Prosecution Insights
Last updated: April 19, 2026
Application No. 17/603,439

METHOD FOR DETECTING SPECIFIC NUCLEIC ACIDS IN SAMPLES

Final Rejection §103§112
Filed
Oct 13, 2021
Examiner
TURPIN, ZACHARY MARK
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Genepath Diagnostics Inc.
OA Round
2 (Final)
0%
Grant Probability
At Risk
3-4
OA Rounds
3y 2m
To Grant
0%
With Interview

Examiner Intelligence

Grants only 0% of cases
0%
Career Allow Rate
0 granted / 11 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
61 currently pending
Career history
72
Total Applications
across all art units

Statute-Specific Performance

§101
9.0%
-31.0% vs TC avg
§103
30.8%
-9.2% vs TC avg
§102
19.7%
-20.3% vs TC avg
§112
25.3%
-14.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 11 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group II (Claim 42), drawn to a kit comprising TSP probes and PCR primer and ligase/polymerase in the reply filed on March 19, 2025 is acknowledged. Applicant’s elections: “PIDS comprise nucleotide sequences (SEQ ID NOs: 175-259) from Appendix A” and “SIDS comprise nucleotide sequences (SEQ ID NOs: 260-344) from Appendix B” in the reply filed on March 19, 2025 are acknowledged. Claim Status and Action Summary This action is in response to the papers filed on November 5, 2025. Claims 1, 42, 46-53, 56-57, and 59-63 are pending in this application. Claims 2-41, 43-45, 54-55, and 58 were canceled by applicant prior to this action. Claims 46-63 were added with the reply filed on March 19, 2025. Claim 1 is withdrawn as directed to a non-elected invention. Claims 47, 49-50, and 52 are withdrawn as directed to non-elected species because applicant elected: “PIDS comprise… SEQ ID NOs 175-259” and “SIDS comprise… SEQ ID NOs 260-344”. Claims 42, 46, 48, 51, 53, 56-57, and 59-63 are under examination. Any objections and rejections not reiterated below are hereby withdrawn. The objections of record to the specification have been withdrawn in view of the substitute specification submitted with the November 5, 2025 response. The objections of record to claim 42 have been withdrawn in view of the amendment deleting the repeated claim term. The rejections of record under 35 U.S.C. 102 have been withdrawn in view of the amendments to the claims. Effective Filing Date The present application, filed on October 13, 2021 is a 371 of PCT/US2020/029622, filed on April 23, 2020, and claims foreign priority to INDIA 201941016190, filed on April 24, 2019. A certified translation of the foreign priority document was submitted on October 13, 2021. Therefore, the priority date of the present application is determined to be April 24, 2019. Claim Objections Claims 46, 48, 51, and 53 are objected to because of the following informalities: the claims contain the apparent typographical (transposition) error: “…comprises distinct a nucleotide sequence…” and has been interpreted as “…comprises a distinct nucleotide sequence…” Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 46, 48, 51, and 53 are/remain rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, regards as the invention. Claims 46 and 48 each recite the limitation “the PIDS [1 or 2, respectively] comprise distinct a nucleotide sequence selected from one of SEQ ID NOs 175-259” as amended on 11/05/2025. The specification teaches that said sequences are “exemplar SOA (first PCR primer) constructs” (Specification, pages 93-95 “Appendix A) consisting of a constant 29 nt sequence at the 5’ end, a variable 12 nt sequence, and a constant 14 nt sequence at the 3’ end of the sequence. It is unclear whether the claim language “comprise distinct a nucleotide sequence selected from one of SEQ ID NOs 175-259” is intended to require that the PIDS component of the TSP1/2 or the first/second PCR primer comprises the entirety of a recited SEQ ID (i.e. the PIDS 1 or 2 is 55nt in length as shown in the recited SEQ IDs) OR whether the claim is intended to encompass that the PIDS may be some fragment (for example, the variable 12-mer) selected from any of the longer recited sequences. It is therefore unclear what is encompassed by the claim limitation “the PIDS [1 or 2, respectively] comprise distinct a nucleotide sequence selected from one of SEQ ID NOs 175-259” and the metes and bounds of the claims are indefinite. Claims 51 and 53 are similarly indefinite because they recite the claim limitation “the SIDS [1 or 2, respectively] comprise distinct a nucleotide sequence selected from one of SEQ ID NOs 260-344”. The specification teaches that the recited sequences are “exemplar SOB (second PCR primer) constructs” (Specification, pages 95-96 “Appendix B) consisting of a constant 24 nt sequence at the 5’ end, a variable 12 nt sequence, and a constant 19 nt sequence at the 3’ end. It is unclear whether the claim language “comprise distinct nucleotide sequences selected from” is intended to require that the SIDS component of the TSP1/2 or the first/second PCR primer comprises the entirety of a recited SEQ ID (i.e. the SIDS 1 or 2 is 55nt in length as shown in the recited SEQ IDs) OR whether the claim is intended to encompass that the PIDS may be some fragment (for example, the variable 12-mer) selected from any of the longer recited sequences. It is therefore unclear what is encompassed by the claim limitation “the SIDS [1 or 2, respectively] comprise distinct nucleotide sequences selected from SEQ ID NOs 260-344” and the metes and bounds of the claims are indefinite. Response to arguments The response asserts “particular elements of the claims (e.g., SIDS1, etc.) comprise (i.e. include) one of the recited sequences. Thus, for example, the PIDS1 element can include a sequence selected from one of SEQ ID NO: 175-259.” This argument/amendment does not resolve the 112(b) indefiniteness issue of record. Throughout the specification, for example in: “Table 1. Exemplar TSP1 constructs” [comprising PIDS] AND “Table 3. Exemplar SOA (first PCR primer) sequence)” [comprising SIDS], the “PIDS” and “SIDS” element is an 8- or 12- nucleotide barcode sequence, respectively, positioned between other elements that together comprise one of the primers used in the invention (tables reproduced in part below for convenience) PNG media_image1.png 228 808 media_image1.png Greyscale PNG media_image2.png 190 770 media_image2.png Greyscale Furthermore, the sequence recited as an “Exemplar SOA (first PCR primer) sequence” comprising from 5’ to 3’ a Tethering adapter sequence (SEQID NO: 63), a SIDS1, and a Common Adapter sequence (SEQ ID NO: 65), 5’-AATGATACGGCGACCACCGAGATCTACAC-[SIDS1]-TCGTCGGCAGCGTC-3’ is identical in form to the sequence SEQ ID NOs: 175-259, recited by the claims as “PIDS1 comprises distinct a nucleotide sequence selected from one of SEQ ID NOs: 175-259”. SEQ ID NO: 175 (reproduced here with TA1 and CA1 underlined and the “SIDS1” sequence in brackets for convenience): AATGATACGGCGACCACCGAGATCTACAC-[AACAACAACACC]-TCGTCGGCAGCGTC. Therefore, it is unclear how a PIDS or SIDS sequence is intended to comprise the entirety of any of the sequences SEQ ID NOs 175-259, as the PIDS and SIDS barcode sequences are clearly comprised by the primers of SEQ ID NOs 175-259. Appropriate correction is required. Applicant is reminded that no new matter may be added by amendment. Claims 42, 46, 48, 51, 53, 56-57, and 59-63 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, regards as the invention. This rejection is necessitated by claim amendments field on 11/05/2025. Amended claim 42 filed on 11/05/2025 recites “wherein the TSS1 or the TSS2 hybridizes to one or more nucleotide sequences associated with a genetic disorder selected from spinal muscular atrophy, Duchenne muscular dystrophy, Becker muscular dystrophy, alpha thalassemia, microdeletion and microduplication syndromes associated with neurodevelopmental disorder, autism, atypical hemolytic uraemic syndrome, beta thalassemia, congenital adrenal hyperplasia, thrombophilia, lysosomal storage disorders, Prader- Willi syndrome, Angelmann syndrome. Beckwith-Wiedemann syndrome, Silver-Russell Syndrome, or fragile-X syndrome; or an infectious disease caused by chikungunya virus, dengue virus, plasmodium, Zika, cytomegalovirus, Epstein-Barr virus, herpes simplex virus, varicella zoster virus, adenovirus, human immunodeficiency virus, hepatitis B virus, hepatitis C virus, human papillomavirus, Neisseria gonorrhoeae (NG), Chlamydia trachomatis (CT), Trichomonas vaginalis (TV), Mycoplasma sp., influenza virus, S. pneumoniae, K. pneumonia, S. aureus, Salmonella, fungus, Pseudomonas, E. coli, Proteus, Acinetobacter, influenza A virus subtype H1N1, or severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2).”. The metes and bounds of the limitation “one or more nucleotide sequences associated with a genetic disorder selected from ---" are unclear because none of the genetic disorder listed has a known underlying etiology of a single gene mutation and/or de-regulation of a single gene expression. It is unclear what criteria are used to determine which nucleotide sequence(s) is/are associated with a given genetic disorder. In this regard, as an example, does the limitation encompass any non-coding sequences in a mammalian genome that regulate gene expression? Claims 46, 48, 51, 53, 56-57, and 59-63 depend from claim 42. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 42 and 59-63 are rejected under 35 U.S.C. 103 as being unpatentable over Shum (US 2017/0342465 A1, published November 30, 2017) in view of NCBI reference sequence NC_001806.2 (published August 2, 2011), Colgrove et al., “History and genomic sequence analysis of the herpes simplex virus 1 KOS and KOS 1.1 sub-strains” Virology Volume 487, January 2016, pages 215-221, and Arkblad et al., “Multiplex ligation-dependent probe amplification improves diagnostics in spinal muscular atrophy” Neuromuscular Disorders 16 (2006) 830-838. This rejection has been updated from an anticipation-type rejection under 35 U.S.C. 102(a)(1) of record in the preceding office action to an obviousness-type rejection under 35 U.S.C. 103 as necessitated by the amendments to the claims. Regarding claim 42, Shum teaches a kit for determining the abundance of a plurality of target sequences in one or more samples (Shum, paragraphs 0042-0046). Shum teaches that the kit comprises: A set of first primers comprising stochastic or defined barcodes comprising, from the 5’ to 3’ end, a universal label (i.e. a common adaptor), a molecular label (i.e. a PIDS1), and a target-specific sequence (Shum, paragraphs 0042-0046, 0065, and 0178-0179). A set of second primers comprising stochastic or defined barcodes comprising, from the 5’ to 3’ end, a universal label (i.e. a common adaptor), a molecular label (i.e. a PIDS2), and a target-specific sequence (Shum, paragraphs 0042-0046, 0065, and 0178-0179). A set of third primers comprising from the 5’ end to the 3’ end, an Illumina sequencing adapter (i.e. a tethering adapter), a sample index (i.e. a SIDS1), and a primer against the common adapter (Shum, paragraphs 0165-0167). A set of fourth primers comprising from the 5’ end to the 3’ end, an Illumina sequencing adapter (i.e. a tethering adapter), a sample index (i.e. a SIDS2), and a primer against the common adapter (Shum, paragraphs 0165-0167). Shum additionally teaches amplifying target nucleic acid molecules by PCR (i.e. with a polymerase) (Shum, paragraphs 0160-0161). Shum teaches the target nucleotide sequences are derived from (i.e. associated with) cancer cells or virus infected cells (i.e. an infectious disease) (Shum, paragraph 0217 and 0218). Shum teaches the cancer cells comprise prostate cancer or colon cancer and the infected cells comprise virus infected cells as well as other parasites such as fungi. (Shum, paragraph 0217) Shum does not teach that the target nucleotide sequences are viral oligonucleotides associated with an infectious disease selected from the list recited in claim 46. However, the complete nucleotide sequence of all of the recited viruses are known. For example, the complete nucleotide sequence of a number of herpes simplex virus (i.e. HSV-1; HHV-1) subtypes are known, such as the complete genome sequence of HHV-1 strain 17, publicly available from NCBI as reference sequence NC_001806.2. Furthermore, HHV1-specific PCR primers are very well known in the art, for example, the ICP8 (infected cell protein 8) primers taught by Colgrove et al. (page 220, column 1). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have selected, for example, the well-known ICP8 primers taught by Colgrove et al. as “primers specific for viral [HHV-1] DNA” as the “target-specific sequence” in the first primers taught by Shum for the detection of viral oligonucleotides in infected cells (i.e. nucleotides associated with an infectious disease; herpes simplex virus). The ordinary artisan would have been motivated to select target-specific sequences from the published HHV-1 genome, for example the known ICP8 primers taught by Colgrove et al. because of the teaching of Shum that the target-specific sequences can be used to identify virus infected cells and the teaching of Colgrove et al. that said ICP8 primers are specific for HHV-1 nucleic acids. Shum does not teach that the target nucleotide sequences are associated with a genetic disorder selected from the list recited by claim 42. However, Arkblad et al. teach several target-sequence specific primer sequences for sequencing of the SMN genes and diagnosis of spinal muscular atrophy (Arkblad et al., page 831, column 2, paragraph 3 and table 2). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have selected any of the known SMN-specific primer sequences as the target-specific sequence in the primers taught by Shum for sequencing of the SMN genes and diagnosis of spinal muscular atrophy. The ordinary artisan would have been motivated to select the target-specific, spinal muscular atrophy associated nucleotide sequences taught by Arkblad et al. because of the teaching of Arkblad et al. that sequencing of the SMN genes allows for the identification of novel allelic variation associated with the genetic disorder spinal muscular atrophy in addition to the diagnostic value of the known copy number variation in SMN genes associated with spinal muscular atrophy (Arkblad et al., page 836, column 1, paragraphs 3-5). Regarding claim 59, Shum teaches the molecular label and/or sample label (i.e. the PIDS and/or SIDS) can be 5-20 nucleotides in length (i.e. 4-21 nucleotides in length) (Shum, paragraph 0007). Regarding claims 60-61, Shum teaches the molecular labels (i.e. the PIDS1 and PIDS2) targeting the same sequence can comprise the same or different sequences from each other (Shum, paragraphs 0033-0034). Regarding claims 62-63, Shum teaches the sample labels (i.e. the SIDS1 and SIDS2) targeting the same sequence can comprise the same or different sequences from each other (Shum, paragraphs 0033-0034). Claims 42, 46, 48, 51, 53, and 56 are rejected under 35 U.S.C. 103 as being unpatentable over Kitson et al. in view of Illumina Document 1000000002694 v01, published February 2016, Kennedy et al., “Detecting ultralow-frequency mutations by Duplex Sequencing”, Nature Protocols 9, 2586-2606, published October 9, 2014, NCBI reference sequence NC_001806.2 (published August 2, 2011), Colgrove et al., “History and genomic sequence analysis of the herpes simplex virus 1 KOS and KOS 1.1 sub-strains” Virology Volume 487, January 2016, pages 215-221, and Arkblad et al., “Multiplex ligation-dependent probe amplification improves diagnostics in spinal muscular atrophy” Neuromuscular Disorders 16 (2006) 830-838. This rejection has been updated as necessitated by the amendments to the claims. Regarding claim 42, Kitson et al. teach a set of first primers comprising, from the 5’ to 3’ end, a “Bridge sequence and sequencing primer binding site (i.e. a Common adaptor, CA1), a forward Molecular identification tag “Fwd MID1” (i.e. a probe identification sequence; PIDS1), and a Forward Primer specific to a gene region of interest (i.e. a target specific sequence; TSS1). Kitson additionally teaches set of second primers comprising, from the 5’ end to the 3’ end, a “Bridge sequence and sequencing primer binding site (i.e. a Common adaptor; CA2), a reverse Molecular identification tag “Rev MID1” (i.e. a probe identification sequence; PIDS2), and a Reverse Primer specific to a gene region of interest (i.e. a target specific sequence; TSS) (Kitson et al., Figure 1). Kitson et al. further teach a set of third primers comprising from the 5’ end to the 3’ end, an Illumina Read1 adapter (i.e. a first tethering adapter), a forward MID2 (i.e. a SIDS1), and a bridge sequence (i.e. a sequence corresponding to CA1) (Kitson et al., Figure 1). Kitson et al. further teach a set of fourth primers comprising from the 5’ end to the 3’ end, an Illumina Read2 adapter (i.e. a second tethering adapter), a reverse MID2 (i.e. a SIDS2), and a bridge sequence (i.e. a sequence corresponding to CA2) (Kitson et al., Figure 1). Finally, Kitson et al. teach amplifying template DNA by PCR (i.e. PNG media_image3.png 327 789 media_image3.png Greyscale with a polymerase). Kitson et al. further teach the TSS1 and TSS2 amplify (i.e. hybridize to) the Cytochrome C Oxidase subunit I barcode region (coxI), allowing for the identification of parasites present in a sample of a population of sample organisms (i.e. nucleotide sequences associated with an infectious disease) (Kitson et al., page 4, paragraphs 2-3). Kitson further teaches that these primer sets are useful for studying complex populations of genetic sequences (Kitson et al., page 9, paragraph 6-8). Kitson et al. do not teach the target nucleotide sequences are viral oligonucleotides associated with an infectious disease selected from the list recited in claim 46. However, the complete nucleotide sequence of all of the recited viruses are known. For example, the complete nucleotide sequence of a number of herpes simplex virus (i.e. HSV-1; HHV-1) subtypes are known, such as the complete genome sequence of HHV-1 strain 17, publicly available from NCBI as reference sequence NC_001806.2. Furthermore, HHV1-specific PCR primers are very well known in the art, for example, the ICP8 (infected cell protein 8) primers taught by Colgrove et al. (page 220, column 1). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have selected, for example, the well-known ICP8 primers taught by Colgrove et al. as “primers specific for viral [HHV-1] DNA” as the “target-specific sequence” in the first primers taught by Kitson et al. for the detection of viral oligonucleotides in infected cells (i.e. nucleotides associated with an infectious disease; herpes simplex virus). The ordinary artisan would have been motivated to select target-specific sequences from the published HHV-1 genome, for example the known ICP8 primers taught by Colgrove et al. because of the teaching of Colgrove et al. that said ICP8 primers are specific for HHV-1 nucleic acids. Kitson et al. do not teach that the target nucleotide sequences are associated with a genetic disorder selected from the list recited by claim 42. However, Arkblad et al. teach several target-sequence specific primer sequences for sequencing of the SMN genes and diagnosis of spinal muscular atrophy (Arkblad et al., page 831, column 2, paragraph 3 and table 2). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have selected any of the known SMN-specific primer sequences as the target-specific sequence in the primers taught by Kitson et al. for sequencing of the SMN genes and diagnosis of spinal muscular atrophy. The ordinary artisan would have been motivated to select the target-specific, spinal muscular atrophy associated nucleotide sequences taught by Arkblad et al. because of the teaching of Arkblad et al. that sequencing of the SMN genes allows for the identification of novel allelic variation associated with the genetic disorder spinal muscular atrophy in addition to the diagnostic value of the known copy number variation in SMN genes associated with spinal muscular atrophy (Arkblad et al., page 836, column 1, paragraphs 3-5). Regarding claim 59, Kitson et al. teach that the MID sequences are 8 nucleotides long (i.e. the PIDS1/2 and/or SIDS1/2 are between 4 and 21 nucleotides in length) (Kitson et al., page 2, paragraph 2). Regarding claim 60, Kitson et al. teach that the paired forward MID1 and reverse MID1 (i.e. the PIDS1 and PIDS2 targeting the same sequence) comprise different sequences to each other (Kitson et al., page 2, paragraph 2). Regarding claim 62, Kitson et al. teach that the paired forward MID2 AND reverse MID2 are different sequences from each other (i.e. the SIDS1 and SIDS2 targeting the same sequence comprise different sequences) (Kitson et al., figure 2). Regarding claims 46, 48, 51, and 53, Kitson et al. teaches first and second primers comprising, from the 5’ to 3’ end: Bridge sequence (Common Adaptors), a “standard Illumina molecular identifier”, and a target-specific sequence (Kitson et al., figure 1 and page 4, paragraph 2). Kitson teaches third and fourth primers comprising from the 5’ to 3’ end: Illumina read 1 (or read 2) adapters (i.e. Tethering adapters), “Standard Illumina molecular identifiers”, and a sequence corresponding to the bridge (i.e. common adapter) sequence. The sequences recited in claims 46 and 48 (SEQ ID NOs: 175-259) have the following formula from the 5’ end to the 3’ end: a common 29 nt sequence, a 12 nt barcode sequence shared with their sequential counterpart in SEQ ID NOs: 260-344 (i.e. the 12 nt barcode in SEQ ID NO: 175 is identical to the 12 nt barcode in SEQ ID NO: 260, etc.), and a common 14 nt sequence. The sequences recited in claims 51 and 53 (SEQ ID NOs: 260-344) have the following formula from the 5’ end to the 3’ end: a common 24 nt sequence, a 12 nt barcode sequence shared with their sequential counterpart in SEQ ID NOs: 175-259, and a common 19 nt sequence. PNG media_image4.png 249 601 media_image4.png Greyscale The 5’ end 29 nt sequence common to all SEQ ID NO: 175-259 is “AATGATACGGCGACCACCGAGATCTACAC”. This 5’ end sequence is identical to the 5’ end of the Illumina Nextera Index Kit: Index 2 Read as well as the Illumina “TruSeq Universal Adapter”. The 3’ end 14 nt sequence common to all SEQ ID NO: 175-259 is “TCGTCGGCAGCGTC”. This 3’ end sequence is identical to the 3’ end of the Illumina Nextera Index Kit: Index 2 Read. (Illumina, page 12, see below). The 5’ end 24 nt sequence common to all SEQ ID NOs: 260-344 is “CAAGCAGAAGACGGCATACGAGAT”. This 5’ end sequence is identical to the 5’ end sequence of the “Index PCR Primers” used in several of the kits disclosed by Illumina including the Nextera Index Kit and the TruSeq DNA Methylation Kit. The 3’ end 19 nt sequence common to all SEQ ID NOs: 260-344 is “GTGACTGGAGTTCAGACGT. This 3’ end sequence is identical to the 3’ end of the “Index PCR Primers” used in the TruSeq DNA Methylation Kit. (Illumina, page 17). The PCR primers taught by Illumina appear to differ from the claimed sequences only in that the intervening 12 nt sequence in the claimed polynucleotide sequences do not appear to comprise the index sequences taught by Illumina, which are 6 or 8 nucleotides in length. However, Kennedy et al. teaches adapters for next-generation sequencing comprising a randomized 12-mer sequence tag (i.e. barcode) on both ends of the sequencing library (Kennedy et al., figure 1). Kennedy et al teaches the method comprising paired 12-mer sequence tags is capable of detecting single mutations among more than 10 million wild-type sequences, enabling the study of heterogenous populations and very low-frequency genetic alterations (Kennedy et al., Abstract). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to modify the primers for nested barcoding comprising standard Illumina adapter and barcode sequences, taught by Kitson et al., to comprise the conventional primers identical to the 5’ and 3’ end sequences shared by the claimed nucleotide sequences, as taught by Illumina. Furthermore, it would have been obvious to substitute the 8 nucleotide long molecular identifier tags (i.e. barcodes, PIDS/SIDS) taught by Kitson et al. and Illumina with the randomized 12 nucleotide sequence tags taught by Kennedy et al. for identification of single genetic events within a very large population of sequences. The ordinary artisan would have been motivated to modify the nested barcoding primers comprising primer- and sample- specific molecular identifiers (i.e. PIDS and SIDS) taught by Kitson et al. to comprise the standard sequencing primer sequences taught by Illumina, and/or the randomized 12 nucleotide sequence tags (i.e. molecular identifiers, barcodes, PIDS/SIDS) taught by Kennedy et al. because both Kitson et al. and Kennedy et al. teach that paired-end barcoding with unique combinations of barcode sequences increases the number of unique library molecules that can be identified in a given sequencing experiment as well as allows for increased library multiplexing on a single sequencing run (Kitson et al., page 2, paragraph 2, and Kennedy et al., figure 1 and abstract). The ordinary artisan would have been reasonably confident that incorporating the random 12-mer barcodes into the primers taught by Kennedy would have successfully increased the number of unique genetic sequences that could be observed within a heterogenous population of sequences because combinations of 12 nucleotide long random sequences necessarily encompass more than the ~96 unique combinations taught by Kitson et al. Furthermore, the randomized 12 nucleotide molecular identifier sequences taught by Kennedy et al. necessarily comprise the intervening 12 nucleotide variable sequences in the claimed sequences. Regarding claim 56, Kitson et al. teaches that the target sequences can comprise a sequence corresponding to SNPs and indels (i.e. a genetic aberration… being a single nucleotide polymorphism (SNP), insertion, deletion (indel)…)(Kitson et al., page 9, paragraph 8). Claims 42 and 57 are rejected under 35 U.S.C. 103 as being unpatentable over Kitson et al. in view of Illumina Document 1000000002694 v01, published February 2016, Kennedy et al., “Detecting ultralow-frequency mutations by Duplex Sequencing”, Nature Protocols 9, 2586-2606, published October 9, 2014, NCBI reference sequence NC_001806.2 (published August 2, 2011), Colgrove et al., “History and genomic sequence analysis of the herpes simplex virus 1 KOS and KOS 1.1 sub-strains” Virology Volume 487, January 2016, pages 215-221, and Arkblad et al., “Multiplex ligation-dependent probe amplification improves diagnostics in spinal muscular atrophy” Neuromuscular Disorders 16 (2006) 830-838, as applied to claims 42, 46, 48, 51, 53 and 56 above, and further in view of Koshinsky et al., US 2018/0258476 A1 (Published September 13, 2018). This rejection has been updated as necessitated by the amendments to the claims. Regarding claim 42, Kitson et al. teach a set of target specific probes comprising, from the 5’ to 3’ end, a “Bridge sequence and sequencing primer binding site (i.e. a Common adaptor, CA1), a forward Molecular identification tag “Fwd MID1” (i.e. a probe identification sequence; PIDS1), and a Forward Primer specific to a gene region of interest (i.e. a target specific sequence; TSS1). Kitson additionally teaches set of second target specific probes comprising, from the 5’ end to the 3’ end, a “Bridge sequence and sequencing primer binding site (i.e. a Common adaptor; CA2), a reverse Molecular identification tag “Rev MID1” (i.e. a probe identification sequence; PIDS2), and a Reverse Primer specific to a gene region of interest (i.e. a target specific sequence; TSS) (Kitson et al., Figure 1). Kitson et al. further teach a set of first PCR primers comprising from the 5’ end to the 3’ end, an Illumina Read1 adapter (i.e. a first tethering adapter), a forward MID2 (i.e. a SIDS1), and a bridge sequence (i.e. a sequence corresponding to CA1) (Kitson et al., Figure 1). Kitson et al. further teach a set of second PCR primers comprising from the 5’ end to the 3’ end, an Illumina Read2 adapter (i.e. a second tethering adapter), a reverse MID2 (i.e. a SIDS2), and a bridge sequence (i.e. a sequence corresponding to CA2) (Kitson et al., Figure 1). Finally, Kitson et al. teach amplifying template DNA by PCR (i.e. PNG media_image5.png 404 975 media_image5.png Greyscale with a polymerase). Kitson et al. do not teach that the second target specific probe (TSP2) is reversed in polarity (i.e. that the sequence rather comprises from the 5’ end to the 3’ end a target specific sequence, and a common adapter. However, Koshinsky et al. teaches kits comprising probes designed to detect specific target sequences comprising a first probe complementary to a 5’ end of a target sequence with a 5’ overhang comprising a universal primer sequence and a second probe complementary to a target sequence 3’ of the first target sequence with a 3’ overhang comprising a universal primer sequence. Koshinsky et al. teaches that the two probes are hybridized to a target sequence, ligated together on the target sequence, and the resulting ligated probe is amplified by PCR with primers comprising sequencing adapters, barcodes (i.e. PIDS), and sequences that anneal to the universal primer sequence at either end of the ligated probes (Koshinsky et al. figure 1). Therefore, it would have been prima facie obvious prior to the effective filing date of the claimed invention for one of ordinary skill in the art to have modified the first and second sets of primers taught by Kitson et al. by reversing the sequence polarity of the second primer such that the primer 1 (i.e. the TSP1) and the reversed primer 2 (i.e. the TSP2) anneal to the same strand of the target molecule, allowing for discrimination between SNPs at the ligation junction of the two probes on a target molecule as taught by Koshinsky et al. (Koshinsky et al., paragraph 0060-0069). The ordinary artisan would have been motivated to modify the first and second PCR primers taught by Kitson et al. to identify a given sequence by selective ligation as taught by Koshinsky et al. because Koshinsky et al. teaches that ligation between adjacent probes allows for reduction in bias due to reverse transcription when assaying complex populations of RNA molecules and allows for targeted analysis of a subset of loci of interest rather than the entire population of all possible variants at a locus (Koshinsky et al., paragraph 0240). The ordinary artisan would have been reasonably confident that such a modification to the primers of Kitson et al. would have successfully targeted a subset of sequence variants within a given locus because Koshinsky et al. teaches that in the absence of a targeted SNP, probes designed to anneal to neighboring sequences do not ligate and resulting library molecules are not produced in the subsequent PCR amplification (Koshinsky et al., figure 15A). Regarding claim 57, Koshinsky teaches that the 5’ end of the second complementary probe (i.e. the TSP2) is phosphorylated (Koshinsky, paragraph 0376). Response to arguments The response summarizes the 103 rejections of record and asserts: “Applicant respectfully disagrees. Nonetheless, without acquiescing to the rejection a[n]d solely to advance prosecution, claim 42 is amended to recite the genetic disorders and infectious diseases of claim 55. In view of the amendments, please withdraw the rejections.” The 103 rejections have been updated to address the amended claims now requiring that the TSS1 or the TSS2 hybridizes to one or more nucleotide sequences associated with a genetic disorder or infectious disease. This limitation was previously recited in the alternative to the previously rejected “associated with a cancer… or…” recited by claim 55, now canceled and incorporated into base claim 42. Conclusion No claim is allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ZACHARY MARK TURPIN whose telephone number is (703)756-5917. The examiner can normally be reached Monday-Friday 8:00 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Winston Shen can be reached at 5712723157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Z.M.T./Examiner, Art Unit 1682 /WU CHENG W SHEN/Supervisory Patent Examiner, Art Unit 1682
Read full office action

Prosecution Timeline

Oct 13, 2021
Application Filed
Apr 30, 2025
Non-Final Rejection — §103, §112
Nov 05, 2025
Response Filed
Jan 20, 2026
Final Rejection — §103, §112 (current)

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
0%
Grant Probability
0%
With Interview (+0.0%)
3y 2m
Median Time to Grant
Moderate
PTA Risk
Based on 11 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month