Prosecution Insights
Last updated: May 29, 2026
Application No. 17/601,934

HYBRID PROMOTERS FOR MUSCLE EXPRESSION

Final Rejection §103§112§DOUBLEPATENT§DP
Filed
Oct 07, 2021
Priority
Apr 08, 2019 — EU 19305455.8 +1 more
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
UNIVERSITE D'EVRY VAL D'ESSONNE
OA Round
3 (Final)
71%
Grant Probability
Favorable
4-5
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
42 granted / 59 resolved
+11.2% vs TC avg
Strong +38% interview lift
Without
With
+37.8%
Interview Lift
resolved cases with interview
Typical timeline
2y 10m
Avg Prosecution
40 currently pending
Career history
112
Total Applications
across all art units

Statute-Specific Performance

§101
5.0%
-35.0% vs TC avg
§103
49.6%
+9.6% vs TC avg
§102
3.1%
-36.9% vs TC avg
§112
15.5%
-24.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 59 resolved cases

Office Action

§103 §112 §DOUBLEPATENT §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant's election without traverse of group I and species: Group A: a plurality of liver-selective enhancers having the same sequence, SEQ ID NO: 1 (i.e. HS-CRM8), Group B: 3 liver-selective enhancers (HS-CRM8, SEQ ID NO: 1), and Group C: CK6 promoter (SEQ ID NO: 6) in the reply filed on 4/7/2025 was previously acknowledged. Applicants have since cancelled the limitation in Group B requiring a plurality of liver-selective enhancers having the same sequence, SEQ ID NO: 1 (i.e. HS-CRM8). However, the preamble still maintains a plurality of liver-selective enhancers. Therefore, the nucleic acid molecule of claim 20 will still be examined as comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter. Examiner has extended the species selection of Groups A-C: liver-selective enhancers to include (SEQ ID NO: 30) and muscle-selective promoters to include (SEQ ID NO: 3-4 and 6-8) as the combination of the elected species were free of the prior art of record. The election restriction of withdrawn Group continues to be maintained. Claims 22 and 40-41 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group or species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 4/7/2025. Amendments and Status of the Claims This action is in response to papers filed 1st April 2026, in which some claims were amended, claim 27 was canceled, and new claim 46 was added. All of the amendments have been thoroughly reviewed and entered. Applicant has amended: Elected claims 20, 25, 30, and 42 to overcome the 112(a) written description rejection; the 112(a) rejection of claims 20-21, 23-24, 30, 35-39, and 42, has not been overcome and is maintained; the 112(a) rejection of claim 25 has been overcome and is withdrawn. Applicant has amended and argued that exceptional results overcome the 35 USC § 103 rejection. Applicant’s amendments and arguments re the §103 rejection are persuasive. The §103 rejection is withdrawn. Applicant’s arguments are addressed at the end of this Office Action. Arguments that are no longer relevant are not addressed. Objections and Rejections not reiterated here are withdrawn. Accordingly, claims 20-21, 23-26, 28, 30, 32, 34-39, 42-46 are being examined. New Claim Rejections The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 42-45 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 42, claim 42 recites in the third wherein clause, wherein the sequence of the liver-selective enhancers consists of SEQ ID NO:1, or is a functional variant having a sequence at least 90% identical to SEQ ID NO:1;. However, claim 20 upon which claim 42 depends, requires in the first wherein clause wherein: the liver-selective enhancer comprises SEQ ID NO: 1, … or functional variants thereof having at least 95% sequence identity to SEQ ID NO: 1. i.e., Claim 20 requires the sequence of a functional variants of SEQ ID NO:1 to having at least 95% sequence identity to SEQ ID NO: 1, whereas claim 42, as recited, allows the nucleic acid sequence to only have at least 90% sequence identity to SEQ ID NO: 1. Therefore, Claim 42 is broadening and not further limiting the claim it depends from. Therefore, claim 42 is rejected for failing to further limit the claim upon which it depends. Claims 43-45 recite similar language and so are likewise rejected. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Interpretation muscle-selective promoter: is being interpreted according to specification page 7, lines 21-24, to mean a promoter that allows for the selective or preferential expression of a heterologous gene in muscle as compared to expression in another tissue. functional variant or functional fragment: The specification does not describe these terms. Therefore, these terms are being given the plain English meaning of the terms to mean any difference from the original sequences with the proviso that the function of the original sequence is maintained. It does not take into consideration that the Inventors have found another unpublished function for the original sequence. It is noted that the subject matter of a properly construed claim is defined by the terms that limit its scope. It is this subject matter that must be examined. As a general matter, the grammar and intended meaning of terms used in a claim will dictate whether the language limits the claim scope. Although the claims are interpreted in light of the specification, limitations from the specification are not read into the claims. See In re Van Geuns, 988 F.2d 1181, 26 USPQ2d 1057 (Fed. Cir. 1993). Response to Arguments Applicant’s argument, see Pg. 7, filed 1st April 2026, with respect to claim interpretation have been fully considered and are persuasive. The claim interpretation re muscle-selective promoter has been reconsidered and interpreted as per Applicants persuasive argument and corresponding specification. It is noted that Applicants have not discussed functional variant or functional fragment. Therefore, the previous claim interpretation re functional variant or functional fragment is maintained. Maintained Claim Rejections - 35 USC § 112 (a) Written Description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. This rejection has been rewritten to address amendments and to include newly rejoined claims that were previously withdrawn as being directed to unelected species. Note: the previous rejection of claim 25 is withdrawn. New claim 46 and newly rejoined claim 26 are not included in this rejection. Claims 20-21, 23-24, 28, 30, 32, 34-39, 42-45 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This analysis pertains to the elected species only. The purpose of the written description requirement is to “ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor’s contribution to the field of art as described in the patent specification.” Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1353-54 (Fed. Cir. 2010) (en banc) (quoting Univ. of Rochester v. G.D. Searle & Co., 358 F.3d 916, 920 (Fed. Cir. 2004)). To satisfy the written description requirement, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991). See also MPEP 2163.04. For a claim to a genus, a generic statement that defines a genus of substances by only their functional activity does not provide an adequate written description of the genus. Reagents of the University of California v. Eli Lilly, 43 USPQ2d 1398 (CAFC 1997). An original claim may lack written description support when a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. See MPEP 2163. Scope of the Invention In the instant case, the genera are A liver-selective enhancer(s) comprising two recited SEQ ID Nos (SEQ ID NO: 1 and 30), or functional variants thereof having 95% identity to the recited sequences…said functional variant having liver-selective enhancer activity (recited in claim 20). A liver-selective enhancer(s) comprising the SEQ ID NO: 1, or functional variants thereof having 90% identity to the recited sequence (recited in claims 42-45). A muscle-selective promoter comprising several recited SEQ ID NOs, or functional variants thereof having 95% identity to the recited sequences…said functional variant having muscle-selective promoter activity (recited in claim 20). A muscle-selective promoter or functional variants thereof having at least 95% identity to SEQ ID NO: 6/7/8 (recited in claims 30, 32, and 34 respectively). The broadest reasonable interpretation of the scope of the genera listed above encompasses a hybrid promoter made up of a liver-selective enhancer and a muscle-selective promoter that drives expression of a transgene in the muscle. This interpretation is based on definitions on pg. 7: "liver-selective enhancer" includes natural or synthetic liver-selective enhancers that preferentially drives expression of a gene operably linked to said transcription regulatory element in the liver AND when present in a hybrid nucleic acid molecule with a muscle-selective promoter, drives expression of a gene operably linked to it in the muscle. Thus, such a hybrid nucleic acid molecule is suitable for gene therapy of neuromuscular diseases [Summary of Invention]. Disclosure of a Complete or Partial Structure Regarding 1) and 2) liver-selective enhancer, Applicant lists two liver-selective enhancers by SEQ ID NO which are SEQ ID NO: 1 consisting of 72 bases (claim 20 and 42-45) and SEQ ID NO: 30 (claim 20). In the specification, various variants include: having at least 80% identity to SEQ ID NO: 1 [pg. 2, last para]. Functionally, the enhancer and variants must have liver-selective enhancer activity [pg. 3, first para]. The inventive concept requires the enhancer and variants to retain their ability to drive expression of a gene even in the muscle so as to function in gene therapy of neuromuscular diseases [Summary of Invention]. Further description includes combining a plurality of liver-selective enhancers or combining this preferential liver-selective enhancer with a muscle-selective promoter. In any case, the enhancer(s) are combined with a muscle-selective promoter to result in a novel hybrid promoter [pgs. 3-4]. The working examples of hybrid promoters (Figures 2 - 6) shows that some combinations of liver-selective enhancers work better than others. Specifically, H3 (three copies of HSCRM8 (SEQ ID NO: 1)) is more efficacious than H1 (one copy of HSCRM8 (SEQ ID NO: 1)) when these enhancers are present in a hybrid promoter along with muscle-selective enhancer and muscle-selective promoter. They go on to show that inclusion of a muscle-selective enhancer isn’t even required for enhanced expression in the muscle when a liver-selective enhancer is present in the hybrid promoter (Figure 4). Although discussed briefly, the other recited SEQ IDs, i.e., SEQ ID NO: 30, is shown in fig. 7, as a hybrid with synthetic muscle-selective promoter, as enhancing expression of a reporter gene in a specific muscle type (Quads) when compared with the use of a synthetic muscle-selective promoter alone. However, it is not clear how the two sequences may be varied so that they retain 95% identity to the original sequences, as recited, yet retain the two functions that define them; i.e., driving liver and muscle-specific transgene expression, as described by the rest of the disclosure. Regarding 3) and 4) muscle-selective promoters, as recited in claims 20 and 30, 32, and 34, Applicant describes muscle-selective promoter(s) to be preferentially SEQ ID NO: 6 (CK6) consisting of 575 bases. Various variants include: having at least 95% identity to a SEQ ID NO: 6 [pg. 11, middle para]. Functionally, the promoter and variants must have muscle-selective promoter activity [bridging pgs. 10-11]. The inventive concept requires the muscle-selective promoter, when juxtaposed with a liver-specific enhancer and functional variants, retain their ability to drive expression of a gene in the muscle so as to function in gene therapy of neuromuscular diseases [Summary of Invention]. Further description includes combining a plurality of enhancers with a muscle-selective promoter. In any case, the enhancer(s) are combined with a muscle-selective promoter to result in a novel hybrid promoter [pgs. 3-4]. The working examples of hybrid promoters utilizes i) spC5.12 promoter, SEQ ID NO: 2 (Table 1), as the muscle-selective promoter (Figures 2, 6, and 7), and similar sequences are described as: SEQ ID NOs 2 – 4; ii) the CK6 muscle-selective promoter (SEQ ID NO 6); and iii) the CK8 muscle-selective promoter (SEQ ID NO 7). All tested muscle-selective promoters show enhanced expression when juxtaposed near SEQ ID NO 1, the liver-selective enhancer(s). However, it is not clear how SEQ ID NOs: 3, 4, 6, 7, 8 (claimed) compares with SEQ ID NO: 2 or any other muscle-selective promoter and it is not clear how SEQ ID NOs: 2, 3, 4, 6, 7, 8 may be varied so that it retains 95% identity to its original sequence yet retains its ability to drive muscle-specific transgene expression, as described by the rest of the disclosure. Species Not Described SEQ ID NO: 1 is 72 nucleotides in length. A sequence having at least 95 % identity to SEQ ID NO: 1 includes a large genus of sequences comprising nucleotide sequences that may be ≤5% different from SEQ ID NO: 1; i.e., 3 nucleotides could be different. Furthermore, a nucleotide sequence could be or have: up to 5% of the nucleotides removed from SEQ ID NO: 1; a single chunk comprising ≤5% of the nucleotides different from SEQ ID NO: 1; every 20th nucleotide (starting at any position) different from SEQ ID NO: 1; every 20th nucleotide (starting at any position) removed from SEQ ID NO: 1; any other combination of nucleotides mutated or removed as long as the total adds up to ≤5% of total nucleotides. Similarly, SEQ ID NO: 6 is 575 nucleotides in length. A sequence having at least 95 % identity to SEQ ID NO: 6 includes a large genus of sequences comprising nucleotide sequences that may be ≤5% different from SEQ ID NO: 6; i.e., 28 nucleotides could be different. Furthermore, a nucleotide sequence could be or have: up to 5% of the nucleotides removed from SEQ ID NO: 6; a single chunk comprising ≤5% of the nucleotides different from SEQ ID NO: 6; every 20th nucleotide (starting at any position) different from SEQ ID NO: 6; every 20th nucleotide (starting at any position) removed from SEQ ID NO: 6; any other combination of nucleotides mutated or removed as long as the total adds up to ≤5% of total nucleotides. Each of those categories comprises a broad subgenus with diverse members and different structures that affect their functions. Some of those structures may have altered regulatory activity or other altered function(s). Similar considerations as above can be made for SEQ ID NOs: 30 and 3, 4, 6, 7, 8. With respect to claim 42, the genus is even greater as the claim requires 90% identity to the claimed SEQ ID NO. Structure/Function Correlation Regarding the genera, as discussed above, Applicant’s claim 20 encompasses particular sequences of enhancer and a dependent claims (claims 30 and 42) encompasses particular sequences of promoter elements with the proviso that they allow for the sequences, working alone or in combination with each other, to enhance transgene expression so as to function in gene therapy of neuromuscular diseases [Summary of Invention], while only specific sequences are described in the instant specification without any correlation to what core sequence is encompassed by the recited sequences; i.e., there is no evidence of a common domain/sequences between all sequences recited. The breadth of the claimed genera is enormously broad with an unfathomable number of structurally divergent and diverse sequences. Such structure-function correlation is required so as to allow one skilled in the art to vary sequences to allow for construction of a nucleic acid molecule that would possess the claimed function. Regarding all the sequences claimed, Applicant has not demonstrated possession of any nucleic acid molecule comprising a liver-selective enhancer operably linked to a muscle-selective promoter that will work to enhance transgene expression in the muscle, other than a molecule where the liver-selective enhancer is the full-length sequence identified as SEQ ID NO: 1 and 30. Similarly, Applicant does not describe a muscle-selective promoter that will enhance transgene expression in the muscle, other than where the muscle-selective promoter is the full-length sequence identified as SEQ ID NO: 2/6/7/8. The examples do not provide support for the entire genus/subgenera of sequences claimed because the examples show only individual species. The Specification does not provide sufficient evidence that each member of the entire genus of sequences claimed would produce the intended outcome of enhance transgene expression in the muscle. The Specification does not provide specific guidance for determining what the structure of species of sequences should be that will enhance transgene expression in the muscle while still being 95% identical to original sequence; the functional characteristic is not coupled with a known structure. The Spec. does not identify a core structure necessary for being a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle. Among the evidences provided for a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle, no core structure, partial structure, physical or chemical property, or functional characteristic coupled with a known or disclosed structure/function relationship responsible for the a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle is disclosed in such a way to demonstrate possession of the full invention as claimed at time of filing. Altogether, the number of species disclosed by complete structure is not sufficient to provide the written description support for the huge genus of a liver-selective enhancer and/or a muscle-selective promoter that will enhance transgene expression in the muscle claimed. These are broad genera with diverse members and different structures that underly their functions. Although the claims recite compounds that inherently possess a functional characteristic, i.e., enhance transgene expression in the muscle, the functional characteristic is not coupled with a known structure. Knowledge from the State of the Art Chuah (Chuah et al., Molecular Therapy, Volume 22, Issue 9, September 2014, Pages 1605-1613), which would be considered the closest prior art teaches cis-acting regulatory modules (CRMs) identified in a genome-wide bio-informatics strategy. This data-mining approach identifies instant SEQ ID NO: 1 as a cis-regulatory module (CRMs) with robust regulatory activity and further analyze expression patterns from an AAV construct bearing the CRMs in vivo. Chuah teach that for a CRM to act, the modules within that function as transcription factor binding sites (TFBs) must be preserved. This teaching is derived from computationally determining consensus regions of TFBs within CRMs across species (Fig. 1). While the consensus sites are deemed important, nothing in the art teaches one of skill how to vary the regions in between such sites. Re: functional variants thereof having at least 95% identity to the recited sequence, what one learns from the art is that it is quite unlikely that if the nucleotides in the regulatory elements were varied, the elements would still be functional. In fact, Chuah states, “high degree of phylogenetic conservation among 44 divergent species, this suggests a strong evolutionary selective pressure to maintain these particular TFBS combinations for high tissue-specific expression”(pg. 1607, right col). Further, Chuah indicate, there is unpredictability in taking (testing) HS-CRM element (instant SEQ ID NO: 1) out of context and testing in any routine lab cell line (HS-CRM8 element was subsequently evaluated …hFIX mRNA expression was restricted to the liver (Figure 3d,e), even upon administration of extremely high vector doses (3 × 1012 vg), despite the detection of viral genomes in non-hepatic tissues (i.e., heart, spleen, muscle, etc.) (data not shown)., pg. 1608, right col). Dependent Claims Claims 21, 23-24, 28, 30, 32, 34-39, and 42-45 do not further limit the genus of nucleic acid molecules comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter so as to resolve the issues above, and are therefore, not sufficiently described for at least the reasons above. Claim 30, 32, 34, and 42-45 are additionally rejected for not describing the genus of promoters that are at least 95% identical to SEQ ID NO:6/7/8 and the genus of enhancers that are at least 90% identical to SEQ ID NO:1. Conclusion of Written Description While none of these elements is specifically required to demonstrate possession, in combination their lack means that one skilled in the art at the time of filing would conclude that the inventors lacked possession of an invention of any oligonucleotide sequence of liver-selective enhancer(s) comprising several of the recited SEQ ID NOs, or functional variants thereof having 90 or 95% identity to the recited sequences or a combination thereof or with muscle-selective promoter (or functional variants thereof having 90 or 95% identity to the recited sequences), or any combination thereof. Therefore, the examiner concludes there is insufficient written description support for the instantly claimed genera of nucleic acid molecules comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter, and combinations with each other as stated. Only nucleic acid molecules comprising the combination of SEQ ID NO: 1 and 30 as the one or a plurality of liver-selective enhancer(s) and SEQ ID NO: 6 (elected species) as the muscle-selective promoter but not the full breadth of the claims is supported by Applicant’s disclosure. Therefore, claims 20-21, 23-24, 28, 30, 32, 34-39, 42-45 are rejected under 35 §112a for lacking adequate written description. Response to Arguments Applicant’s arguments, see Pgs. 8 - 11, filed 1st April 2026, with respect to rejections under 35 USC § 112(a) have been fully considered but are not persuasive. The previous 112 rejections are maintained. Applicants essentially assert that: 1) pg. 9: the case law of Capon v. Eshhar, 418 F.3d 1349, 1358 (Fed. Cir. 2005) makes clear that what is known in the art does not need to be described and that instant invention is directed to the combination of known elements and not the elements themselves; 2) pg. 10: the claims have been amended to recite specific sequences that demonstrate exceptional results and percent identity from 90% identity to 95% identity; and 3) pg. 10-11: the knowledge in the field provide ample guidance as to how one can determine that the claimed functional fragments of nucleic acid molecules (comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter) have the desired activity. Applicants state, “In view of the maturity of enhancer and promoter technologies, the existing knowledge of variants of enhancers and promoters, and the presence in the art of straightforward means to verify functionality of liver-selective enhancers and muscle-selective promoters using standard assays (e.g., luciferase reporter transduction in muscle and/or liver cells”. Regarding 1), this is not persuasive. Applicants cited case law of Capon v. Eshhar is in agreement with the written description rejection. From Capon v. Eshhar, we learn that the Board's rule that the nucleotide sequences of the chimeric genes must be fully presented, although the nucleotide sequences of the component DNA are known, is an inappropriate generalization. In summary, the Board erred in ruling that § 112 imposes a per se rule requiring recitation in the specification of the nucleotide sequence of claimed DNA, when that sequence is already known in the field. In Applicants case, the sequence is not already known in the field because Applicants claims require 90 or 95% identity to a sequence that is fully known; i.e., the claims are directed to a broad unknown genus based off known sequences. Regarding 2) this limited amendment still does not overcome the problems raised in the OA. While previously recited claim encompassed 90%, there was no disclosure supporting such a sequence identity. The limitation, “at least 95% identity” (claim 42 still maintains 90%) is now recited in amendments. Therefore, the rejection of previous claims still applies; i.e., specifically, the lack of structure – function correlation is required when a claim is directed to a genus. As discussed in the OA, when the specification, as in instant, only shows results obtained for a few recited sequences, then structure – function correlation is required. In the instant case, such is required for i) sequences recited and ii) variants of sequences recited. Regarding 3), this is not persuasive. Applicants have not provided any reference that shows that a regulatory element could be modified to 90 or 95% identity of the original functional element and still maintain activity. In addition, in instant OA, Examiner has elaborated on the knowledge from the art section citing Chuah 2014. Instant liver-specific regulatory sequences were obtained from this paper. Briefly, Chuah emphasizes the conserved nature of regulatory elements; i.e., substitutions, deletions etc., are not seen in these tested regulatory elements probably indicating selection pressure against any changes. Therefore, the Examiner maintains 112a Written Description Rejection. Withdrawn Claim Rejections - 35 USC § 103 Response to Arguments Applicant’s arguments, see Pgs. 11 - 15, filed 1st April 2026, with respect to rejections under 35 USC § 103 have been fully considered and are persuasive. Applicants argue unexpected results. The previous 103 rejections are withdrawn. Regarding unexpected results ,"To be particularly probative, evidence of unexpected results must establish that there is a difference between the results obtained and those of the closest prior art, and that the difference would not have been expected by one of ordinary skill in the art at the time of the invention." Bristol-Myers Squibb Co. v. Teva Pharm. USA, Inc., 752 F.3d 967, 977 (Fed. Cir. 2014). A showing of unexpected results must be "commensurate in scope with the degree of protection sought by the claimed subject matter." In re Harris, 409 F.3d 1339, 1344 (Fed. Cir. 2005). "Any differences between the claimed invention and the prior art may be expected to result in some differences in properties. The issue is whether the properties differ to such an extent that the difference is really unexpected." (emphasis added). See MPEP §716.02. "It is not enough to show that results are obtained which differ from those obtained in the prior art: that difference must be shown to be an unexpected difference". ( original emphasis). In re Klosak, 455 F.2d 1077, 1080 (CCPA 1972). The closest prior art is Gray (of record). Gray taught combination of a liver-specific enhancer (ApoE-HCR) with a muscle-specific promoter (desmin promoter) resulted in a regulatory construct that promoted muscle (Fig. 2), liver (Figs. 3 and 4), and central nervous system expression (Figs. 9-11). Below see TABLE 4A of Gray detailing the constructs and Fig. 2 showing results in muscle. It can be seen that vectors comprising the combination of a liver-specific enhancer (ApoE-HCR) with a muscle-specific promoter (desmin promoter); i.e., vectors 3-5, do not exhibit better expression than the vectors having the individual elements. PNG media_image1.png 1186 1319 media_image1.png Greyscale PNG media_image2.png 200 400 media_image2.png Greyscale Further, Gray demonstrated muscle and liver transduction using liver-specific enhancer/muscle-specific promoter constructs. In contrast, instant nucleic acids, wherein the first SEQ ID NO is the liver-specific enhancer and the second SEQ ID NO is the muscle-specific promoter: the combination of SEQ ID NO: 1 with SEQ ID NO: 2, with MCK enhancer interspersed or without MCK enhancer interspersed, provide highly efficient and selective muscle cell reporter gene expression with no reporter gene expression in liver (instant Figures 2-3 and Figure 4 respectively); the combination of SEQ ID NO: 1 with SEQ ID NO: 6/7, provide highly efficient muscle cell reporter gene expression (instant Figure 5); the combination of SEQ ID NO: 1 with SEQ ID NO: 8, provide highly efficient muscle cell reporter gene expression (instant Figure 6); the combination of SEQ ID NO: 30 with SEQ ID NO: 2, provide highly efficient muscle cell reporter gene expression (instant Figure 7). Therefore, the combination of SEQ ID Nos discussed above are free of the prior art of record as they exhibit unexpected activity over the results of closest prior art of Gray. In view of the foregoing, the previous §103 rejection of claims 20-21, 23-25, 30, 35-39, and 42 is withdrawn. Double Patenting 18294577 Claims 20 - 21, 23 - 25, 30, 35 - 39, 42 remain provisionally rejected and new claim 46 and newly rejoined claims 26, 28, 32, 34, and 43-45 are newly rejected on the ground of nonstatutory double patenting as being unpatentable over claims 16 - 32 of copending Application No. 18294577 (reference application) because reference claims anticipate the claims of instant app as discussed below. This rejection is rewritten from the rejection presented in NFOA dated 11/06/2025 to address amendments. The claims of both applications require a hybrid promoter comprising a liver-selective enhancer in combination with a muscle-selective promoter. Furthermore, the sequences recited for each of the liver-selective enhancers and muscle-selective promoters are the same. The reference application further comprises a broader genus of regulatory elements than instant. The independent claims have the following patentably indistinct recitations: Instant claim 20 Reference claim 16 A nucleic acid molecule comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter, wherein: the liver-selective enhancer comprises a sequence selected from the group consisting of SEQ ID NO: 1 SEQ ID NO: 30 or functional variants thereof having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 30 and having liver selective enhancer activity; and the muscle-selective promoter comprises SEQ ID NOs: 2, 3, 4, 6, 7, 8 or functional variants thereof having at least 95% sequence identity to SEQ ID NOs: 2, 3, 4, 6, 7 or 8 and having selective expression in muscle cells. A nucleic acid molecule comprising, operatively linked to each other: (i) one or a plurality of liver-selective enhancer(s); (ii) a first muscle-selective promoter, which is a CK6 promoter or a functional variant thereof; and (iii) a second muscle-selective promoter, which is selected in the group consisting of: a spC5-12 promoter, CK6 promoter, CK8 promoter, Actal promoter, MCK promoter, desmin promoter, and functional variants thereof. Specifically, the recitation in reference application claim 16 of various promoters is the same as the sequences of promoters recited in instant claim 20. This is evident in the dependent claims of reference app that further recite the SEQ ID Nos of the various recited promoters. The sequence listing discloses these sequences to be the same as instant sequences. Thus, instant claims anticipate the species of the genus of liver-selective enhancer(s) and muscle-selective promoters recited in reference application 18294577. Per MPEP 804 II B1, “To avoid improperly treating what is disclosed in a reference patent or copending application as if it were prior art in the context of a nonstatutory double patenting analysis, the examiner must first properly construe the scope of the reference claims. The portion of the specification of the reference that describes subject matter that falls within the scope of a reference claim may be relied upon to properly construe the scope of that claim. In particular, when ascertaining the scope of the reference’s claim(s) to a compound, the examiner should consider the reference’s specification, including all of the compound’s uses that are disclosed. In construing the claims of the reference patent or application, a determination is made as to whether a portion of the specification, including the drawings and claims, is directed to subject matter that is within the scope of a reference claim. For example, assume that the claim in a reference patent is directed to a genus of compounds, and the application being examined is directed to a species within the reference patent genus. If the reference patent discloses several species within the scope of the reference genus claim, that portion of the disclosure should be analyzed to properly construe the reference patent claim and determine whether it anticipates or renders obvious the claim in the application being examined. Because that portion of the disclosure of the reference patent is an embodiment of the reference patent claim, it may be helpful in determining the full scope and obvious variations of the reference patent claim. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Any additional limitations of the ‘577 claims are encompassed by the open claim language “comprises” found in the instant claims. US 12171843 B2 Claims 20-21, 23-25, 27, 30, 35-39, and 42 remain rejected and new claim 46 and newly rejoined claims 26, 28, 32, 34, and 43-45 are newly rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1 - 13 of U.S. Patent No. 12171843 (reference application of 16/968196). This rejection is rewritten from the rejection presented in NFOA dated 11/06/2025 to address amendments. The independent claims have the following patentably indistinct recitations: Instant claim 20 Reference claim 1 A nucleic acid molecule comprising one or a plurality of liver-selective enhancer(s) operably linked to a muscle-selective promoter, wherein: the liver-selective enhancer comprises a sequence selected from the group consisting of SEQ ID NO: 1 SEQ ID NO: 30 or functional variants thereof having at least 95% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 30 and having liver selective enhancer activity; and the muscle-selective promoter comprises SEQ ID NOs: 2, 3, 4, 6, 7, 8 or functional variants thereof having at least 95% sequence identity to SEQ ID NOs: 2, 3, 4, 6, 7 or 8 and having selective expression in muscle cells. A nucleic acid sequence comprising: (i) a first transcription regulatory element capable of driving or enhancing tissue-selective expression in a first tissue, wherein said first tissue is the liver; and (ii) a second transcription regulatory element capable of driving or enhancing tissue-selective expression in a second tissue, wherein said second tissue is not the liver; wherein the first and second transcription regulatory elements are fused together; and wherein the second transcription regulatory element is a muscle-selective promoter; wherein the first transcription regulatory element is a combination of ApoE enhancer and alpha-1 antitrypsin (hAAT) promoter; and wherein the second transcription regulatory element is spC5.12 promoter. While instant claim 20 and reference application’s claim 1 recite different SEQ ID NOs. and different names of regulatory sequences, the sequence of nucleotides for the liver-selective enhancer; i.e., SEQ ID NO: 1 is 100% identical to one of the regulatory sequences, alpha-1 antitrypsin (hAAT) promoter (SEQ ID NO: 2), in reference application. See alignment. Further, instant claim’s muscle-selective promoter includes SEQ ID NO: 2 which is the same as reference application’s spC5.12 promoter. Thus, reference application claims would read on instant claims. RESULT 1 US-16-968-196-2/c Query Match 100.0%; Score 72; DB 1; Length 397; Best Local Similarity 100.0%; Matches 72; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 305 GGGGGAGGCTGCTGGTGAATATTAACCAAGGTCACCCCAGTTATCGGAGGAGCAAACAGG 246 Qy 61 GGCTAAGTCCAC 72 |||||||||||| Db 245 GGCTAAGTCCAC 234 Any additional limitations of the ‘843 claims are encompassed by the open claim language “comprises” found in the instant claims. Response to Arguments Applicant’s arguments, see Pgs. 8 - 11, filed 1st April 2026, with respect to rejections under DP have been fully considered but are not persuasive. The previous DP rejections are maintained. Applicant argues that the 18294577 application has a later priority filing date and later US effective filing date than the instant Application, and cite Ex Parte Baurin, Appeal 2024-002920, Appl. No. 17/135,529, where the Board held that claims of a later-filed application (which would expire later than the pending claims in the application being rejected) could not serve as reference claims against the claims in the earlier filed application (Remarks, Pg. 15 1st para). This is not found to be persuasive for the following reasons: Examiner agrees that the co-pending application(s) has/have a later US filing date. However, MPEP 804.I.B.1.(b).(i) makes clear that a provisional double patenting rejection should be made and maintained by the examiner until the rejection has been overcome by amendment or the rejection is the only rejection remaining in an application having the earlier patent term filing date. Because the claims are still rejected under § 112, the rejection(s) for nonstatutory double patenting is/are maintained. Applicant argues that U.S. Patent No. 12,171,843 is structurally distinct from pending claims (Remarks, Pg. 15 3rd para). This is not found to be persuasive for the following reasons: the sequence alignment shown above shows the sequences between the instant and patent to be the same. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/Examiner, Art Unit 1635 /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Oct 07, 2021
Application Filed
Jun 16, 2025
Non-Final Rejection mailed — §103, §112, §DOUBLEPATENT
Sep 16, 2025
Response Filed
Nov 06, 2025
Non-Final Rejection mailed — §103, §112, §DOUBLEPATENT
Apr 01, 2026
Response Filed
May 06, 2026
Final Rejection mailed — §103, §112, §DOUBLEPATENT (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12605398
CRISPR-BASED METHODS AND NOVEL COMPOSITIONS FOR TREATING VASCULAR DISORDERS
4y 9m to grant Granted Apr 21, 2026
Patent 12571038
DIGITAL COUNTING OF INDIVIDUAL MOLECULES BY STOCHASTIC ATTACHMENT OF DIVERSE LABELS
1y 10m to grant Granted Mar 10, 2026
Patent 12570979
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 4m to grant Granted Mar 10, 2026
Patent 12565651
OLIGONUCLEOTIDES COMPRISING SEGMENTED GAP STRUCTURES
1y 7m to grant Granted Mar 03, 2026
Patent 12565657
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
1y 2m to grant Granted Mar 03, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

4-5
Expected OA Rounds
71%
Grant Probability
99%
With Interview (+37.8%)
2y 10m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 59 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month