Prosecution Insights
Last updated: April 19, 2026
Application No. 17/602,035

Pharmaceutical Composition for Treating Muscle Disease

Final Rejection §103§112
Filed
Oct 07, 2021
Examiner
HUDSON, AMY ROSE
Art Unit
1636
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
National University Corporation Tokyo Medical And Dental University
OA Round
2 (Final)
75%
Grant Probability
Favorable
3-4
OA Rounds
2y 7m
To Grant
86%
With Interview

Examiner Intelligence

Grants 75% — above average
75%
Career Allow Rate
1076 granted / 1432 resolved
+15.1% vs TC avg
Moderate +11% lift
Without
With
+11.3%
Interview Lift
resolved cases with interview
Typical timeline
2y 7m
Avg Prosecution
60 currently pending
Career history
1492
Total Applications
across all art units

Statute-Specific Performance

§101
3.0%
-37.0% vs TC avg
§103
33.6%
-6.4% vs TC avg
§102
14.5%
-25.5% vs TC avg
§112
33.2%
-6.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1432 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s election without traverse of group IV, claims 34-36 and 38-40 and the species Duchenne Muscular Dystrophy and SEQ ID NO: 27 in the reply filed on 12/11/24 is acknowledged. Claims 1-7 and 9-33 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/11/24. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 34-36 and 38-40 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The instant claims are directed to a method of inducing exon skipping in the skeletal or heart muscle of a subject comprising administration of any double stranded nucleic acid complex with a first and second strand of 14-30 bases in length wherein the first strand comprises a sequence of any length that is capable of hybridizing to all or any part of any transcription product of any dystrophin gene. The first strand is not necessarily the same length as the second strand and is annealed at any level (i.e. a single nucleotide). The specification does not adequately describe the structure required for the complex to function as claimed by exon skipping. The specification discloses fully annealed dsRNA molecules of a specific length that have the instantly recited effects on a target that is fully complementary to the antisense strand, which is not representative of exon skipping via broad delivery of any agent of the instantly recited genus that has minimal specificity to any specific target. The MPEP states that for a generic claim, the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. See MPEP § 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP § 2163. Although the MPEP does not define what constitute a sufficient number of representative species, the courts have indicated what do not constitute a representative number of species to adequately describe a broad genus. In Gostelli, the courts determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gostelli, 872, F.2d at 1012, 10 USPQ2d at 1618. Additionally, in Carnegie Mellon University v. Hoffman-La Roche Inc., Nos. 07-1266, -1267 (Fed. Cir. Sept. 8, 2008), the Federal Circuit affirmed that a claim to a genus described in functional terms was not supported by the specification’s disclosure of species that were not representative of the entire genus. Furthermore, for a broad generic claim, the specification must provide adequate written description to identify the genus of the claim. In Regents of the University of California v. Eli Lilly & Co. the court stated: "A written description of an invention involving a chemical genus, like a description of a chemical species, 'requires a precise definition, such as by structure, formula, [or] chemical name,' of the claimed subject matter sufficient to distinguish it from other materials." Fiers, 984 F.2d at 1171, 25 USPQ2d 1601; In re Smythe, 480 F.2d 1376, 1383, 178 USPQ 279, 284985 (CCPA 1973) ("In other cases, particularly but not necessarily, chemical cases, where there is unpredictability in performance of certain species or subcombinations other than those specifically enumerated, one skilled in the art may be found not to have been placed in possession of a genus ...") Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398. The claims are rejected under the written description requirement for failing to disclose adequate species to represent the claimed genus, the genus being double stranded nucleic acid complexes with minimal specificity to any specific dystrophin gene that would function as claimed. In absence of a full length DNA complement to a specific target sequence at a location that has shown to result in exon skipping, the structure would not meet the function. The specification does not adequately describe the structure within the instantly recited genus that is required for the recited function. The Guidelines for Examination of Patent Applications under the 35 USC § 112, first paragraph, “Written Description” Requirement”, published at Federal Register, Vol. 66, No. 4, pp. 1099-1111 outline the method of analysis of claims to determine whether adequate written description is present. The first step is to determine what the claim as a whole covers, i.e., discussion of the full scope of the claim. Second, the application should be fully reviewed to understand how applicant provides support for the claimed invention including each element and/or step, i.e., compare the scope of the claim with the scope of the description. Third, determine whether the applicant was in possession of the claimed invention as a whole at the time of filing. To achieve the desired function, it appears that the structure is required to be of a shorter length than the claimed genus which has no length limitation; and for the antisense strand and sense strand to be hybridized as a duplex; and for the antisense strand to by fully complementary to a target sequence that its inhibition has been shown to result in the instantly recited outcomes; and for the antisense strand to be DNA. For example, Elbashir et al. (The EMBO Journal, Vol. 20, No. 23, pages 6877-6888, 2001) teaches that duplexes of 21-23 nt RNAs are the sequence specific mediators of RNAi and that even single mismatches between the siRNA duplex and the target mRNA abolish interference (abstract and page 6888). The instant claim breadth encompasses siRNAs. The specification does not adequately describe which double-stranded nucleic acid complexes within the instant genus would have the structure to result in the function of having an exon skipping effect on the transcription product. Thus, having analyzed the claims with regard to the Written Description guidelines, it is clear that the specification does not disclose a representative number of species for possible double stranded nucleic acid complexes with varying levels of complementarity between each strand and between the antisense strand and the target within the instant enormous genus that function as claimed. Thus, one skilled in the art would be led to conclude that Applicant was not in possession of the claimed invention at the time the application was filed. Response to Arguments Applicant argues that examples 15-22 demonstrate and confirm exon skipping induced by intravenously or subcutaneously administering a double-stranded nucleic acid complex to a mouse model. However, the examples demonstrate induction of exon skipping in heart and skeletal muscles and inhibition of expression of a specific dystrophin protein in the tissue by a double-stranded nucleic acid agent consisting of an antisense oligonucleotide targeting exon 23/intron 23 of the murine dystrophin gene, and a tocopherol or cholesterol-conjugated complementary strand, which is not commensurate in scope with the instant claims that are directed to a method of inducing exon skipping in the skeletal or heart muscle of a subject comprising administration intravenously or subcutaneously of any double stranded nucleic acid complex with a first and second strand of 14-30 bases in length wherein the first strand comprises a sequence of any length that is capable of hybridizing to all or any part (i.e. 2 nt) of any transcription product of any dystrophin gene. The first strand is not necessarily the same length as the second strand and is annealed at any level (i.e. a single nucleotide). The claims are not directed to delivery of a double-stranded duplex wherein one strand is fully complementary to any specific target, wherein it appears that it is necessary for the antisense strand of a duplex to consist of an antisense oligonucleotide targeting exon 23/intron 23 of a specific dystrophin gene sequence for the recited function. Claims 34-36 and 38-40 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for inhibition of a target wherein the DNA antisense strand is fully complementary to the target; and to a method of inducing exon skipping in the skeletal or heart muscle in a subject comprising intravenously or subcutaneously administering a duplex of dsRNA wherein the one strand consists of an antisense oligonucleotide targeting exon 23/intron 23 of a specific dystrophin gene, does not reasonably provide enablement for a method of inducing exon skipping of any dystrophin gene in the skeletal or heart muscle of a subject comprising intravenously or subcutaneously administration of any double stranded nucleic acid complex with a first and second strand of 14-30 bases in length wherein the first strand comprises a sequence of any length that is capable of hybridizing to all or any part (i.e. 2 nt) of any transcription product of any dystrophin gene. The first strand is not necessarily the same length as the second strand and is annealed at any level (i.e. a single nucleotide) and wherein the first strand comprises a sequence of any length (i.e. 2 nt) that is capable of hybridizing to all or any part of any transcription product of any dystrophin gene. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. Factors to be considered in a determination of lack of enablement include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988) The instant claims are directed to a method of inducing exon skipping of any dystrophin gene in the skeletal or heart muscle of a subject comprising intravenously or subcutaneously administration of any double stranded nucleic acid complex with a first and second strand of 14-30 bases in length wherein the first strand comprises a sequence of any length that is capable of hybridizing to all or any part (i.e. 2 nt) of any transcription product of any dystrophin gene. The first strand is not necessarily the same length as the second strand and is annealed at any level (i.e. a single nucleotide) and wherein the first strand comprises a sequence of any length (i.e. 2 nt) that is capable of hybridizing to all or any part of any transcription product of any dystrophin gene. The specification demonstrates in vivo inhibition of mRNA expression in mice via intravenous injection of a double stranded nucleic acid consisting of a 14-mer DNA antisense oligonucleotide targeting the SR-B1 gene and a tocopherol or cholesterol conjugated RNA complementary strand (Example 1). The complex showed significant inhibitory effects compared to single stranded ASO (page 49). The specification demonstrates the same results for the complex comprising a 16-mer fully complementary to malat1 non-coding RNA or a 16-mer fully complementary to DMPK mRNA. The specification demonstrates induction of exon skipping in heart and skeletal muscles and the inhibition of expression of a specific dystrophin protein in the tissue by a double-stranded nucleic acid agent consisting of an antisense oligonucleotide targeting exon 23/intron 23 of the murine dystrophin gene, and a tocopherol or cholesterol-conjugated complementary strand; which is not commensurate in scope with a method of inducing exon skipping of any dystrophin gene in the skeletal or heart muscle of a subject comprising intravenously or subcutaneously administration of any double stranded nucleic acid complex with a first and second strand of 14-30 bases in length wherein the first strand comprises a sequence of any length that is capable of hybridizing to all or any part (i.e. 2 nt) of any transcription product of any dystrophin gene. The first strand is not necessarily the same length as the second strand and is annealed at any level (i.e. a single nucleotide) and wherein the first strand comprises a sequence of any length (i.e. 2 nt) that is capable of hybridizing to all or any part of any transcription product of any dystrophin gene. Notably, the instant claims do not require for the antisense strand to be complementary or to hybridize to any specific portion of any specific dystrophin gene. Certainly targeting any portion of any dystrophin gene would not induce exon skipping. The experiments of the specification are not commensurate in scope and are not enabling for the instant claim breadth. The specification demonstrates target inhibition and exon skipping via intravenous injection of a double stranded nucleic acid consisting of a 14-mer or 16-mer DNA antisense oligonucleotide targeting a specific target sequence and a tocopherol or cholesterol conjugated RNA complementary strand; wherein the instant claims are not limited to a double stranded nucleic acid consisting of a 14-mer or 16-mer DNA antisense oligonucleotide targeting any specific target sequence in a specific dystrophin gene (any double stranded nucleic acid complex with a first and second strand of 14-30 bases in length wherein the first strand comprises a sequence of any length that is capable of hybridizing to all or any part (i.e. 2 nt) of any transcription product of any dystrophin gene. The first strand is not necessarily the same length as the second strand and is annealed at any level (i.e. a single nucleotide) and wherein the first strand comprises a sequence of any length (i.e. 2 nt) that is capable of hybridizing to all or any part of any transcription product of any dystrophin gene and the antisense strand is not targeted to any specific portion of the target that would necessarily result in exon skipping. There is no guidance in the specification as filed that teaches how to deliver any double stranded nucleic acid of any configuration within the instant claim breadth in vivo and predictably result in each of the instantly recited outcome. The scope of the claims in view of the specification as filed together do not reconcile the unpredictability in the art to enable one of skill in the art to make and/or use the claimed invention, namely a broad method of inducing exon skipping in the skeletal or heart muscle of a subject via intravenous or subcutaneous delivery of a broad possible genus of double stranded nucleic acid complexes of varying configurations and specificity to any given target encompassing in vivo effects. Importantly, even for those duplexes of a 14-mer or 16-mer DNA antisense oligonucleotide targeting a specific target sequence and a tocopherol or cholesterol conjugated RNA complementary strand, the agents are not specific for any specific location in any specific target that has been shown to result in exon skipping. With regards to the treatment recited in instant claims 35 and 36, the specification hasn’t demonstrated that the instantly recited complexes targeted to any possible location in any possible target would result in treatment of a muscular dystrophy. The agent can be targeted to a sequence that has no correlation to muscular dystrophy. MPEP 2164.01 Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention. Also, MPEP 2164.01(a) A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993). Given the teachings of the specification as discussed above, one skilled in the art could not predict a priori whether introduction of any possible complex within the instant claim breadth in vivo would result in successful exon skipping or treatment of a muscular dystrophy. To practice the claimed invention, one of skill in the art would have to de novo determine; the stability of the molecule in vivo, delivery of the molecule to the whole organism, specificity to the target tissue in vivo, dosage and toxicity in vivo, and entry of the molecule into the cell in vivo and the effective action therein. Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention. A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)). Response to Arguments Applicant argues that for all of the reasons given above in response to the rejection under 35 U.S.C. 112(a), as allegedly failing to comply with the written description requirement, it is respectfully submitted that claim 34, et seq., is now clearly supported and enabled by the application as filed. Applicants arguments regarding the written description rejection have been addressed above. The instant specification is not enabling for a method of inducing exon skipping of any dystrophin gene in the skeletal or heart muscle of a subject comprising intravenously or subcutaneously administration of any double stranded nucleic acid complex with a first and second strand of 14-30 bases in length wherein the first strand comprises a sequence of any length that is capable of hybridizing to all or any part (i.e. 2 nt) of any transcription product of any dystrophin gene. The first strand is not necessarily the same length as the second strand and is annealed at any level (i.e. a single nucleotide) and wherein the first strand comprises a sequence of any length (i.e. 2 nt) that is capable of hybridizing to all or any part of any transcription product of any dystrophin gene. The first strand can hybridize to any part of any location of the target. The specification does not draw an adequate nexus between delivery of such a broad genus of structures with a broad genus of possible sequences and the predictable outcome of inducing exon skipping in the skeletal or heart muscle of a subject. The specification demonstrates induction of exon skipping in heart and skeletal muscles and the inhibition of expression of a specific dystrophin protein in the tissue by a double-stranded nucleic acid agent consisting of an antisense oligonucleotide targeting exon 23/intron 23 of the murine dystrophin gene, and a tocopherol or cholesterol-conjugated fully complementary strand; which is not commensurate in scope with the instant claims and are limitations that are not required by the instant claims. Applicant argues that as for the enablement rejection of claims 34 and 35, dystrophin, as required by claim 34, is the causative gene of Duchenne muscular dystrophy. The application provides examples conducted in MDX mice, which are considered to be an animal model for Duchene M.D. In the provided examples, various endurance and muscle strength tests conducted in the MDX model mice, confirm that the mice receiving the inventive treatment [double-stranded nucleic acid complex (Chol-HDO or Toc-HDO)] are stronger and have more endurance than the MDX mice receiving the control treatment. However, the claims are not limited to delivery of the double-stranded complex of the specification and the instant claim language encompasses a much broader genus of compounds. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 34-36 and 38-40 is/are rejected under 35 U.S.C. 103 as being unpatentable over Yokota et al. (WO 2014/203518 A1), in view of Martin et al. (WO 2015/089074 A1), Passini et al. (WO 2019/067981 A1), Bestwick et al. (EP 2970964 B1), Passini et al. (WO 2019/059973 A1), and Yokota et al. (WO 2019/014772 A1). Yokota et al. teach: double-stranded antisense nucleic acid complexes that can efficiently alter the processing of RNA in a cell via an antisense effect, and methods for using the same. One method comprises contacting with the cell a double-stranded nucleic acid complex comprising: a first nucleic acid strand annealed to a second nucleic acid strand, wherein: the first nucleic acid strand comprises (i) nucleotides independently selected from natural DNA nucleotides, modified DNA nucleotides, and nucleotide analogs, (ii) no regions that have 4 or more consecutive natural DNA nucleotides, (iii) the total number of natural DNA nucleotides, modified DNA nucleotides, and nucleotide analogs in the first nucleic acid strand is from 8 to 100, and (iv) the first nucleic acid strand is capable of hybridizing to RNA inside of the cell; and the second nucleic acid strand comprises nucleotides independently selected from natural RNA nucleotides, modified RNA nucleotides, and nucleotide analogs (abstract). Yokota et al. teach: The antisense method is a method of selectively altering the expression of a protein that is encoded by a target gene, by introducing into a cell an oligonucleotide (antisense oligonucleotide (ASO)) which is complementary to a partial sequence of the mRNA (sense strand) of a target gene (page 1) (instant claim 34). Yokota et al. teach: In some other embodiments, the first nucleic acid strand is (i) selected from a morpholino oligonucleotide, a 2'-O-methyl modified oligonucleotide, a 2'-O-(2-methoxyethyl) modified oligonucleotide, or a bridged nucleotide oligonucleotide, (ii) the total number of nucleotides in the first nucleic acid strand is from 8 to 100, and (iv) the first nucleic acid strand is capable of hybridizing to RNA inside of the cell; and the second nucleic acid strand comprises nucleotides independently selected from natural RNA nucleotides, modified RNA nucleotides, and nucleotide analogs (pages 10 and 11) (instant claim 34). Yokota et al. teach incorporation of a moiety for targeted delivery, wherein the moiety can be cholesterol or tocopherol (pages 9 and 21) (instant claim 34). Yokota et al. teach: The ability of a double-stranded antisense nucleic acid complex according to one embodiment of the invention to cause exon-skipping during the processing of pre-mRNA of a portion of the dystrophin gene was tested and compared with that of a single-stranded antisense oligonucleotide (Example 2, page 26) (instant claim 34). Yokota et al. teach: Two different antisense oligonucleotides that can cause exon skipping of exon 58 were prepared and tested. One ASO binds to a sequence within intron 57, and the other ASO binds to a sequence within exon 58, though both cause the skipping of exon 58. Two different complementary strands were prepared for each ASO to be used to form the double-stranded antisense nucleic acid complex. In each case, the complementary strands are 2'-OMe RNA/RNA gapmers with 3' and 5' wings of either 2 bases or 3 bases (Example 2, page 26). Yokota et al. teach: In all cases, the degree of exon 58 skipping induced by the double-strand ASO complex was significantly greater than that for the single-stranded ASO at the same concentration (10 nM). Above each bar in the graphs is the value for the Dunnett's test applied to the P value for each test (N=3) relative to the ASO only control (page 31). Therefore, Yokota et al. teach a method of inducing exon skipping via delivery of double-stranded complex comprising a first and second nucleic acid strand, wherein the strands are fully complementary to each other and the one strand is fully complementary to mRNA of a dystrophin target gene, wherein the one strand is a morpholino oligonucleotide and the other strand comprises nucleotide analogs, and one strand is bound to cholesterol or tocopherol. Yokota et al. teach: As is well-known in the art, exon skipping and splice switching is of interest for treating or ameliorating the effects of genetic mutations. Certain genetic diseases are thought to be treatable at the genetic level by such a mechanism, rather than at the protein level. Two examples are Duchenne muscular dystrophy and spinal muscular dystrophy (page 2). Therefore, Yokota et al. offer motivation to delivery the agent to treat Duchenne muscular dystrophy (instant claims 35 and 36). Yokota et al. teach: There are no particular limitations on the preferred form of administration of the composition of some embodiments, and examples thereof include enteral (peroral or the like) or non-enteral administration, more specifically, intravenous administration, intraarterial administration, intraperitoneal administration, subcutaneous administration, intracutaneous administration, tracheobronchial administration, rectal administration, and intramuscular administration, and administration by transfusion (page 24) (instant claim 34). Yokota et al. teach: The composition of some embodiments can be used for animals including human beings as subjects. However, there are no particular limitations on the animals excluding human beings, and various domestic animals, domestic fowls, pets, experimental animals and the like can be the subjects of some embodiments (page 24) (instant claim 34). Yokota et al. teach: When the composition of some embodiments is administered or ingested, the amount of administration or the amount of ingestion may be appropriately selected in accordance with the age, body weight, symptoms and health condition of the subject, type of the composition (pharmaceutical product, food and drink, or the like), and the like. However, the effective amount of ingestion of the composition according to the certain embodiments is 0.001 mg/kg/day to 50 mg/kg/day of the double stranded nucleic acid complex (page 24) (instant claims 38 and 39). Therefore, specific selection within the range taught by Yokota et al. is considered to be a matter of design choice because Yokota et al. teach that the amount of administration or the amount of ingestion may be appropriately selected in accordance with the age, body weight, symptoms and health condition of the subject, type of the composition (pharmaceutical product, food and drink, or the like), and the like (instant claims 38 and 39). Yokota et al. does not teach that the exon skipping is in skeletal or heart muscle. However, when treating Duchenne muscular dystrophy, as motivated by Yokota et al., delivery of the agent of Yokota et al. targeting a dystrophin gene would necessarily result in the exon skipping in the tissue comprising the target gene, which is skeletal or heart muscle. Martin et al. is additional evidence that it was known that Duchenne muscular dystrophy is a condition involving the heart. Martin et al. teach a method of treating Duchenne muscular dystrophy comprising providing an effective amount of a composition comprising a shRNA to an individual (claims 1-31), wherein the shRNA is targeted to a target mRNA. Application/Control Number: 17/602,035 Page 15 Art Unit: 1636 Martin et al. teach: [0008] In particular embodiments, an individual in need of therapy for a cardiac medical condition is provided an effective amount of one or more nucleic acids, or cells comprising one or more nucleic acids, in which the nucleic acids provide therapeutic benefit to the individual. In specific embodiments, the nucleic acid is a form that directly or indirectly provides RNA interference, including at least shRNA. Yokota et al. does not teach instant SEQ ID NOs: 25-28. However, each were known to be incorporated into antisense agents for the same intended use (instant claim 40). Passini et al. (WO 2019/067981 A1) teach that instant SEQ ID NO: 28 is "Casimersen" formerly known by its code name "SPR-4045" and is a PMO having the base sequence 5'- CAATGCCATCCTGGAGTTCCTG - 3' (SEQ ID NO: 1) and is targeted to dystrophin for treating Duchenne’s Muscular Dystrophy. Bestwick et al. (EP 2970964 B1) teach an exon skipping composition for treating muscular dystrophy comprising instant SEQ ID NO: 27. Bestwick et al. teach: According to one aspect, the invention provides an antisense molecule capable of binding to a selected target in human dystrophin pre-mRNA to induce exon skipping. The present disclosure includes antisense sequences targeted to exon 53, identified below. H53A(+36+60): 5'-GTTGCCTCCGGTTCTGAAGGTGTTC-3' (SEQ ID NO:1). The antisense oligomer specifically hybridizes to annealing site H53A(+36+60), and has the sequence: SEQ ID NO: 1. Passini et al. (WO 2019/059973 A1) teach: [0001] The present disclosure relates to novel antisense oligomer conjugates suitable for exon 53 skipping in the human dystrophin gene and pharmaceutical compositions thereof. The disclosure also provides methods for inducing exon 53 skipping using the novel antisense oligomer conjugates, methods for producing dystrophin in a subject having a mutation of the dystrophin gene that is amenable to exon 53 skipping, and methods for treating a subject having a mutation of the dystrophin gene that is amenable to exon 53 skipping. Passini et al. teach that the oligomer is identical to instant SEQ ID NO: 26 (SEQ ID NO: 1 of Passini et al.), which comprises instant SEQ ID NO: 27; and Passini et al. teach a sequence identical to instant SEQ ID NO: 25 (human exon 51-54). Yokota et al. (WO 2019/014772 A1) teach a therapeutic antisense oligonucleotide which binds to exon 51 of the human dystrophin pre-mRNA to induce exon skipping, and conjugates and compositions thereof. The invention further relates to methods and uses of the antisense oligonucleotide for the treatment of muscular disorders, specifically for Duchenne Muscular Dystrophy (Technical Field), wherein the oligomer is identical to instant SEQ ID NO: 25 (see SEQ ID NO: 6, Eteplirsen of Yokota et al.). It would have been obvious to incorporate any of the known target sequences in human dystrophin pre-mRNA or the human dystrophin gene into the double stranded complex of Yokota et al. with expectation of exon skipping, as each incorporate an antisense strand complementary to the target sequence for the same intended action at the site. Response to Arguments The rejection has been amended in response to the amendment to the claims. It is believed that applicant’s arguments are addressed by the amended rejection. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Amy R Hudson whose telephone number is (571)272-0755. The examiner can normally be reached M-F 8:00am-6:00pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AMY ROSE HUDSON/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Oct 07, 2021
Application Filed
Mar 18, 2025
Non-Final Rejection — §103, §112
Sep 16, 2025
Response Filed
Dec 08, 2025
Final Rejection — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600969
EXPRESSION CONTROL USING A REGULATABLE INTRON
2y 5m to grant Granted Apr 14, 2026
Patent 12595479
ANTISENSE OLIGONUCLEOTIDE-BASED PROGRANULIN AUGMENTATION THERAPY IN NEURODEGENERATIVE DISEASES
2y 5m to grant Granted Apr 07, 2026
Patent 12595483
TREATMENT OF TUMORS WITH MIRNA TARGETING CDK4/CDK6
2y 5m to grant Granted Apr 07, 2026
Patent 12589133
METHODS OF DOWNREGULATING CCL20 GENES FOR TREATMENT OF TRAUMATIC BRAIN INJURIES
2y 5m to grant Granted Mar 31, 2026
Patent 12584132
NUCLEIC ACID DRUG TARGETING MURF1
2y 5m to grant Granted Mar 24, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
75%
Grant Probability
86%
With Interview (+11.3%)
2y 7m
Median Time to Grant
Moderate
PTA Risk
Based on 1432 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month