Prosecution Insights
Last updated: October 02, 2026
Application No. 17/601,522

AIM2 INHIBITORS AND USES THEREOF

Final Rejection §103
Filed
Oct 05, 2021
Priority
Apr 18, 2019 — provisional 62/835,861 +3 more
Examiner
TRAN, CHRISTINA L
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Massachusetts
OA Round
4 (Final)
52%
Grant Probability
Moderate
5-6
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
32 granted / 62 resolved
-8.4% vs TC avg
Strong +48% interview lift
Without
With
+48.2%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
54 currently pending
Career history
114
Total Applications
across all art units

Statute-Specific Performance

§101
5.4%
-34.6% vs TC avg
§103
35.0%
-5.0% vs TC avg
§102
11.8%
-28.2% vs TC avg
§112
34.9%
-5.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 62 resolved cases

Office Action

§103
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Applicant's amendments and remarks filed on July 20, 2026 are acknowledged. Claims 12, 17, 19-20, and 23-35 have been canceled. Claims 1-11, 13-16, 18, 21, 22, and 36-39 are pending. Claims 16, 18, 21, and 22 are withdrawn. Claims 1-11, 13-15, and 36-39 are examined on the merits herein. Priority This application claims priority to PCT/US20/28535 filed on April 16, 2020 which claims priority to U.S. provisional application 62/972,831, filed on February 11, 2020 and U.S. provisional application 62/835,861 filed on April 18, 2019. Claim Objections Claim 36 is objected to because of the following informality: There are two (2) instances of part “(ii)” in claim 36. Appropriate correction is required. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-11, 13-15, and 36-39 are rejected under 35 U.S.C. 103 as being unpatentable over Kerr et al. (WO 2020/154645; reference previously cited by the Examiner) in view of Bhanot et al. (WO 2011/156673; reference previously cited by the Examiner) and Hassler et al. (Nucleic Acids Research 2018; reference cited by Applicant). Regarding claims 1, 4, 5, 6, 7, 8, 9, 10, 11, 36, Kerr et al. teaches that despite the advances made in the development of nucleic acid therapeutics that are evident in recent clinical achievements, the field of gene therapy is still severely limited by unwanted adverse events in recipients triggered by the therapeutic nucleic acids, themselves [0014]. Accordingly, there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases [0015]. Further, Kerr et al. teaches pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder [0016]. Kerr et al. teaches that the human AIM2 protein is encoded by the AIM2 gene comprising nucleic acid sequence NM_004833.2 (SEQ ID NO: 600). Further, a gene silencing siRNA oligonucleotide duplex targeted specifically to human AIM2 (NM_004833.2) can readily be used to knockdown AIM2 expression [00449]. Kerr et al. teaches nucleic acids containing known nucleotide analogs or modified backbone residues or linkages which include phosphorothioate and 2’-O-methyl ribonucleotides [0077]. Kerr et al. also teaches that oligonucleotides are chemically modified to alter and improve in vivo properties such as delivery, stability, life-time, folding, target specificity, as well as biological function and mechanism that directly correlates with therapeutic application [00173]. Kerr et al. SEQ ID NO: 600 (designated as Db) at positions 136 through 1529 has a 100% match to instant SEQ ID NO: 46 (designated as Qy) as shown in the alignment below. Query Match 100.0%; Score 1394; DB 1; Length 1558; Best Local Similarity 100.0%; Matches 1394; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AGAAGTGTCAGAGTCTTTGTAGCTTTGAAAGTCACCTAGGTTATTTGGGCATGCTCTCCT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 136 AGAAGTGTCAGAGTCTTTGTAGCTTTGAAAGTCACCTAGGTTATTTGGGCATGCTCTCCT 195 Qy 61 GAGTCCTCTGCTAGTTAAGCTCTCTGAAAAGAAGGTGGCAGACCCGGTTTGCTGATCGCC 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 196 GAGTCCTCTGCTAGTTAAGCTCTCTGAAAAGAAGGTGGCAGACCCGGTTTGCTGATCGCC 255 Qy 121 CCAGGGATCAGGAGGCTGATCCCAAAGTTGTCAGATGGAGAGTAAATACAAGGAGATACT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 256 CCAGGGATCAGGAGGCTGATCCCAAAGTTGTCAGATGGAGAGTAAATACAAGGAGATACT 315 Qy 181 CTTGCTAACAGGCCTGGATAACATCACTGATGAGGAACTGGATAGGTTTAAGTTCTTTCT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 316 CTTGCTAACAGGCCTGGATAACATCACTGATGAGGAACTGGATAGGTTTAAGTTCTTTCT 375 Qy 241 TTCAGACGAGTTTAATATTGCCACAGGCAAACTACATACTGCAAACAGAATACAAGTAGC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 376 TTCAGACGAGTTTAATATTGCCACAGGCAAACTACATACTGCAAACAGAATACAAGTAGC 435 Qy 301 TACCTTGATGATTCAAAATGCTGGGGCGGTGTCTGCAGTGATGAAGACCATTCGTATTTT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 436 TACCTTGATGATTCAAAATGCTGGGGCGGTGTCTGCAGTGATGAAGACCATTCGTATTTT 495 Qy 361 TCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 496 TCAGAAGTTGAATTATATGCTTTTGGCAAAACGTCTTCAGGAGGAGAAGGAGAAAGTTGA 555 Qy 421 TAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 556 TAAGCAATACAAATCGGTAACAAAACCAAAGCCACTAAGTCAAGCTGAAATGAGTCCTGC 615 Qy 481 TGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 616 TGCATCTGCAGCCATCAGAAATGATGTCGCAAAGCAACGTGCTGCACCAAAAGTCTCTCC 675 Qy 541 TCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 676 TCATGTTAAGCCTGAACAGAAACAGATGGTGGCCCAGCAGGAATCTATCAGAGAAGGGTT 735 Qy 601 TCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 736 TCAGAAGCGCTGTTTGCCAGTTATGGTACTGAAAGCAAAGAAGCCCTTCACGTTTGAGAC 795 Qy 661 CCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 796 CCAAGAAGGCAAGCAGGAGATGTTTCATGCTACAGTGGCTACAGAAAAGGAATTCTTCTT 855 Qy 721 TGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAAT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 856 TGTAAAAGTTTTTAATACACTGCTGAAAGATAAATTCATTCCAAAGAGAATAATTATAAT 915 Qy 781 AGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTGTTAGA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 916 AGCAAGATATTATCGGCACAGTGGTTTCTTAGAGGTAAATAGCGCCTCACGTGTGTTAGA 975 Qy 841 TGCTGAATCTGACCAAAAGGTTAATGTCCCGCTGAACATTATCAGAAAAGCTGGTGAAAC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 976 TGCTGAATCTGACCAAAAGGTTAATGTCCCGCTGAACATTATCAGAAAAGCTGGTGAAAC 1035 Qy 901 CCCGAAGATCAACACGCTTCAAACTCAGCCCCTTGGAACAATTGTGAATGGTTTGTTTGT 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1036 CCCGAAGATCAACACGCTTCAAACTCAGCCCCTTGGAACAATTGTGAATGGTTTGTTTGT 1095 Qy 961 AGTCCAGAAGGTAACAGAAAAGAAGAAAAACATATTATTTGACCTAAGTGACAACACTGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1096 AGTCCAGAAGGTAACAGAAAAGAAGAAAAACATATTATTTGACCTAAGTGACAACACTGG 1155 Qy 1021 GAAAATGGAAGTACTGGGGGTTAGAAACGAGGACACAATGAAATGTAAGGAAGGAGATAA 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1156 GAAAATGGAAGTACTGGGGGTTAGAAACGAGGACACAATGAAATGTAAGGAAGGAGATAA 1215 Qy 1081 GGTTCGACTTACATTCTTCACACTGTCAAAAAATGGAGAAAAACTACAGCTGACATCTGG 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1216 GGTTCGACTTACATTCTTCACACTGTCAAAAAATGGAGAAAAACTACAGCTGACATCTGG 1275 Qy 1141 AGTTCATAGCACCATAAAGGTTATTAAGGCCAAAAAAAAAACATAGAGAAGTAAAAAGGA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1276 AGTTCATAGCACCATAAAGGTTATTAAGGCCAAAAAAAAAACATAGAGAAGTAAAAAGGA 1335 Qy 1201 CCAATTCAAGCCAACTGGTCTAAGCAGCATTTAATTGAAGAATATGTGATACAGCCTCTT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1336 CCAATTCAAGCCAACTGGTCTAAGCAGCATTTAATTGAAGAATATGTGATACAGCCTCTT 1395 Qy 1261 CAATCAGATTGTAAGTTACCTGAAAGCTGCAGTTCACAGGCTCCTCTCTCCACCAAATTA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1396 CAATCAGATTGTAAGTTACCTGAAAGCTGCAGTTCACAGGCTCCTCTCTCCACCAAATTA 1455 Qy 1321 GGATAGAATAATTGCTGGATAAACAAATTCAGAATATCAACAGATGATCACAATAAACAT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1456 GGATAGAATAATTGCTGGATAAACAAATTCAGAATATCAACAGATGATCACAATAAACAT 1515 Qy 1381 CTGTTTCTCATTCA 1394 |||||||||||||| Db 1516 CTGTTTCTCATTCA 1529 Kerr et al. SEQ ID NO: 600 (designated as Db) at positions 497 through 515 has a match to positions 662 through 680 of instant SEQ ID NO: 48 (designated Qy) as shown in the alignment below. Query Match 95.0%; Score 19; DB 1; Length 1558; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CAGAAGTTGAATTATATGC 19 ||||||||||||||||||| Db 497 CAGAAGTTGAATTATATGC 515 Kerr et al. SEQ ID NO: 600 (designated as Db) at positions 851 through 867 has a match to positions 1034 through 1050 of instant SEQ ID NO: 48 (designated Qy) as shown in the alignment below. Query Match 94.4%; Score 17; DB 1; Length 1558; Best Local Similarity 100.0%; Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTCTTTGTAAAAGTTTT 17 ||||||||||||||||| Db 851 TTCTTTGTAAAAGTTTT 867 Regarding claim 2, Kerr et al. SEQ ID NO: 600 (designated as Db) has a match to positions 1 through 14 of instant SEQ ID NO: 29 (designated as Qy) as shown in the alignment below. Query Match 93.3%; Score 14; DB 1; Length 1558; Best Local Similarity 42.9%; Matches 6; Conservative 8; Mismatches 0; Indels 0; Gaps 0; Qy 1 UUUGUAAAAGUUUU 14 :::|:|||||:::: Db 854 TTTGTAAAAGTTTT 867 Kerr et al. SEQ ID NO: 600 (designated as Db) has a match to positions 1 through 14 of instant SEQ ID NO: 27 (designated as Qy) as shown in the alignment below. Query Match 93.3%; Score 14; DB 1; Length 1558; Best Local Similarity 57.1%; Matches 8; Conservative 6; Mismatches 0; Indels 0; Gaps 0; Qy 1 GUUGAAUUAUAUGC 14 |::|||::|:|:|| Db 502 GTTGAATTATATGC 515 Regarding claim 3, Kerr et al. SEQ ID NO: 600 (designated as Db) is complementary to positions 2 through 20 of instant SEQ ID NO: 30 (designated as Qy) as shown in the alignment below. Query Match 95.0%; Score 19; DB 1; Length 1558; Best Local Similarity 78.9%; Matches 15; Conservative 4; Mismatches 0; Indels 0; Gaps 0; Qy 2 AAAACUUUUACAAAGAAGA 20 |||||::::|||||||||| Db 867 AAAACTTTTACAAAGAAGA 849 Kerr et al. SEQ ID NO: 600 (designated as Db) is complementary to positions 2 through 20 of instant SEQ ID NO: 28 (designated as Qy) as shown in the alignment below. Query Match 95.0%; Score 19; DB 1; Length 1558; Best Local Similarity 63.2%; Matches 12; Conservative 7; Mismatches 0; Indels 0; Gaps 0; Qy 2 GCAUAUAAUUCAACUUCUG 20 |||:|:||::||||::|:| Db 515 GCATATAATTCAACTTCTG 497 Regarding claims 13, 14, 37, and 38, Kerr et al. teaches dendritic cells used in the production of a ceDNA vector for expression of an inhibitor of the immune response [00254]. Regarding claims 15 and 39, Kerr et al. teaches pharmaceutical compositions comprising one or more inhibitors of the immune response and a carrier [0022]. Further, the compositions wherein the inhibitor of AIM2 is an RNA inhibitor of AIM2 such as an siRNA specific for AIM2 or is encoded by the ceDNA [00449]. However, Kerr et al. does not teach a hydrophobically modified double stranded RNA molecule as recited in instant claims 1 and 36 wherein the sense strand comprises the sequence as recited in claim 2 and wherein the antisense strand comprises the sequence as recited in claim 3. Kerr et al. also does not teach the exact pattern of modifications of the sense strand and antisense strands of claims 4, 5, 7, 9, 11, and 36. Bhanot et al. teaches antisense compounds useful for modulating gene expression and associated pathways via antisense mechanisms of action such as RNaseH, RNAi and dsRNA enzymes as well as other antisense mechanisms based on target degradation or target occupancy [page 4, second paragraph]. Bhanot et al. teaches that antisense technology is emerging as an effective means for reducing the expression of certain gene products and may therefore prove to be uniquely useful in a number of therapeutic, diagnostic, and research applications for the modulation of the transcript [page 3, second full paragraph]. Bhanot et al. teaches modified oligonucleotides consisting of 10 to 30 linked nucleobases [page 25, first paragraph]. Further, the antisense compound has a nucleobase sequence at least 90% complementarity as measured over the entirety of said antisense compound [claim 6]. Bhanot et al. also designed many modified oligonucleotides using the principles described throughout the disclosure (see for example Tables 2-7). Specifically, Bhanot et al. teaches antisense compounds comprising one or more nucleosides wherein the sugar group has been modified to impart enhanced nuclease stability, increased binding affinity, or other beneficial biological property to the antisense compound [page 33, second full paragraph]. Further, examples of nucleosides having modified sugar moieties include 2’-F [page 33, third full paragraph]. Bhanot et al. also teaches modified oligonucleotides in which one or more internucleoside linkages are modified wherein a modified linkage is a substitution of a naturally-occurring phosphodiester linkage [page 32, fifth full paragraph]. Because Bhanot et al. teaches that modified internucleoside linkages substitute a naturally-occurring phosphodiester linkage, and Bhanot et al. teaches modified oligonucleotides comprising one modified internucleoside linkage, Bhanot et al. inherently teaches modified oligonucleotides with at least one naturally-occurring phosphodiester linkage. Bhanot et al. also teaches modified antisense compounds comprising one or more stabilizing groups attached to one or both termini to enhance properties such as nuclease stability. Specifically, terminal modifications such as cap structures protect the antisense compound from exonuclease degradation and can help in delivery and/or localization within a cell [page 43, third paragraph]. Bhanot et al. demonstrated that modified oligonucleotides designed to many different locations in a target nucleic acid achieve target nucleic acid inhibition (see Tables 2-7). Further, Bhanot et al. demonstrated in Example 4 that modified oligonucleotides also function in vivo including in the relief of symptoms of a disease associated with the target molecule [pages 62-64]. Hassler et al. teaches that an asymmetric, cholesterol-modified siRNA was used to compare the impact of partially or fully modified scaffolds on conjugate-mediated distribution and silencing in vivo. The asymmetric design, termed hsiRNAs (15-nucleotide passenger strand with a 3’-conjugate and 20-nucleotide guide strand) lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading [page 2188, right column, last paragraph]. Figure 1A (reproduced below) is the chemical structure, modification pattern, and molecular model of partially (hsiRNA) and fully modified (FM-hsiRNA) hydrophobic siRNA [page 2187]. Hassler et al. also teaches that cholesterol conjugation to partially modified hsiRNAs results in robust cellular uptake in vitro and potent local silencing in vivo [page 2189, left column, first full paragraph] and chol-FM-hsiRNA showed significantly enhanced efficacy following passive uptake [page 2189, right column, first paragraph]. PNG media_image1.png 540 836 media_image1.png Greyscale Although Kerr et al. does not teach a double stranded RNA molecule, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a hydrophobically modified dsRNA according to claims 1 and 36 and arrive at the instantly recited SEQ ID NOS. using the design principles taught by Bhanot et al. and Hassler et al. because it would have amounted to applying known design principles for preparing antisense compounds, to a human AIM2 sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides because as evidenced by Bhanot et al. it was well within the purview of the skilled artisan, and routine in the art, to design, test, and identify modified oligonucleotides that effectively inhibit the target nucleic acid wherein the modified oligonucleotides consist of 10 to 30 linked nucleobases and the antisense compound has a nucleobase sequence at least 90% complementarity over the entirety of the antisense compound and as evidenced by Hassler et al. a fully modified hydrophobic siRNA lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading. One would have been motivated to modify the oligonucleotide of Kerr et al. using the design principles of Bhanot et al. and Hassler et al. to provide the oligonucleotide for the purposes of knocking down AIM2 expression because Kerr et al. taught that there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases and also taught pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder. Although Kerr et al. does not teach a double stranded RNA molecule or the specific modification pattern as recited in claims 4, 5, 7, 9, 11, and 36, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a hydrophobically modified dsRNA and arrive at the instantly recited SEQ ID NOS. with the specific modification pattern using the design principles taught by Kerr et al., Bhanot et al., and Hassler et al. because it would have amounted to applying known design principles for preparing antisense compounds, to a human AIM2 sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides because as evidenced by Bhanot et al. it was well within the purview of the skilled artisan, and routine in the art, to design, test, and identify modified oligonucleotides that effectively inhibit the target nucleic acid wherein the modified oligonucleotides consist of 10 to 30 linked nucleobases and the antisense compound has a nucleobase sequence at least 90% complementarity over the entirety of the antisense compound and as evidenced by Hassler et al. a fully modified hydrophobic siRNA lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading and cholesterol conjugation of fully modified hydrophobic siRNA results in significantly enhanced efficacy. One would have been motivated to modify the oligonucleotide of Kerr et al. using the design principles of Bhanot et al. and Hassler et al. to provide the oligonucleotide for the purposes of knocking down AIM2 expression because Kerr et al. taught that there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases and also taught pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder. Response to Arguments Applicant's arguments filed July 20, 2026 have been fully considered but they are not persuasive. Applicant asserts the following: PNG media_image2.png 244 802 media_image2.png Greyscale PNG media_image3.png 132 792 media_image3.png Greyscale PNG media_image4.png 510 794 media_image4.png Greyscale These arguments are not found persuasive. Kerr et al. teaches that inhibition of the AIM2 mRNA can be by gene silencing RNAi molecules according to methods commonly known by a skilled artisan. For example, a gene silencing siRNA oligonucleotide duplex targeted specifically to human AIM2 (NM_004833.2) can readily be used to knockdown AIM2 expression. Further, AIM2 mRNA can be successfully targeted using siRNAs and other siRNA molecules may be readily prepared by those of skill in the art based on the known sequence of the target mRNA. Accordingly, in avoidance of any doubt, one of ordinary skill in the art can design nucleic acid inhibitors such as RNAi agents to the nucleic acid sequence of NM_004833.2 which is SEQ ID NO: 600 [00449]. Although Kerr et al. does not teach a double stranded RNA molecule, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to design a hydrophobically modified dsRNA according to claims 1 and 36 and arrive at the instantly recited SEQ ID NOS. using the design principles taught by Bhanot et al. and Hassler et al. because it would have amounted to applying known design principles for preparing antisense compounds, to a human AIM2 sequence, by known means to yield predictable results. The skilled artisan would have had a reasonable expectation of success in preparing the modified oligonucleotides because as evidenced by Bhanot et al. it was well within the purview of the skilled artisan, and routine in the art, to design, test, and identify modified oligonucleotides that effectively inhibit the target nucleic acid wherein the modified oligonucleotides consist of 10 to 30 linked nucleobases and the antisense compound has a nucleobase sequence at least 90% complementarity over the entirety of the antisense compound and as evidenced by Hassler et al. a fully modified hydrophobic siRNA lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading. One would have been motivated to modify the oligonucleotide of Kerr et al. using the design principles of Bhanot et al. and Hassler et al. to provide the oligonucleotide for the purposes of knocking down AIM2 expression because Kerr et al. taught that there is a need in the field for a new technology that inhibits (e.g., reduces, ameliorates, mitigates, prevents) the immune response on administration of vectors or nucleic acid to a subject that permits expression of a therapeutic protein in a cell, tissue or subject capable of treatment of a wide variety of diseases and also taught pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder. In addition, NM_004833.2 is a 1,558 base pair sequence and thus there are a finite number of sequences. Therefore, contrary to Applicant's assertions, it would not be considered undue experimentation to design an RNAi agent to the nucleic acid sequence of NM_004833.2. Further, the amount of experimentation needed is not related to the predictability of designing RNAi agents nor is it related to whether or not there is a reasonable expectation of success. PNG media_image5.png 376 776 media_image5.png Greyscale This argument is not found persuasive. The Bhanot et al. and Hassler et al. references were used in combination with Kerr et al. to render obvious the limitations of the instant claims because Kerr et al. does not teach a hydrophobically modified double stranded RNA molecule as recited in instant claims 1 and 36 wherein the sense strand comprises the sequence as recited in claim 2 and wherein the antisense strand comprises the sequence as recited in claim 3. In addition, Kerr et al. does not teach the exact pattern of modifications of the sense strand and antisense strands of claims 4, 5, 7, 9, 11, and 36. Applicant points to FIG. 16 and paragraph [0181] where twelve hydrophobically modified double stranded RNA molecules were prepared and three of the twelve AIM2 siRNAs showed significant AIM2 gene suppression. Applicant also points to FIG. 14A which shows the quantitative RT-PCR analysis of the AIM2 mRNA expression in mock or AIM2 siRNA-transfected WT BMDCs 3 days after transfection. PNG media_image6.png 374 788 media_image6.png Greyscale PNG media_image7.png 100 776 media_image7.png Greyscale These arguments are not found persuasive. Kerr et al. taught pharmaceutical compositions comprising an inhibitor of the AIM2 inflammasome pathway for inhibiting (i.e., reducing or suppressing) an immune response in a subject suffering from a genetic disorder. Kerr et al. also taught that the human AIM2 protein is encoded by the AIM2 gene comprising nucleic acid sequence NM_004833.2 and a gene silencing siRNA oligonucleotide duplex targeted specifically to human AIM2 (NM_004833.2) can readily be used to knockdown AIM2 expression. Bhanot et al. taught design principles of antisense oligonucleotides to effectively inhibit the target nucleic acid and Hassler et al. taught that a fully modified hydrophobic siRNA lowers the melting temperature of the double-strand region, to facilitate the dissociation of the non-cleavable modified guide strand from the RISC during loading. In addition, Reynolds et al. (Nature Biotechnology 2004) taught that the average probability of selecting an F50 siRNA or F80 siRNA through random selection is 46.5% and 16.3%, respectively in a screen of duplexes targeting the complete mRNA of six different genes [page 327, right column, last paragraph]. Therefore, based on the teachings of the prior art, one of ordinary skill in the art would have had a reasonable expectation of success in suppressing AIM2 gene expression. Further, a POSA would not expect every dsRNA to “significantly” suppress gene expression or a near 100% success rate as Applicant asserts. As evidenced by Reynolds et al., the prior art illustrates that many siRNAs designed to target a gene of interest achieve the levels of knockdown achieved by Applicant. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTINA TRAN whose telephone number is (571)270-0550. The examiner can normally be reached M-F 7:30 - 5:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.T./ Examiner, Art Unit 1637 /Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Show 1 earlier event
Apr 15, 2025
Non-Final Rejection mailed — §103
Jul 15, 2025
Response Filed
Oct 10, 2025
Final Rejection mailed — §103
Jan 06, 2026
Request for Continued Examination
Jan 07, 2026
Response after Non-Final Action
Feb 24, 2026
Non-Final Rejection mailed — §103
Jul 20, 2026
Response Filed
Aug 25, 2026
Final Rejection mailed — §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12747438
COMPOSITIONS AND METHODS FOR REPROGRAMMING AGE-RESTRICTED NON-NEURONAL CELLS
4y 5m to grant Granted Sep 29, 2026
Patent 12721858
DOUBLE-STRANDED OLIGONUCLEOTIDE TARGETING DKK1 GENE, CONSTRUCT INCLUDING SAME, AND HAIR LOSS PREVENTION OR HAIR GROWTH COMPOSITION CONTAINING SAME
5y 1m to grant Granted Sep 01, 2026
Patent 12723247
METHODS FOR INHIBITION OF HAO1 (HYDROXYACID OXIDASE 1 (GLYCOLATE OXIDASE)) GENE EXPRESSION
4y 7m to grant Granted Sep 01, 2026
Patent 12649004
HIGHLY EFFICIENT TRANSDUCTION AND LATERAL SPREAD IN THE RETINA BY A NOVEL AAV VIRUS ENHANCED BY RATIONAL DESIGN
4y 10m to grant Granted Jun 09, 2026
Patent 12624362
MUTANT REVERSE TETRACYCLINE TRANSACTIVATORS FOR EXPRESSION OF GENES
5y 1m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

5-6
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+48.2%)
3y 11m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 62 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month