DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 6/9/26 has been entered.
Applicant’s election without traverse of group IV, claims 34-36 and 38-40 and the species Duchenne Muscular Dystrophy and SEQ ID NO: 27 in the reply filed on 12/11/24 is acknowledged.
Claims 1-7 and 9-33 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/11/24.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 34-36 and 38-40 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. THIS IS A NEW MATTER REJECTION.
Amended claim 34 requires for the target region to be located within any exon or at any exon/intron boundary of the pre-mRNA of the dystrophin gene. However, the specification only discloses targeting the exon 23/intron 23 boundary region, which is not commensurate in scope with the amended claim language.
MPEP §2163.06 notes:
If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112, first paragraph - written description requirement. In re Rasmussen, 650 F.2d 1212, 211 USPQ 323 (CCPA 1981).
MPEP §2163.02 teaches that:
Whenever the issue arises, the fundamental factual inquiry is whether a claim defines an invention that is clearly conveyed to those skilled in the art at the time the application was filed...If a claim is amended to include subject matter, limitations, or terminology not present in the application as filed, involving a departure from, addition to, or deletion from the disclosure of the application as filed, the examiner should conclude that the claimed subject matter is not described in that application.
A review of the specification does not reveal support for where the claim amendments are found. Should applicant disagree, applicants are encouraged to point out with particularity by page and line number where such support might exist for each claim limitation added in the amended claims filed on 6/9/26.
There is no support for this claim limitation in the claimed priority documents. Therefore, the effective filing date of the instant claims is considered, for purposes of prior art, to be 10/7/21, which is the filing date of the instant application.
Claims 34-36 and 38-40 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of exon skipping of a dystrophin gene via delivery of the instant double-stranded nucleic acid complex wherein the first strand is complementary to the exon/intron boundary of exon 23/intron 23, does not reasonably provide enablement for a method of inducing exon skipping of any dystrophin gene in the skeletal or heart muscle of a subject comprising intravenously or subcutaneously administration of any double stranded nucleic acid complex meeting the instant structural limitations and targeted to any exon or any exon/intron junction of the pre-mRNA of the dystrophin gene. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Factors to be considered in a determination of lack of enablement include, but are not limited to:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988)
The instant claims are directed to a method of inducing exon skipping of any dystrophin gene in the skeletal or heart muscle of a subject comprising intravenously or subcutaneously administration of any double stranded nucleic acid complex meeting the instant structural limitations and targeted to any exon or any exon/intron junction of the pre-mRNA of the dystrophin gene.
The specification demonstrates in vivo inhibition of mRNA expression in mice via intravenous injection of a double stranded nucleic acid consisting of a 14-mer DNA antisense oligonucleotide targeting the SR-B1 gene and a tocopherol or cholesterol conjugated RNA complementary strand (Example 1). The complex showed significant inhibitory effects compared to single stranded ASO (page 49). The specification demonstrates the same results for the complex comprising a 16-mer fully complementary to malat1 non-coding RNA or a 16-mer fully complementary to DMPK mRNA.
The specification demonstrates induction of exon skipping in heart and skeletal muscles and the inhibition of expression of a specific dystrophin protein in the tissue by a double-stranded nucleic acid agent consisting of an antisense oligonucleotide targeting exon 23/intron 23 of the murine dystrophin gene, and a tocopherol or cholesterol-conjugated complementary strand; which is not commensurate in scope with a method of inducing exon skipping of any dystrophin gene in the skeletal or heart muscle of a subject comprising intravenously or subcutaneously administration of any double stranded nucleic acid complex targeted to any exon or any exon/intron junction of the pre-mRNA of the dystrophin gene.
For example, Adams et al. (BMC Molecular Biology 2007, 8:57, 1-8) teach: Although many dystrophin exons can be excised using a single AO, several exons require two motifs to be masked for efficient or specific exon skipping. Some AOs were inactive when applied individually, yet pronounced exon excision was induced in transfected cells when the AOs were used in select combinations, clearly indicating synergistic rather than cumulative effects on splicing. The necessity for AO cocktails to induce efficient exon removal was observed with 2 different chemistries, 2'-O-methyl modified bases on a phosphorothioate backbone and phosphorodiamidate morpholino oligomers. Similarly, other trends in exon skipping, as a consequence of 2'-O-methyl AO action, such as removal of additional flanking exons or variations in exon skipping efficiency with overlapping AOs, were also seen when the corresponding sequences were prepared as phosphorodiamidate morpholino oligomers (abstract).
Adams et al. teach: The combination of 2 AOs, directed at appropriate motifs in target exons was found to induce very efficient targeted exon skipping during processing of the dystrophin pre-mRNA (abstract). Adams et al. teach: However, some exons were found to be extremely difficult to dislodge, despite the evaluation of many AOs directed to the target exon (page 2). Therefore, it was known that not all exons are equally amenable to skipping and that the efficiency of skipping depends on the specific binding site and the surrounding splicing regulatory elements.
Li et al. (Trends in Pharmacological Sciences, November 2018, Vol. 39, No. 11, 982-994) teach: Clinical implementation of two recently approved antisense RNA therapeutics Exondys51J to treat Duchenne muscular dystrophy (Duchenne MD) and SpinrazaJas a treatment for spinal muscular atrophy (SMA) highlights the therapeutic potential of antisense oligonucleotides (ASOs). As shown in the Duchenne and Becker cases, the identification and specific removal of ‘dispensable’ exons by exon-skipping ASOs could potentially bypass lethal mutations in other genes and bring clinical benefits to affected individuals carrying amenable mutations (abstract). Li et al. is evidence that determination of which exons are dispensable by exon skipping is imperative.
Li et al. teach: However, because factors such as RNA secondary structure, competition between ASOs and SR proteins, hnRNPs, and/or the spliceosome can affect ASOs’ action, ASOs directed at the crucial acceptor or donor splice sites will not always alter splicing (page 985).
Li et al. teach: The locations of in-frame DMD exon deletions are another important consideration, as the loss of any exon encoding a crucial domain would be expected to severely compromise function (page 986). Li et al. teach: Consequently, before therapeutic exon skipping could be considered in individual patients, there must be proof that an exon can be omitted from the mRNA without compromising the function of the protein (page 987).
Fletcher et al. (J Gene Med 2006; 8: 207–216) teach: It is yet to be demonstrated that removal of dystrophin exons can reduce the phenotype severity in DMD or BMD patients. Although it is predicted that many DMD patients could benefit from AO-induced exon skipping, each mutation will need to be evaluated independently (page 215). Therefore, it would involve undue experimentation to determine which specific oligomers targeted to which specific sites would result in the instantly recited outcomes.
The experiments of the specification are not commensurate in scope and are not enabling for the instant claim breadth. The specification demonstrates target inhibition and exon skipping via intravenous injection of a double stranded nucleic acid consisting of a 14-mer or 16-mer DNA antisense oligonucleotide targeting a specific target sequence and a tocopherol or cholesterol conjugated RNA complementary strand; wherein the instant claims are not limited to a double stranded nucleic acid consisting of a 14-mer or 16-mer DNA antisense oligonucleotide targeting any specific target sequence in a specific dystrophin gene.
There is no guidance in the specification as filed that teaches how to deliver any double stranded nucleic acid within the instant claim breadth in vivo and predictably result in each of the instantly recited outcomes.
The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of inducing exon skipping in the skeletal or heart muscle of a subject via intravenous or subcutaneous delivery of a broad possible genus of double stranded nucleic acid complexes encompassing in vivo effects.
The specification demonstrates a single double stranded nucleic acid complex (SEQ ID NOs: 18 and 19) targeted to Dystrophin (PMO first strand; Toc 2nd strand), which is not commensurate in scope with targeting any exon or any exon/intron boundary of the pre-mRNA of the dystrophin gene.
Importantly, even for those duplexes of a 14-mer or 16-mer DNA antisense oligonucleotide targeting a specific target sequence and a tocopherol or cholesterol conjugated RNA complementary strand, the agents are not specific for any specific location in the pre-mRNA of the dystrophin gene that has been shown to result in exon skipping.
MPEP 2164.01
Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.
Also, MPEP 2164.01(a)
A conclusion of lack of enablement means that, based on the evidence regarding each of
the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed
invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27
USPQ2d 1510, 1513 (Fed. Cir. 1993).
Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether introduction of any possible complex within the instant claim breadth in vivo would result in successful exon skipping or treatment of a muscular dystrophy. To practice the claimed invention, one of skill in the art would have to de novo determine; the stability of the molecule in vivo, delivery of the molecule to the whole organism, specificity to the target tissue in vivo, dosage and toxicity in vivo, and entry of the molecule into the cell in vivo and the effective action therein. Without further guidance, one of skill in the art would have to practice a substantial amount of trial-and-error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention.
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)).
Response to Arguments
Applicant argues that the specification contains multiple in vivo working examples demonstrating the recited results (exon skipping in both cardiac and skeletal muscle, increased dystrophin expression, and functional improvement (increased running time and grip strength, and reduced serum CK/AST/ALT) in mdx mice following systemic (intravenous/subcutaneous) administration) (Examples 15-22, 21-22, and the corresponding figures). Applicant argues that the only element that one of ordinary skill must select to practice the full scope of the invention is the antisense base sequence directed to a selected dystrophin exon, which is a routine task.
Contrary to applicant’s argument, it would involve undue experimentation to determine which antisense sequences targeting any region of any exon or any exon/intron boundary of the pre-mRNA of the dystrophin gene would in fact result in exon skipping. As set forth in the rejection above, it was known that not any antisense oligomer targeting these regions of the pre-mRNA of the dystrophin gene result in the recited outcomes.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 34-36 and 38-40 is/are rejected under 35 U.S.C. 103 as being unpatentable over Yokota et al. (WO 2014/203518 A1), in view of Martin et al. (WO 2015/089074 A1), Fletcher et al. (The Journal of Gene Medicine, 2006; 8: 207–216), Astriab-Fisher et al. (Biochemical Pharmacology 68 (2004) 403–407), Passini et al. (WO 2019/067981 A1), Bestwick et al. (EP 2970964 B1), Passini et al. (WO 2019/059973 A1), and Yokota et al. (WO 2019/014772 A1).
Yokota et al. teach: double-stranded antisense nucleic acid complexes that can efficiently alter the processing of RNA in a cell via an antisense effect, and methods for using the same. One method comprises contacting with the cell a double-stranded nucleic acid complex comprising: a first nucleic acid strand annealed to a second nucleic acid strand, wherein: the first nucleic acid strand comprises (i) nucleotides independently selected from natural DNA nucleotides, modified DNA nucleotides, and nucleotide analogs, (ii) no regions that have 4 or more consecutive natural DNA nucleotides, (iii) the total number of natural DNA nucleotides, modified DNA nucleotides, and nucleotide analogs in the first nucleic acid strand is from 8 to 100, and (iv) the first nucleic acid strand is capable of hybridizing to RNA inside of the cell; and the second nucleic acid strand comprises nucleotides independently selected from natural RNA nucleotides, modified RNA nucleotides, and nucleotide analogs (abstract (instant claim 34).
Yokota et al. teach: The antisense method is a method of selectively altering the expression of a protein that is encoded by a target gene, by introducing into a cell an oligonucleotide (antisense oligonucleotide (ASO)) which is complementary to a partial sequence of the mRNA (sense strand) of a target gene (page 1) (instant claim 34).
Yokota et al. teach: In some other embodiments, the first nucleic acid strand is (i) selected from a morpholino oligonucleotide, a 2'-O-methyl modified oligonucleotide, a 2'-O-(2-methoxyethyl) modified oligonucleotide, or a bridged nucleotide oligonucleotide, (ii) the total number of nucleotides in the first nucleic acid strand is from 8 to 100, and (iv) the first nucleic acid strand is capable of hybridizing to RNA inside of the cell; and the second nucleic acid strand comprises nucleotides independently selected from natural RNA nucleotides, modified RNA nucleotides, and nucleotide analogs (pages 10 and 11) (instant claim 34).
Yokota et al. teach incorporation of a moiety for targeted delivery, wherein the moiety can be cholesterol or tocopherol (pages 9 and 21) (instant claim 34).
Yokota et al. teach: The ability of a double-stranded antisense nucleic acid complex according to one embodiment of the invention to cause exon-skipping during the processing of pre-mRNA of a portion of the dystrophin gene was tested and compared with that of a single-stranded antisense oligonucleotide (Example 2, page 26) (instant claim 34).
Yokota et al. teach: Two different antisense oligonucleotides that can cause exon skipping of exon 58 were prepared and tested. One ASO binds to a sequence within intron 57, and the other ASO binds to a sequence within exon 58, though both cause the skipping of exon 58. Two different complementary strands were prepared for each ASO to be used to form the double-stranded antisense nucleic acid complex. In each case, the complementary strands are 2'-OMe RNA/RNA gapmers with 3' and 5' wings of either 2 bases or 3 bases (Example 2, page 26).
Yokota et al. teach: The ability of a double-stranded antisense nucleic acid complex according to one embodiment of the invention to cause exon-skipping during the processing of pre-mRNA of a portion of the dystrophin gene was tested and compared with that of a single-stranded antisense oligonucleotide.
Yokota et al. teach: In all cases, the degree of exon 58 skipping induced by the double-strand ASO complex was significantly greater than that for the single-stranded ASO at the same concentration (10 nM). Above each bar in the graphs is the value for the Dunnett's test applied to the P value for each test (N=3) relative to the ASO only control (page 31).
Therefore, Yokota et al. teach a method of inducing exon skipping via delivery of double-stranded complex comprising a first and second nucleic acid strand, wherein the strands are fully complementary to each other and the one strand is fully complementary to mRNA of a dystrophin target gene or the pre-mRNA of a dystrophin gene, wherein the one strand is a morpholino oligonucleotide and the other strand comprises nucleotide analogs, and one strand is bound to cholesterol or tocopherol.
Yokota et al. teach: As is well-known in the art, exon skipping and splice switching is of interest for treating or ameliorating the effects of genetic mutations. Certain genetic diseases are thought to be treatable at the genetic level by such a mechanism, rather than at the protein level. Two examples are Duchenne muscular dystrophy and spinal muscular dystrophy (page 2).
Therefore, Yokota et al. offer motivation to deliver the agent to treat Duchenne muscular dystrophy (instant claims 35 and 36). Additionally, the specific oligomers of Yokota et al. are disclosed as DMD (Duchenne muscular dystrophy) oligomers for exon skipping wherein the one strand of the double stranded nucleic acid is targeted to an exon or an intron.
Yokota et al. teach: There are no particular limitations on the preferred form of administration of the composition of some embodiments, and examples thereof include enteral (peroral or the like) or non-enteral administration, more specifically, intravenous administration, intraarterial administration, intraperitoneal administration, subcutaneous administration, intracutaneous administration, tracheobronchial administration, rectal administration, and intramuscular administration, and administration by transfusion (page 24) (instant claim 34).
Yokota et al. teach: The composition of some embodiments can be used for animals including human beings as subjects. However, there are no particular limitations on the animals excluding human beings, and various domestic animals, domestic fowls, pets, experimental animals and the like can be the subjects of some embodiments (page 24) (instant claim 34).
Yokota et al. teach: When the composition of some embodiments is administered or ingested, the amount of administration or the amount of ingestion may be appropriately selected in accordance with the age, body weight, symptoms and health condition of the subject, type of the composition (pharmaceutical product, food and drink, or the like), and the like. However, the effective amount of ingestion of the composition according to the certain embodiments is 0.001 mg/kg/day to 50 mg/kg/day of the double stranded nucleic acid complex (page 24) (instant claims 38 and 39).
Therefore, specific selection within the range taught by Yokota et al. is considered to be a matter of design choice because Yokota et al. teach that the amount of administration or the amount of ingestion may be appropriately selected in accordance with the age, body weight, symptoms and health condition of the subject, type of the composition (pharmaceutical product, food and drink, or the like), and the like (instant claims 38 and 39).
Yokota et al. does not teach that the exon skipping is in skeletal or heart muscle. However, when treating Duchenne muscular dystrophy, as motivated by Yokota et al., delivery of the agent of Yokota et al. targeting a dystrophin gene would necessarily result in the exon skipping in the tissue comprising the target gene, which is skeletal or heart muscle.
Martin et al. is additional evidence that it was known that Duchenne muscular dystrophy is a condition involving the heart. Martin et al. teach a method of treating Duchenne muscular dystrophy comprising providing an effective amount of a composition comprising a shRNA to an individual (claims 1-31), wherein the shRNA is targeted to a target mRNA. Martin et al. teach: [0008] In particular embodiments, an individual in need of therapy for a cardiac medical condition is provided an effective amount of one or more nucleic acids, or cells comprising one or more nucleic acids, in which the nucleic acids provide therapeutic benefit to the individual. In specific embodiments, the nucleic acid is a form that directly or indirectly provides RNA interference, including at least shRNA.
Fletcher et al. teach that exon skipping of Dystrophin in the mdx mouse after localized and systemic administration of a morpholino antisense oligonucleotide (title, abstract). Fletcher et al. teach that in comparison to other modifications, the stability of the morpholino structural type, and the fact that it can be delivered to muscle in the absence of a delivery reagent, render this compound eminently suitable for consideration for therapeutic exon skipping to address dystrophin mutations (abstract). Fletcher et al. teach: We have shown previously that a morpholino AO appeared more effective in inducing exon 23 skipping after intramuscular injection than the optimal 2OMePS AO available at that time (page 212). The morpholino ASO is 25 nucleotides in length. Therefore, this further bolsters the motivation to utilize a fully morpholino modified antisense strand in the instantly recited size range with a reasonable expectation of success.
Fletcher et al. teach dystrophin exon 23 skipping with ASO targeting exon 23 injected into tibialis anterior muscles of mdx mice, wherein the shortened transcript was a major product in samples from muscle injected with 5 and 10 µg of morpholino oligomer (page 210).
Fletcher et al. teaches that benefits from any treatment that partially restores dystrophin expression are likely to be significant in the treatment of Duchenne Muscular Dystrophy. Fletcher et al. teaches that it has been estimated that >75% of DMD patients could benefit from exon removal to overcome dystrophin mutations and that the utility of AO-induced exon skipping in restoring dystrophin expression in experimental systems has been demonstrated (page 212).
Fletcher et al. teach: Although intramuscular injection of AOs is useful in evaluating the efficacy of compounds in vivo, any treatment for DMD will need to be effective after systemic delivery. Because skeletal muscle constitutes about 30% of the total body mass and because dystrophin isoforms are also expressed in a variety of tissues, DMD can only be ameliorated by systemic dystrophin restoration. We evaluated intraperitoneal injection of the morpholino AO as a potential systemic treatment regimen. Immunofluorescent staining of sections of selected tissues from 7-week-old mdx mice, which had received a single intraperitoneal injection at 5 days of age, revealed the presence of a low level of dystrophin in the tibialis anterior, quadriceps femoris and diaphragm (page 214). Therefore, it was known that for treatment of DMD, systemic dlievery would be necessary (recited intended use of instant claims 35 and 36).
Fletcher et al. teach: Dystrophin expression was subsequently demonstrated by immunofluorescent staining in mdx mouse tibialis anterior, ileum, diaphragm, triceps brachialis and quadriceps femoris after a series of 13 intraperitoneal injections, starting at 2 days of age and continuing over a 3-week period. These animals were sacrificed at the same age as those that received a single treatment. However, the shortened transcript was detected in limb muscles and diaphragm and Western blot analysis revealed low levels of dystrophin in tibialis anterior and a trace amount in diaphragm (page 214).
Fletcher et al. teaches: Persistence of the shortened transcript for at least 4 weeks, and the presence of substantial sarcolemmal dystrophin 6–10 weeks after a single intramuscular injection of the morpholino AO, are encouraging. Fletcher et al. teach: Systemic administration of AOs by a number of different routes, including intravenous, transdermal, subcutaneous and oral, has been reported (page 214). Therefore, it would have been obvious for the delivery to by intravenous to achieve treatment effects of DMD.
Fletcher et al. teach that uptake of double-stranded nucleic acids is more efficient than that of single-stranded antisense oligonucleotides (pages 208 and 213) and reference Astriab-Fisher et al. on page 208 for support. Astriab-Fisher et al. teach that antisense oligonucleotides have increased uptake by delivery as double stranded complexes (title). Fletcher et al. teach: The results obtained suggested that double stranded delivery could provide a simple and effective means for enhancing cell uptake of pharmacologically active oligonucleotides (abstract).
Yokota et al. does not teach instant SEQ ID NOs: 25-28. However, each were known to be incorporated into antisense agents for the same intended use (instant claim 40).
Passini et al. (WO 2019/067981 A1) teach that instant SEQ ID NO: 28 is "Casimersen" formerly known by its code name "SPR-4045" and is a PMO having the base sequence 5'- CAATGCCATCCTGGAGTTCCTG - 3' (SEQ ID NO: 1) and is targeted to dystrophin for treating Duchenne’s Muscular Dystrophy.
Bestwick et al. (EP 2970964 B1) teach an exon skipping composition for treating muscular dystrophy comprising instant SEQ ID NO: 27. Bestwick et al. teach: According to one aspect, the invention provides an antisense molecule capable of binding to a selected target in human dystrophin pre-mRNA to induce exon skipping. The present disclosure includes antisense sequences targeted to exon 53, identified below. H53A(+36+60): 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO:1). The antisense oligomer specifically hybridizes to annealing site H53A(+36+60), and has the sequence: SEQ ID NO: 1.
Passini et al. (WO 2019/059973 A1) teach: [0001] The present disclosure relates to novel antisense oligomer conjugates suitable for exon 53 skipping in the human dystrophin gene and pharmaceutical compositions thereof. The disclosure also provides methods for inducing exon 53 skipping using the novel antisense oligomer conjugates, methods for producing dystrophin in a subject having a mutation of the dystrophin gene that is amenable to exon 53 skipping, and methods for treating a subject having a mutation of the dystrophin gene that is amenable to exon 53 skipping.
Passini et al. teach that the oligomer is identical to instant SEQ ID NO: 26 (SEQ ID NO: 1 of Passini et al.), which comprises instant SEQ ID NO: 27; and Passini et al. teach a sequence identical to instant SEQ ID NO: 25 (human exon 51-54).
Yokota et al. (WO 2019/014772 A1) teach a therapeutic antisense oligonucleotide which binds to exon 51 of the human dystrophin pre-mRNA to induce exon skipping, and conjugates and compositions thereof. The invention further relates to methods and uses of the antisense oligonucleotide for the treatment of muscular disorders, specifically for Duchenne Muscular Dystrophy (Technical Field), wherein the oligomer is identical to instant SEQ ID NO: 25 (see SEQ ID NO: 6, Eteplirsen of Yokota et al.).
It would have been obvious to incorporate any of the known target sequences in human dystrophin pre-mRNA or the human dystrophin gene into the double stranded complex of Yokota et al. with expectation of exon skipping, as each incorporate an antisense strand complementary to the target sequence for the same intended action at the site.
Response to Arguments
Applicant argues that the ordinary artisan would have seen no reasonable expectation of success in making the alleged combination of references. As of the effective filing date, delivery of oligonucleotides to skeletal muscle, and particularly to cardiac muscle, was a central and unresolved problem in the art. It is known in the art that single-stranded morpholino agents, in particular, exhibit poor uptake into muscle and negligible uptake into the heart. None of the cited references teaches or suggests, in any combination, that systemic (intravenous/subcutaneous) administration of a morpholino-based heteroduplex bearing a cholesterol or tocopherol ligand achieves exon skipping, restoration of dystrophin expression, and functional rescue in skeletal and cardiac muscle.
The instant claims require intravenous or subcutaneous delivery, which is obvious in view of Fletcher et al. Fletcher et al. teach: Although intramuscular injection of AOs is useful in evaluating the efficacy of compounds in vivo, any treatment for DMD will need to be effective after systemic delivery. Because skeletal muscle constitutes about 30% of the total body mass and because dystrophin isoforms are also expressed in a variety of tissues, DMD can only be ameliorated by systemic dystrophin restoration. We evaluated intraperitoneal injection of the morpholino AO as a potential systemic treatment regimen. Immunofluorescent staining of sections of selected tissues from 7-week-old mdx mice, which had received a single intraperitoneal injection at 5 days of age, revealed the presence of a low level of dystrophin in the tibialis anterior, quadriceps femoris and diaphragm (page 214). Therefore, it was known that for treatment of DMD, systemic dlievery would be necessary (recited intended use of instant claims 35 and 36).
Fletcher et al. teach: Dystrophin expression was subsequently demonstrated by immunofluorescent staining in mdx mouse tibialis anterior, ileum, diaphragm, triceps brachialis and quadriceps femoris after a series of 13 intraperitoneal injections, starting at 2 days of age and continuing over a 3-week period. These animals were sacrificed at the same age as those that received a single treatment. However, the shortened transcript was detected in limb muscles and diaphragm and Western blot analysis revealed low levels of dystrophin in tibialis anterior and a trace amount in diaphragm (page 214).
Fletcher et al. teaches: Persistence of the shortened transcript for at least 4 weeks, and the presence of substantial sarcolemmal dystrophin 6–10 weeks after a single intramuscular injection of the morpholino AO, are encouraging (page 214). Therefore, it would have been obvious for the delivery to by intravenous to achieve treatment effects of DMD.
Applicant argues that the claimed method yields unexpected results. The specification discloses that systemic administration of the claimed Chol-/Toc-HDO achieved exon skipping of 27% or more in the heart a tissue in which the corresponding single-stranded morpholino produced almost no skipping and 2- to 4-fold greater exon skipping than the single-stranded morpholino, together with measurable functional improvement (increased running time, increased grip strength, and reduced serum CK/AST/ALT in mdx mice) (Examples 21-22 and the corresponding figures). Such tissue reach to the heart and skeletal muscle and functional efficacy achieved by systemic administration are surprising in light of the prior art and rebut the prima facie case of obviousness.
With regards to the unexpected results argued by applicant, the unexpected results are not commensurate in scope with the instant claims. The instant claims are not limited to the specific PMO ASO sequence of the specification that is directed to a specific portion of a specific target that results in exon skipping when in a duplex with a fully complementary RNA oligomer. The specification discloses an ASO PMO strand and a fully complementary RNA as the second strand, wherein the ASO PMO is fully complementary to a specific portion of a Dystrophin target sequence that results in exon-skipping, which is a species that is not commensurate in scope with the instant claims (Table 1).
Applicant argues that the Examiner's reasoning rests on impermissible hindsight, as defined by KSR. The conclusion that treatment of DMD would "necessarily result" in "exon skipping in muscle and cardiac muscle" is derived from the very results disclosed in the present application. Contrary to applicant’s argument, the instant claims regarding treatment of DMD do not recite any additional method step. The method is obvious in view of the cited references. Recitation of intended outcomes does not introduce any additional method step that is not obvious in view of the cited art. Additionally, the primary reference offers motivation to treat DMD with the construct and Fletcher et al. teaches that benefits from any treatment that partially restores dystrophin expression are likely to be significant in the treatment of Duchenne Muscular Dystrophy. Fletcher et al. teaches that it has been estimated that >75% of DMD patients could benefit from exon removal to overcome dystrophin mutations and that the utility of AO-induced exon skipping in restoring dystrophin expression in experimental systems has been demonstrated (page 212). Therefore, there would certainly be a reaonslab expectation of success without improper hindsight.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 34-36 and 38-40 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1, 3, 6-12, 20, and 21 of copending Application No. 17/906,444 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of application ‘444 are directed to a method of regulating expression of a target gene or transcriptional product thereof (wherein the instant claims recite a species, dystrophin, that anticipates the genus of application ‘444) in the central nervous system of a subject, comprising intrathecally or intraventricularly administering to a subject in need of such regulating a double-stranded nucleic acid complex comprising a first nucleic acid strand and a second nucleic acid strand, wherein said first nucleic acid strand is capable of hybridizing to at least part of said target gene or transcription product thereof, has an antisense effect on said target gene or transcription product thereof, and comprises at least two morpholino nucleic acids, said second nucleic acid strand comprises a base sequence complementary to said first nucleic acid strand, and said first nucleic acid strand is annealed to said second nucleic acid strand.
100% of the nucleic acids of the first strand are morpholino nucleic acids (claim 1). Each of the claim sets are directed to delivery of complexes with substantially the same struftural limitations, wherein exon-skipping of the instant application is a species of regulating target gene expression of the copending application. Although each of the methods recites different modes of delivery, the mode of delivery is a matter of design choice depending upon the target to be modified.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
Prosecution Insights