/156673; reference previously cited by the Examiner) and Hassler et al. (Nucleic Acids Research 2018; reference cited by Applicant). Regarding claims 1, 4, 5, 6, 7, 8, 9, 10, and 11, Kerr et al. teaches that despite the advances made in the development of nucleic acid therapeutics that are evident in recent clinical achievements, the field of gene therapy is still severely limited by unwanted adverse events in recipients triggered by the therapeutic nucleic acids, themselves [0014]. Accordingly, there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases [0015]. Further, Kerr et al. teaches pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder [0016]. Kerr et al. teaches that the human AIM2 protein is encoded by the AIM2 gene comprising nucleic acid sequence NM_004833.2 (SEQ ID NO: 600). Further, a gene silencing siRNA oligonucleotide duplexes targeted specifically to human AIM2 (NM_004833.2) can readily be used to knockdown AIM2 expression [00449]. Kerr et al. teaches nucleic acids containing known nucleotide analogs or modified backbone residues or linkages which include phosphorothioate and 2’-O-methyl ribonucleotides [0077]. Kerr et al. also teaches that oligonucleotides are chemically modified to alter and improve in vivo properties such as delivery, stability, life-time, folding, target specificity, as well as biological function and mechanism that directly correlates with therapeutic application [00173]. Kerr et al. SEQ ID NO: 600 (designated as Db) at positions 136 through 1529 has a 100% match to instant SEQ ID NO: 46 (designated as Qy) as shown in the alignment below. Query Match 100.0%; Score 1394; DB 1; Length 1558; Best Local Similarity 100.0%; Matches 1394; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGAAGTGTCAGAGTCTTTGTAGCTTTGAAAGTCACCTAGGTTATTTGGGCATGCTCTCCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 136 AGAAGTGTCAGAGTCTTTGTAGCTTTGAAAGTCACCTAGGTTATTTGGGCATGCTCTCCT 195 Qy 61 GAGTCCTCTGCTAGTTAAGCTCTCTGAAAAGAAGGTGGCAGACCCGGTTTGCTGATCGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 196 GAGTCCTCTGCTAGTTAAGCTCTCTGAAAAGAAGGTGGCAGACCCGGTTTGCTGATCGCC 255 Qy 121 CCAGGGATCAGGAGGCTGATCCCAAAGTTGTCAGATGGAGAGTAAATACAAGGAGATACT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 256 CCAGGGATCAGGAGGCTGATCCCAAAGTTGTCAGATGGAGAGTAAATACAAGGAGATACT 315 Qy 181 CTTGCTAACAGGCCTGGATAACATCACTGATGAGGAACTGGATAGGTTTAAGTTCTTTCT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 316 CTTGCTAACAGGCCTGGATAACATCACTGATGAGGAACTGGATAGGTTTAAGTTCTTTCT 375 Qy 241 TTCAGACGAGTTTAATATTGCCACAGGCAAACTACATACTGCAAACAGAATACAAGTAGC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 376 TTCAGACGAGTTTAATATTGCCACAGGCAAACTACATACTGCAAACAGAATACAAGTAGC 435 Qy 301 TACCTTGATGATTCAAAATGCTGGGGCGGTGTCTGCAGTGATGAAGACCATTCGTATTTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 436 TACCTTGATGATTCAAAATGCTGGGGCGGTGTCTGCAGTGATGAAGACCATTCGTATTTT 495 Qy 361 TCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 496 TCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGA 555 Qy 421 TAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 556 TAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGC 615 Qy 481 TGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 616 TGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCC 675 Qy 541 TCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 676 TCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTT 735 Qy 601 TCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 736 TCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGAC 795 Qy 661 CCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 796 CCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTT 855 Qy 721 TGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 856 TGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAAT 915 Qy 781 AGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTGTTAGA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 916 AGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTGTTAGA 975 Qy 841 TGCTGAATCTGACCAAAAGGTTAATGTCCCGCTGAACATTATCAGAAAAGCTGGTGAAAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 976 TGCTGAATCTGACCAAAAGGTTAATGTCCCGCTGAACATTATCAGAAAAGCTGGTGAAAC 1035 Qy 901 CCCGAAGATCAACACGCTTCAAACTCAGCCCCTTGGAACAATTGTGAATGGTTTGTTTGT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1036 CCCGAAGATCAACACGCTTCAAACTCAGCCCCTTGGAACAATTGTGAATGGTTTGTTTGT 1095 Qy 961 AGTCCAGAAGGTAACAGAAAAGAAGAAAAACATATTATTTGACCTAAGTGACAACACTGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1096 AGTCCAGAAGGTAACAGAAAAGAAGAAAAACATATTATTTGACCTAAGTGACAACACTGG 1155 Qy 1021 GAAAATGGAAGTACTGGGGGTTAGAAACGAGGACACAATGAAATGTAAGGAAGGAGATAA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1156 GAAAATGGAAGTACTGGGGGTTAGAAACGAGGACACAATGAAATGTAAGGAAGGAGATAA 1215 Qy 1081 GGTTCGACTTACATTCTTCACACTGTCAAAAAATGGAGAAAAACTACAGCTGACATCTGG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1216 GGTTCGACTTACATTCTTCACACTGTCAAAAAATGGAGAAAAACTACAGCTGACATCTGG 1275 Qy 1141 AGTTCATAGCACCATAAAGGTTATTAAGGCCAAAAAAAAAACATAGAGAAGTAAAAAGGA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1276 AGTTCATAGCACCATAAAGGTTATTAAGGCCAAAAAAAAAACATAGAGAAGTAAAAAGGA 1335 Qy 1201 CCAATTCAAGCCAACTGGTCTAAGCAGCATTTAATTGAAGAATATGTGATACAGCCTCTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1336 CCAATTCAAGCCAACTGGTCTAAGCAGCATTTAATTGAAGAATATGTGATACAGCCTCTT 1395 Qy 1261 CAATCAGATTGTAAGTTACCTGAAAGCTGCAGTTCACAGGCTCCTCTCTCCACCAAATTA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1396 CAATCAGATTGTAAGTTACCTGAAAGCTGCAGTTCACAGGCTCCTCTCTCCACCAAATTA 1455 Qy 1321 GGATAGAATAATTGCTGGATAAACAAATTCAGAATATCAACAGATGATCACAATAAACAT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1456 GGATAGAATAATTGCTGGATAAACAAATTCAGAATATCAACAGATGATCACAATAAACAT 1515 Qy 1381 CTGTTTCTCATTCA 1394 |||||||||||||| Db 1516 CTGTTTCTCATTCA 1529 Kerr et al. SEQ ID NO: 600 (designated as Db) at positions 497 through 515 has a match to positions 662 through 680 of instant SEQ ID NO: 48 (designated Qy) as shown in the alignment below. Query Match 95.0%; Score 19; DB 1; Length 1558; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGAAGTTGAATTATATGC 19 ||||||||||||||||||| Db 497 CAGAAGTTGAATTATATGC 515 Kerr et al. SEQ ID NO: 600 (designated as Db) at positions 851 through 867 has a match to positions 1034 through 1050 of instant SEQ ID NO: 48 (designated Qy) as shown in the alignment below. Query Match 94.4%; Score 17; DB 1; Length 1558; Best Local Similarity 100.0%; Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTCTTTGTAAAAGTTTT 17 ||||||||||||||||| Db 851 TTCTTTGTAAAAGTTTT 867 Regarding claim 2, Kerr et al. SEQ ID NO: 600 (designated as Db) has a match to positions 1 through 14 of instant SEQ ID NO: 29 (designated as Qy) as shown in the alignment below. Query Match 93.3%; Score 14; DB 1; Length 1558; Best Local Similarity 42.9%; Matches 6; Conservative 8; Mismatches 0; Indels 0; Gaps 0; Qy 1 UUUGUAAAAGUUUU 14 :::|:|||||:::: Db 854 TTTGTAAAAGTTTT 867 Kerr et al. SEQ ID NO: 600 (designated as Db) has a match to positions 1 through 14 of instant SEQ ID NO: 27 (designated as Qy) as shown in the alignment below. Query Match 93.3%; Score 14; DB 1; Length 1558; Best Local Similarity 57.1%; Matches 8; Conservative 6; Mismatches 0; Indels 0; Gaps 0; Qy 1 GUUGAAUUAUAUGC 14 |::|||::|:|:|| Db 502 GTTGAATTATATGC 515 Regarding claim 3, Kerr et al. SEQ ID NO: 600 (designated as Db) is complementary to positions 2 through 20 of instant SEQ ID NO: 30 (designated as Qy) as shown in the alignment below. Query Match 95.0%; Score 19; DB 1; Length 1558; Best Local Similarity 78.9%; Matches 15; Conservative 4; Mismatches 0; Indels 0; Gaps 0; Qy 2 AAAACUUUUACAAAGAAGA 20 |||||::::|||||||||| Db 867 AAAACTTTTACAAAGAAGA 849 Kerr et al. SEQ ID NO: 600 (designated as Db) is complementary to positions 2 through 20 of instant SEQ ID NO: 28 (designated as Qy) as shown in the alignment below. Query Match 95.0%; Score 19; DB 1; Length 1558; Best Local Similarity 63.2%; Matches 12; Conservative 7; Mismatches 0; Indels 0; Gaps 0; Qy 2 GCAUAUAAUUCAACUUCUG 20 |||:|:||::||||::|:| Db 515 GCATATAATTCAACTTCTG 497 Regarding claims 13 and 14, Kerr et al. teaches dendritic cells used in the production of a ceDNA vector for expression of an inhibitor of the immune response [00254]. Regarding claim 15, Kerr et al. teaches pharmaceutical compositions comprising one or more inhibitors of the immune response and a carrier [0022]. Further, the compositions wherein the inhibitor of AIM2 is an RNA inhibitor of AIM2 such as an siRNA specific for AIM2 or is encoded by the ceDNA [00449]. However, Kerr et al. does not teach a hydrophobically modified double stranded RNA molecule as recited in instant claim 1 wherein the sense strand comprises the sequence as recited in claim 2 and wherein the antisense strand comprises the sequence as recited in claim 3. Kerr et al. also does not teach the exact pattern of modifications of the sense strand and antisense strands of claims 4, 5, 7, 9, and 11. Bhanot et al. teaches antisense compounds useful for modulating gene expression and associated pathways via antisense mechanisms of action such as RNaseH, RNAi and dsRNA enzymes as well as other antisense mechanisms based on target degradation or target occupancy [page 4, second paragraph]. Bhanot et al. teaches that antisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of the transcript [page 3, second full paragraph]. Bhanot et al. teaches modified oligonucleotides consisting of 10 to 30 linked nucleobases [page 25, first paragraph]. Further, the antisense compound has a nucleobase sequence at least 90% complementarity as measured over the entirety of said antisense compound [claim 6]. Bhanot et al. also designed many modified oligonucleotides using the principles described throughout the disclosure (see for example Tables 2-7). Specifically, Bhanot et al. teaches antisense compounds comprising one or more nucleosides wherein the sugar group has been modified to impart enhanced nuclease stability, increased binding affinity, or other beneficial biological property to the antisense compound [page 33, second full paragraph]. Further, examples of nucleosides having modified sugar moieties include 2’-F [page 33, third full paragraph]. Bhanot et al. also teaches modified oligonucleotides in which one or more internucleoside linkages are modified wherein a modified linkage is a substitution of a naturally-occurring phosphodiester linkage [page 32, fifth full paragraph]. Because Bhanot et al. teaches that modified internucleoside linkages substitute a naturally-occurring phosphodiester linkage, and Bhanot et al. teaches modified oligonucleotides comprising one modified internucleoside linkage, Bhanot et al. inherently teaches modified oligonucleotides with at least one naturally-occurring phosphodiester linkage. Bhanot et al. also teaches modified antisense compounds comprising one or more stabilizing groups attached to one or both termini to enhance properties such as nuclease stability. Specifically, terminal modifications such as cap structures protect the antisense compound from exonuclease degradation and can help in delivery and/or localization within a cell [page 43, third paragraph]. Bhanot et al. demonstrated that modified oligonucleotides designed to many different locations in a target nucleic acid achieve target nucleic acid inhibition (see Tables 2-7). Further, Bhanot et al. demonstrated in Example 4 that modified oligonucleotides also function in vivo including in the relief of symptoms of a disease associated with the target molecule [pages 62-64]. Hassler et al. teaches that an asymmetric, cholesterol-modified siRNA was used to compare the impact of partially or fully modified scaffolds on conjugate-mediated distribution and silencing in vivo. The asymmetric design, termed hsiRNAs (15-nucleotide passenger strand with a 3’-conjugate and 20-nucleotide guide strand) lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading [page 2188, right column, last paragraph]. Figure 1A (reproduced below) is the chemical structure, modification pattern, and molecular model of partially (hsiRNA) and fully modified (FM-hsiRNA) hydrophobic siRNA [page 2187]. Hassler et al. also teaches that cholesterol conjugation to partially modified hsiRNAs results in robust cellular uptake in vitro and potent local silencing in vivo [page 2189, left column, first full paragraph] and chol-FM-hsiRNA showed significantly enhanced efficacy following passive uptake [page 2189, right column, first paragraph]. PNG media_image1.png 540 836 media_image1.png Greyscale Although Kerr et al. does not teach a double stranded RNA molecule, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a hydrophobically modified dsRNA according to claim 1 and arrive at the instantly recited SEQ ID NOS. using the design principles taught by Bhanot et al. and Hassler et al. because it would have amounted to applying known design principles for preparing antisense compounds, to a human AIM2 sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides because as evidenced by Bhanot et al. it was well within the purview of the skilled artisan, and routine in the art, to design, test, and identify modified oligonucleotides that effectively inhibit the target nucleic acid wherein the modified oligonucleotides consist of 10 to 30 linked nucleobases and the antisense compound has a nucleobase sequence at least 90% complementarity over the entirety of the antisense compound and as evidenced by Hassler et al. a fully modified hydrophobic siRNA lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading. One would have been motivated to modify the oligonucleotide of Kerr et al. using the design principles of Bhanot et al. and Hassler et al. to provide the oligonucleotide for the purposes of knocking down AIM2 expression because Kerr et al. taught that there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases and also taught pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder. Although Kerr et al. does not teach a double stranded RNA molecule or the specific modification pattern as recited in claims 4, 5, 7, 9, and 11, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a hydrophobically modified dsRNA and arrive at the instantly recited SEQ ID NOS. with the specific modification pattern using the design principles taught by Kerr et al., Bhanot et al., and Hassler et al. because it would have amounted to applying known design principles for preparing antisense compounds, to a human AIM2 sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides because as evidenced by Bhanot et al. it was well within the purview of the skilled artisan, and routine in the art, to design, test, and identify modified oligonucleotides that effectively inhibit the target nucleic acid wherein the modified oligonucleotides consist of 10 to 30 linked nucleobases and the antisense compound has a nucleobase sequence at least 90% complementarity over the entirety of the antisense compound and as evidenced by Hassler et al. a fully modified hydrophobic siRNA lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading and cholesterol conjugation of fully modified hydrophobic siRNA results in significantly enhanced efficacy. One would have been motivated to modify the oligonucleotide of Kerr et al. using the design principles of Bhanot et al. and Hassler et al. to provide the oligonucleotide for the purposes of knocking down AIM2 expression because Kerr et al. taught that there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases and also taught pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder. Response to Arguments Applicant's arguments filed January 6, 2026 have been fully considered to the extent that they might apply to the new ground of rejection set forth above but they are not persuasive. Applicant asserts the following: PNG media_image2.png 382 806 media_image2.png Greyscale PNG media_image3.png 412 794 media_image3.png Greyscale PNG media_image4.png 444 804 media_image4.png Greyscale These arguments are not found persuasive. Kerr et al. teaches that inhibition of the AIM2 mRNA can be by gene silencing RNAi molecules according to methods commonly known by a skilled artisan. For example, a gene silencing siRNA oligonucleotide duplex targeted specifically to human AIM2 (NM_004833.2) can readily be used to knockdown AIM2 expression. Further, AIM2 mRNA can be successfully targeted using siRNAs and other siRNA molecules may be readily prepared by those of skill in the art based on the known sequence of the target mRNA. Accordingly, in avoidance of any doubt, one of ordinary skill in the art can design nucleic acid inhibitors such as RNAi agents to the nucleic acid sequence of NM_004833.2 which is SEQ ID NO: 600 [00449]. Applicant's amendment necessitated the incorporation of the Hassler et al. reference presented in this Office action because Kerr et al. and Bhanot et al. did not teach a hydrophobically modified dsRNA molecule. Although Kerr et al. does not teach a double stranded RNA molecule, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a hydrophobically modified dsRNA according to claim 1 and arrive at the instantly recited SEQ ID NOS. using the design principles taught by Bhanot et al. and Hassler et al. because it would have amounted to applying known design principles for preparing antisense compounds, to a human AIM2 sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides because as evidenced by Bhanot et al. it was well within the purview of the skilled artisan, and routine in the art, to design, test, and identify modified oligonucleotides that effectively inhibit the target nucleic acid wherein the modified oligonucleotides consist of 10 to 30 linked nucleobases and the antisense compound has a nucleobase sequence at least 90% complementarity over the entirety of the antisense compound and as evidenced by Hassler et al. a fully modified hydrophobic siRNA lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading. One would have been motivated to modify the oligonucleotide of Kerr et al. using the design principles of Bhanot et al. and Hassler et al. to provide the oligonucleotide for the purposes of knocking down AIM2 expression because Kerr et al. taught that there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases and also taught pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder. Applicant asserts the following: PNG media_image5.png 266 796 media_image5.png Greyscale PNG media_image6.png 480 776 media_image6.png Greyscale These arguments are not found persuasive. Contrary to Applicant’s assertions that Kerr et al. is silent regarding a mouse AIM2 sequence, the mouse AIM2 sequence (instant SEQ ID NO: 48; designated as Db) and human AIM2 sequence (instant SEQ ID NO: 46; designated as Qy) are conserved and thus share levels of identity as shown in the alignment below. Query Match 35.5%; Score 494.2; DB 1; Length 2541; Best Local Similarity 65.9%; Matches 822; Conservative 0; Mismatches 393; Indels 32; Gaps 6; Qy 133 AGGCTGATCCCAAAGTTGTCAGATGGAGAGTAAATACAAGGAGATACTCTTGCTAACAGG 192 |||||||||| ||| ||||||||||| | ||| ||| || || ||| | || || Db 433 AGGCTGATCCTGGGACTGTGAGATGGAGAGTGAGTACCGGGAAATGCTGTTGTTGACCGG 492 Qy 193 CCTGGATAACATCACTGATGAGGAACTGGATAGGTTTAAGTTCTTTCTTTCAGACGAGTT 252 |||||| ||||||| || || |||||| | |||| |||| |||| || ||||| Db 493 CCTGGACCACATCACGGAGGAAGAACTGAAACGGTTCAAGTACTTTGCTTTGACTGAGTT 552 Qy 253 TAATATTGCCACAGGCAAACTACATACTGCAAACAGAATACAAGTAGCTACCTTGATGAT 312 | | ||||||| ||| ||| | ||| | || | | | ||||| | |||| Db 553 TCAGATTGCCAGGAGCACACTCGACGTGGCAGATAGGACAGAGTTAGCTGACCACCTGAT 612 Qy 313 TCAAAATGCTGGGGCGGTGTCTGCAGTGATGAAGACCATTCGTATTTTTCAGAAGTTGAA 372 ||||| ||| || |||| ||||||||||| ||| ||||| |||||| ||||||||||| Db 613 TCAAAGTGCAGGTGCGGCGTCTGCAGTGACCAAGGCCATTAATATTTTCCAGAAGTTGAA 672 Qy 373 TTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGATAAGCAATACAA 432 |||||||| | | ||||| |||| | ||| | ||| | ||| ||| || || Db 673 TTATATGCATATTGCAAATGCTCTTGAAGAGAAAAAGAAAGAAGCTGAACGTAAACTCAT 732 Qy 433 ATCGGTAACAAAACCAAAGCCA------------------CTAAGTCAAGCTGAAATGAG 474 | ||||| | | |||||||||||||| | Db 733 GACCAATACAAAGAAGAGAGGAACACAGAAGGTAGAAAATAGAAGTCAAGCTGAAAACTG 792 Qy 475 TCCTGCTGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGT 534 ||||||| ||||| || ||| | ||| | ||| ||| ||||| || |||| Db 793 CTCTGCTGCCTCTGCCACCCGCAGTGACAATGACTTTAAGGAACAGGCTGCTACAGAAGT 852 Qy 535 CTCTCCTCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGA 594 || |||||| | ||||||| | |||||||||||||||| | |||||| | |||||||| Db 853 CTGTCCTCAAGCTAAGCCTCAGAAGAAACAGATGGTGGCAGAACAGGAAGCCATCAGAGA 912 Qy 595 AGGGTTTCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTT 654 || || ||||| | || | ||| |||||||| | || ||||| || Db 913 AGATTTACAGAAAGATCCACTTGTTGTCACGGTGCTGAAAGCTATAAATCCCTTTGAGTG 972 Qy 655 TGAGACCCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATT 714 |||||| || ||||| | || ||||| |||||||| |||||||| || || | || || Db 973 TGAGACTCAGGAAGGAAGACAAGAGATATTTCATGCAACAGTGGCCACGGAGACAGATTT 1032 Qy 715 CTTCTTTGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAAT 774 ||||||||||||||||| || ||| | | ||||||||||| || |||||||| | ||| Db 1033 TTTCTTTGTAAAAGTTTTAAACGCACAGTTTAAAGATAAATTTATCCCAAAGAGGACAAT 1092 Qy 775 TATAATAGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGT 834 || |||| ||| || | |||||||| ||| | ||||| | || ||||| ||| Db 1093 TAAAATATCAAACTACCTTTGGCACAGTAACTTCATGGAGGTCACCAGTTCCTCAGTTGT 1152 Qy 835 GTTAGATGCTGAATCTGACCAAAAGGTTAATGTCCCGCTGAACATTATCAGAAAAGCTGG 894 | | |||| ||||||| |||| | ||||| ||| || | | | ||| | Db 1153 GGTTGATGTTGAATCTAACCA------CGAAGTCCCAAATAACGTTGTTAAGAGAGCCAG 1206 Qy 895 TGAAACCCCGAAGATCAACACGCTTCAAACTCAGCCCCTTGGAACAATTGTGAATGGTTT 954 ||||| || | ||| | | || | | |||||| |||||||||||||||||| | Db 1207 GGAAACTCCCAGGATTAGTAAACTGAAGATTCAGCCATGTGGAACAATTGTGAATGGGCT 1266 Qy 955 GTTTGTAGTCCAGAAGGTAACAGAAAAGAAGAAAAACATATTATTTGACCTAAGTGACAA 1014 |||| |||||||||| ||||||| | || | | || | | || || ||| || Db 1267 GTTTAAAGTCCAGAAGATAACAGAGGAAAAAGATAGAGTACTGTATGGTATACATGATAA 1326 Qy 1015 CACTGGGAAAATGGAAGTACTGGGGGTTAGAAACGAGGACACAATGAAATGTAAGGAAGG 1074 || |||| |||||| || ||| | | ||||| || || || || ||||||| Db 1327 AACAGGGACAATGGAGGTGTTGGTGCTGGGAAACCCAAGCAAAACAAAGTGCGAGGAAGG 1386 Qy 1075 AGATAAGGTTCGACTTACATTCTTCACACTGTCAAAAAATGGAGAAAAACTACAGCTGAC 1134 ||| ||| || |||| || ||||| ||||||||||||||| ||| | ||| ||| Db 1387 AGACAAGATTAGACTCACGTTCTTTGAGGTGTCAAAAAATGGAGTGAAAATTCAGTTGAA 1446 Qy 1135 ATCTGGAGTTCATAGCACCATAAAGGTTATTAAGGCCAAAAAAAAAACATAGAGAAGTAA 1194 ||||||| | |||| | |||||||||||||| ||| || | | || | | Db 1447 ATCTGGACCTTGTAGCTTTTTTAAGGTTATTAAGGCTGCAAAGCCAA-AAACTGACATGA 1505 Qy 1195 AAAGGACCAATTCAAGCCAACTGGTCTAAGCAGCATTTAATTGAAGAATATGTGATACAG 1254 |||| | | ||| || || | | | | | ||| |||||||| |||| | | Db 1506 AAAGTGTGGAGTGAAGTCACCTCATTTGAAAAACCTTTTCCTGAAGAAT-CCTGATGCTG 1564 Qy 1255 CCTCTTCAATCAGATTGTAAGTTACCTGAAAGCTGCAGTTCACAGGCTCCTC----TCTC 1310 | ||| || ||| || | ||||||| ||| || ||| ||| || | | Db 1565 CTCCTTGAACTAGACTG--AACTACCTGAGGATAGCATTTTACAACCTCATCATCATATT 1622 Qy 1311 CACCAAATTAGGATAGAATAATTGCTGGATAAACAAATTCAGAATAT 1357 | |||| | || | || | || | ||||| | | ||||| Db 1623 GTATTACTTAGAAAAGGACAAATACTCAAAAAACATCTGAAAAATAT 1669 In addition, for example, nucleotides 362-380 of SEQ ID NO: 46 (designated as Qy) has a match to nucleotides 662-681 of SEQ ID NO: 48 (designated as Db) as shown in the alignment below. Query Match 100.0%; Score 19; DB 1; Length 20; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGAAGTTGAATTATATGC 19 ||||||||||||||||||| Db 1 CAGAAGTTGAATTATATGC 19 Kerr et al. teaches that inhibition of the AIM2 mRNA can be by gene silencing RNAi molecules according to methods commonly known by a skilled artisan. For example, a gene silencing siRNA oligonucleotide duplex targeted specifically to human AIM2 (NM_004833.2) can readily be used to knockdown AIM2 expression. Further, AIM2 mRNA can be successfully targeted using siRNAs and other siRNA molecules may be readily prepared by those of skill in the art based on the known sequence of the target mRNA. Accordingly, in avoidance of any doubt, one of ordinary skill in the art can design nucleic acid inhibitors such as RNAi agents to the nucleic acid sequence of NM_004833.2 which is SEQ ID NO: 600 [00449]. Applicant further asserts: PNG media_image7.png 308 784 media_image7.png Greyscale PNG media_image8.png 160 784 media_image8.png Greyscale These arguments are not found persuasive. Kerr et al. teaches that an inhibitor of AIM2 is for example an antibody or antigen-binding fragment that binds AIM2 [00445], an anti-human ASC monoclonal antibody [00446], P202 [00447], a small molecule compound [00448], or a RNA inhibitor [00449]. Thus, Kerr et al. provides a suggestion to use an RNAi inhibitor of AIM2 and does not teach away nor disparage the use of an RNAi as an inhibitor of AIM2. Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Oct 05, 2021
Application Filed
Apr 10, 2025
Non-Final Rejection — §103
Jul 15, 2025
Response Filed
Oct 02, 2025
Final Rejection — §103
Jan 06, 2026
Request for Continued Examination
Jan 07, 2026
Response after Non-Final Action
Feb 17, 2026
Non-Final Rejection — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12584126
MICRORNA INHIBITORS FOR USE IN TREATING METABOLIC DISEASES
2y 5m to grant Granted Mar 24, 2026
Patent 12570707
CODON-OPTIMISED COMPLEMENT FACTOR I
2y 5m to grant Granted Mar 10, 2026
Patent 12545893
RECOMBINANT NERVOUS SYSTEM CELLS AND METHODS TO GENERATE THEM
2y 5m to grant Granted Feb 10, 2026
Patent 12529057
THERAPEUTICS FOR SYNGAP HAPLOINSUFFICIENCY
2y 5m to grant Granted Jan 20, 2026
Patent 12522818
METHOD FOR INDUCING DELETION IN GENOMIC DNA
2y 5m to grant Granted Jan 13, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
43%
Grant Probability
98%
With Interview (+54.4%)
4y 2m
Median Time to Grant
High
PTA Risk
Based on 44 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month