DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
PriorityAcknowledgement is made of Applicant’s National Stage entry of PCT Application
PCT/CA2020/050497 filed on 4/14/2020, and Applicant’s claim to Domestic Benefit of provisional application 62/837958 filed on 4/24/2019.
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Election/Restrictions
Applicant’s election without traverse of species: SEQ ID NO: 3 in the reply filed on Mar 07, 2025, was previously acknowledged.
Claim Amendments
This action is in response to papers filed on 10/01/2025 in response to the Non-final Office Action dated 6/3/2025. All the amendments have been thoroughly reviewed and entered.
No new claims have been added or any claims cancelled.
Applicant has amended claims 1, 3, 12, 14, 23, and 25 to overcome:
the §101 rejection of claims 1 – 32; the §101 rejection of claims 1 – 32 is withdrawn.
the 35 USC § 112 rejections:
i. the 112(b) rejections of claims 1-3, 5-14,16-23, 27-28, and 31-32 is withdrawn; the 112(b) rejections of claims 4, 15, and 26 are maintained because these claims have not been amended;
ii. the 112(a) scope of enablement rejection of claims 1 -32 is maintained. 112(a) scope of enablement rejection has been rewritten to incorporate the reference provided by Applicant.
the 35 USC § 103 rejections; the 35 USC § 103 rejection of claims 1-32 is maintained.
Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for the reasons set forth at the end of this office action.
Status of Claims
Claims 1-32 are under consideration.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4, 15, and 26 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 4, 15, and 26, the claims recite, “A method … nuclease inhibitor dsRNA selected from the group consisting of: …(iii) at least 21 consecutive nucleotides of the nucleotide sequence as set forth in SEQ ID No: 14…and 15”. While the claims recite a “dsRNA”, the SEQ ID NOs listed as the dsRNA in the sequence listing are disclosed as DNA. Thus, one of ordinary skill in the art would not be reasonably apprised of the scope of the invention.
Claim Interpretation
Regarding claims 1, 12, and 23, the claims recite, “A method of … transcribed from the nucleotide sequence of said dsRNA selected from the group consisting of: …(iii) at least 21 consecutive nucleotides of the nucleotide sequence as set forth in SEQ ID No: 3(Pc3)”. The claim is being given the Broadest Reasonable Interpretation (BRI) according to MPEP 2111.01 and in accordance with the disclosure to mean that the claim encompasses a dsRNA wherein at least 21-nucleotides are complementary to at least a portion of the plant pest transcript, wherein the dsRNA is encoded by a nucleotide sequence selected from the group consisting of……
Regarding claims 4, 15, and 26, the claims recite, “The method … the nucleotide sequence of said dsRNA selected from the group consisting of: … at least 21 consecutive nucleotides of the nucleotide sequence as set forth in SEQ ID No: 14…SEQ ID NO: 15”. The claim is being given the Broadest Reasonable Interpretation (BRI) according to MPEP 2111.01 and in accordance with the disclosure to mean that the claim encompasses a dsRNA wherein at least 21-nucleotides are complementary to at least a portion of the plant pest nuclease, wherein the dsRNA is encoded by a nucleotide sequence selected from the group consisting of……SEQ ID NO: 14 / 15.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 1-32 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
Regarding claims 1, 12, and 23: A method of pest control for flea-beetles by inducing RNAi by feeding a full length dsRNA encoded by SEQ ID NO: 3 or feeding said dsRNA in combination with other nuclease inhibitors of flea beetle RNAses as recited;
Regarding claims 4, 15, and 26: the method of pest control specifically for flea-beetles by inducing RNAi by co-administering a full-length dsRNA encoded by SEQ ID NO: 14 or 15, in combination with the full length dsRNA sequences encoded by SEQ ID NO: 3 above;
does not reasonably provide enablement for:
the instant breadth of nucleic acid sequences consisting of any 21 nucleotides from the elected sequence i.e., SEQ ID NO: 3.
the instant breadth of nucleic acid sequences consisting of any 21 nucleotides from the recited sequences of nuclease inhibitors i.e., SEQ ID NO: 14 or 15.
The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
Factors to be considered in a determination of lack of enablement include, but are not limited to:
(A) The breadth of the claims;
(B) The nature of the invention;
(C) The state of the prior art;
(D) The level of one of ordinary skill;
(E) The level of predictability in the art;
(F) The amount of direction provided by the inventor;
(G) The existence of working examples; and
(H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure.
In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988)
Breadth of the Claims
The instant claims are directed to:
(i) any nucleic acid sequence comprising SEQ ID NO: 3, wherein the nucleic acid sequence is up to 353 nucleotides in length (i.e. 21 nucleotides of SEQ ID NO: 3 that must correspond to a target plus 353-21=332 non-specific nucleotides)
(ii) or the complement of the above
(iii) or the combination of (i) with any other similarly derived sequence (as recited in claims 30-32);
(i) any nucleic acid sequence comprising SEQ ID NO: 14 or 15 corresponding to nuclease inhibitors, wherein the nucleic acid sequence is up to 280 nucleotides in length (i.e. 21 nucleotides of SEQ ID NO: 14 or 15 that must correspond to a target plus 280-21=259 non-specific nucleotides)
(ii) or the complement of the above
The specification hypothesizes that the instant sequences may act via controlling pests via RNAi. However, instant independent claims 1, 12, and 24 read on a single stranded oligomer and a huge genus of sequences with minimal specificity to any target. Similarly, instant dependent claims 4, 15, and 26 read on a single stranded oligomer and a huge genus of sequences with minimal specificity to any target.
State of the Prior Art
Yamaguchi (Yamaguchi J, Mizoguchi T, Fujiwara H (2011), PloS ONE 6(9): e25469.) present rules for designing short siRNA sequences targeting genes in insects. The rules are summarized in Fig. 1 shown below and the paragraph following the figure and legend corresponding to the figure (Rules A – H).
PNG
media_image1.png
405
669
media_image1.png
Greyscale
Bolognesi’s teachings (Bolognesi R., 2012, PLoS ONE 7(10): e47534), which post-date Yamaguchi, show that dsRNAs less than 60 nt failed to enter the gut cells efficiently but a 240 bp dsRNA was effective at inducing systemic knockdown of the targeted mRNA in leaf pests (abstract). Bolognesi further teaches ingested dsRNAs ≥60 bp, containing an active 27 bp sequence, were shown to be efficacious in 12-day bioassays against SCR, while dsRNAs <60 bp did not result in relatively high mortality in 12-day bioassays (pg. 5, left column). Bolognesi further hypothesize that a 240 bp dsRNA would produce 100’s of siRNAs (post in-vivo processing) (pg. 5, right column).
Thus, the prior art is helpful in providing direction for i) short siRNAs that follow certain rules of design and ii) 240bp dsRNA as carriers of short sequences of complementarity to target genes. It can also be concluded from the prior art that there is unpredictability in any random sequence of at least 21-bp functioning as effective siRNA agents.
Direction or Guidance Presented and Present Working Examples
In Example 1 applicants show that they were successful in knocking-down known prior art targets, snf7 and vATPase in flea beetles, when the flea beetles were fed dsRNA to these targets albeit with some cross-species reactivity (Table 1). In Example 2 applicants show that a transcriptomic analyses of flea beetle genes identified 74 genes that were common between the two species of flea beetles tested: P. striolata and P. cruciferae and 143 genes did not share similarity of 21-nt length sequences with other beetle species. In Example 3 applicants show that some dsRNA topically applied to canola leaves killed feeding flea beetles more efficaciously than others (Figure 2). In Example 4 applicants show topically-applied dsRNAs on canola leaves reduces leaf consumption by flea beetles, before death of beetles is observed.
In Example 5 applicants show combinations of dsRNAs result in synergism of insecticidal activity. In Example 6 applicants show the flea beetle dsRNA showed no negative impacts on five other insects typically found within canola crops that are predators of flea beetles. In Examples 7-9 applicants show identification of RNAses and that the combinations of dsRNA to canola leaves with dsRNase improved killing of feeding flea beetles. Applicants further extol the dsRNAs described in their experiments were selected on the basis of the lack of shared 21-mer matches (contained within the longer dsRNA sequences) to genes in Genbank, and their selectively for flea beetles was further confirmed by lack of negative impact on other beetles within the cropping system.
Absence of Working Examples, Unpredictability, & Quantity of Experimentation Necessary
Since applicants have not tested any length of nucleotide sequences as the claims recite, and the prior art is limited to showing the efficacy of 24bp siRNA wherein 20bp are complementary to target (Yamaguchi ) and 240-bp dsRNA (Bolognesi), it is unlikely and highly unpredictable that any sequence that comprise shorter sequences (21-nt matching target) as set forth above would act in any specific manner, but would rather more likely be active against a different target wherein the longer portion of the sequences are specific to the different target or be non-specific in general.
Guidance from the MPEP
MPEP 2164.03: Relationship of Predictability of the Art and the Enablement Requirement: In cases involving unpredictable factors, such as most chemical reactions and physiological activity, more may be required. In re Fisher, 427 F.2d 833, 839, 166 USPQ 18, 24 (CCPA 1970) (contrasting mechanical and electrical elements with chemical reactions and physiological activity). See also In re Wright, 999 F.2d 1557, 1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993); In re Vaeck, 947 F.2d 488, 496, 20 USPQ2d 1438, 1445 (Fed. Cir. 1991). This is because in art areas having a high degree of uncertainty (i.e. the unpredictable arts) it is not reasonably predictable from the disclosure of one species, what other species will work.
MPEP 2164.01: Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.
Also, MPEP 2164.01(a): A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993).
Conclusion of Scope of Enablement
Without further guidance, one of skill in the art would have to practice a substantial amount of trial and error experimentation, an amount considered undue and not routine, to practice the instantly claimed invention.
A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)).
Dependent claims are similarly rejected for reciting the same language as independent claims and further, for not rectifying the lack of scope of enablement in the independent claims.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) s 1, 5-8, 12, 16-19, 23, 27-29 are rejected under 35 U.S.C. 103 as being unpatentable over Baum (US 20160230186A1) in view of Crawford (US 20170260522 A1; IDS cites the WO equivalent), both assigned to Monsanto.
Regarding claims 1, 7, 12, 18, 23, and 28, Baum discloses an invention encompassing providing in the diet of Diabrotica species larvae at least one recombinant RNA; wherein ingestion of said recombinant RNA by said Diabrotica species larvae results in mortality or stunting in said Diabrotica species larvae. The claims are broadly drawn to methods and recombinant DNA constructs comprising SEQ ID NOs: 1-15624.
One nucleic acid sequence disclosed by Baum is SEQ ID NO: 8545, which is 1045 nucleotides in length. Shown below is a region of 26 contiguous nucleotides of instant SEQ Id NO: 3 which reads on the complement of Baum’s SEQ ID NO: 8545. Thus, instant dsRNA consisting of SEQ ID NO: 3 would have a sequence that has at least 21 consecutive nucleotides as set forth in Baum’s disclosed sequence. See alignment below:
US-14-207-318A-8545/c
Sequence 8545, US/14207318A
Publication No. US20160230186A1
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
APPLICANT: Baum, James A.
APPLICANT: Bolognesi, Renata
APPLICANT: Segers, Gerrit Cornelis
TITLE OF INVENTION: Compositions and Methods for Controlling Diabrotica
FILE REFERENCE: 38-21(59641)B
CURRENT APPLICATION NUMBER: US/14/207,318A
CURRENT FILING DATE: 2014-03-12
PRIOR APPLICATION NUMBER: 61/782,931
PRIOR FILING DATE: 2013-03-14
NUMBER OF SEQ ID NOS: 15624
SEQ ID NO 8545
LENGTH: 1045
TYPE: DNA
ORGANISM: Diabrotica virgifera
FEATURE:
OTHER INFORMATION: SmartBlast Evalue=9E-79; Info=Ubiquitin-conjugating enzyme n=2
Tax=Endopterygota RepID=Q2Q469_BOMMO
Query Match 7.4%; Score 26; Length 1045;
Best Local Similarity 100.0%;
Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 48 AATTCTGGATTAAAATCATTCCGTGA 73
||||||||||||||||||||||||||
Db 809 AATTCTGGATTAAAATCATTCCGTGA 784
While the sequence is directed to Diabrotica species larvae, it “reads” on a 26-nt contiguous sequence of Phyllotreta sp; i.e., the species recited in the claims.
Further, before the effective filing date of instant application, Crawford discloses methods and dsRNA sequences for controlling insect pests, especially flea beetles, such as Phyllotreta spp., particularly in plants. Crawford provide several embodiments related to a method of causing mortality or stunting in an insect, including topical application of dsRNA formulations to a plant [0011], as required by instant claims 1 and 12; or providing in the diet of an insect at least one polynucleotide including at least one silencing element, wherein the at least one silencing element is essentially identical or essentially complementary to a fragment of a target gene sequence of the insect, and wherein ingestion of the polynucleotide by the insect results in mortality or stunting in the insect [0007], as required by instant claim 23. Crawford further disclose the Phyllotreta spp includes the beetle pests: Phyllotreta striolata (striped flea beetle) and Phyllotreta cruciferae (canola flea beetle) [0037] as required by claims 7, 18, and 28.
Regarding claims 5-6, 16-17, and 27, Crawford discloses a dose to apply on the leaf ([0151] and table 3). The dose is 2ng dsRNA/mg of leaf tissue, which is well above the recited dose of 0.1ng per mm^2.
Regarding claims 8, 19, and 29, Crawford discloses the plant is a cruciferous plant ([0037] In embodiments, the method is useful for causing mortality or stunting in insects that are pests of commercially important crop plants, such as an insect pest of Brassica species). Cruciferous plants belong to the Brassica family.
The ordinary skilled artisan, seeking a pest-control method for Phyllotreta spp. would have been motivated to combine the dsRNA induced pest control teachings of Baum with respect to Diabrotica with the teachings of Crawford with respect to Phyllotreta because Crawford too draw their motivation from previous disclosures of teachings of pest control from studies of Diabrotica spp. which show dsRNAs are effective in silencing pests’ genes and resulting in the death of the pests (Crawford, [0147]). It would have been prima facie obvious for the skilled artisan to make a synthetic design of oligonucleotides as disclosed by Baum and feed it to the Phyllotreta spp as it would have merely amounted to a simple substitution of similar prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that substituting the dsRNA comprising Crawford’s dsRNA with the dsRNA sequence of Baum could be effective and work as predicted because both references teach methods of providing a pest of the order Coleoptera, to which both Diabrotica and Phyllotreta belong, a dsRNA in a preventive approach to halt plant damage by feeding of the plant by the above-mentioned pests. See MPEP 2143 I (B).
Claims 2-3, 13-14, and 24-25 are rejected under 35 U.S.C. 103 as being unpatentable over Baum (US20160230186A1) and Crawford (US 20170260522 A1; IDS cites the WO equivalent) as applied to claims 1, 5-8, 12, 16-19, 23, 27-29 above, and further in view of Raemaekers (US 8906876 B2), cited in IDS of 5/10/2022.
Regarding claims 2-3, 13-14, and 24-25, the dsRNA of Baum and Crawford are taught above.
Neither Baum nor Crawford teach wherein the dsRNA is co-administered with a nuclease inhibitor (claims 2, 13, and 24) or that the nuclease inhibitor targets the nuclease of the species Phyllotreta (claims 3, 14, and 25).
However, before the effective filing date of the instant application, Raemaekers taught (a) several sequences or their complements; (b) the sequences comprise dsRNA; and (c) sequences comprising at least 2 contiguous nucleotides of any of the sequences in a target insect pest; such that when ingested by a plant insect pest the sequences inhibit the growth of the insect pest. Raemaekers taught that the process of gene silencing in the host cell is via a sequence-specific down-regulation of gene expression [10]. Amongst other Orders, one Order of insects to be targeted is Coleoptera [30]. Within this order, the Chrysomelid beetles such as Flea Beetles and Corn Rootworms (Diabrotica) and Curculionids such as Alfalfa Weevils are particularly important pests. Raemaekers taught the importance of target-specificity:
[100]...In the RNA constructs of the invention, multiple dsRNA regions targeting a single or different weak gene(s) may be combined to obtain a stronger RNAi effect. g) "insect specific" genes encompass genes that have no substantial homologous counterpart in non-insect organisms as can be determined by bioinformatics homology searches, for example by BLAST searches. The choice of an insect specific target gene results in a species specific RNAi effect, with no effect or no substantial (adverse) effect in non-target organisms.
Raemaekers taught: the dsRNA may be brought into contact with the target host in one of many ways, such as preparing an extract of the host cells expressing the dsRNA molecule [161]. In such a case, the extract may:
It may also be appropriate to add certain components to the extract, to prevent degradation of the RNA molecules. For example, RNase inhibitors may be added to the extracts derived from the host cells expressing the RNA.
It would have been prima facie obvious to one of ordinary skill in the art before the filing date of the instant application to have co-administered an effective amount of a nuclease inhibitor, specifically one that is specific to the species Phyllotreta, as taught by Raemaekers into the method of Baum and Crawford for the advantage of preserving the life of the preventive dsRNA. The ordinary skilled artisan, would have been motivated to make this combination because the ordinary artisan knows how quickly RNA may be degraded by endogenous RNAses, which in turn would reduce the half-life of the preventive dsRNA. Further, Raemaekers taught that inhibition (by RNAi) is sequence specific, therefore one of skill in the art would pick a nuclease inhibitor that targets the nuclease of the species Phyllotreta. The combination of prior art elements according to known methods to yield predictable results supports a conclusion of obviousness. Given the teachings of the cited references all pertain to the order Coleoptera, specifically, the Chrysomelid beetles, and the level of skill of the ordinary skilled artisan is high, it must be considered, absent evidence to the contrary, that the ordinary skilled artisan would have had a reasonable expectation of success in practicing the claimed invention reached when combining the cited references. See MPEP 2144 II and 2143 I.(A).
Claims 10, 21, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Baum (US20160230186A1), Crawford (US 20170260522 A1; IDS cites the WO equivalent) and Raemaekers (US 8906876 B2), cited in IDS of 5/10/2022as applied to claims 1-2, 5-8, 12-13, 16-19, 23-24, 27-29 above, and further in view of Beattie (US 9777288).
Regarding claims 10, 21, and 31, the method of reducing feeding damage/protecting a plant/killing flea beetles of Baum, Crawford, and Raemaekers are taught above.
Specifically, Baum and Crawford had taught using SEQ ID NO: 3 in the method of RNAi-induced pest control and Raemaekers taught applying a mixture of at least 2 different dsRNA sequences as cited above ([100]).
Neither Baum, Crawford, nor Raemaekers taught wherein the dsRNAs mixture the second dsRNA comprising at least 21 consecutive nucleotides of Pc1, Pc2, Pc4 or Pc5 (claims 10, 21, 31).
However, before the effective filing date of the instant application, Beattie disclosed an invention encompassing providing in the diet of Leptinotarsa species at least one recombinant dsRNA; wherein ingestion of said recombinant RNA by said Leptinotarsa species results in mortality or stunting in said Leptinotarsa species. The claims are broadly drawn to methods and recombinant DNA constructs targeting regions represented by SEQ ID NOs: 1-725. While the sequence is directed to Leptinotarsa species, regions “read” on a 29-nt contiguous sequence (underlined) of Phyllotreta sp.
See alignment of instant SEQ ID NO: 2 with SEQ ID NO: 687 of Beattie:
RESULT 2
US-61-856-137-687/c
(NOTE: this sequence has 9 duplicates in the database searched.
See complete list at the end of this report)
Sequence 687, US/61856137
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
APPLICANT: Beattie, Jodi Lynn
APPLICANT: Crawford, Michael John
APPLICANT: Flagel, Lex Even
APPLICANT: Kapoor, Mahak
APPLICANT: Taylor, Christina Marie
TITLE OF INVENTION: Compositions and Methods for Controlling Leptinotarsa
FILE REFERENCE: 40-21(60191)0000
CURRENT APPLICATION NUMBER: US/61/856,137
CURRENT FILING DATE: 2013-07-19
NUMBER OF SEQ ID NOS: 1086
SEQ ID NO 687
LENGTH: 1445
TYPE: DNA
ORGANISM: Leptinotarsa decemlineata
Query Match 48.0%; Score 166.4; Length 1445;
Best Local Similarity 67.7%;
Matches 233; Conservative 0; Mismatches 111; Indels 0; Gaps 0;
Qy 4 GGACACCACGTTCACCATAAGGGTGGTGGAGCCGCTGAAGAGCGGCTTCAGCGAGCTGAC 63
|| ||||| ||||| || | | || || || |||||||||| || ||| | |
Db 709 GGGAACCACTTTCACAATCCGATTAGTTGAACCAATGAAGAGCGGATTTAGCAGCATATC 650
Qy 64 CCCCAAGCCCAGCAGGGGCAACACGGGGAAGAAAGGCTATGGCAGCGGCAGGGAGACTTT 123
|| || | | || || | ||||||||| ||||| |||||||||||||||||
Db 649 ACCTAATACTGGAAGAGGGTCTTCTGGGAAGAAAATTTATGGTAGCGGCAGGGAGACTTT 590
Qy 124 GAGGTTCAAGGCGGATGGTAACGCGGAGGTGCAGGAGCAGGACGACGCCATGGAGGCGGG 183
|||||||||||| | ||| | ||||| | | || || ||||| | || | ||
Db 589 GAGGTTCAAGGCCGGTGGAGAAGCGGAAATCGAAGAAAGAGATGACGCACTAGATACTGG 530
Qy 184 CGTGGAGAAGATCAATGGGATACTGGAGTCCTTTATGGGTATAAATGATTCGGAGCTGGC 243
| | || || || || || ||||| || || ||||| || |||||||| || || ||
Db 529 CATTGAAAAAATTAACAATATTCTGGAATCGTTCATGGGAATCAATGATTCAGAACTCGC 470
Qy 244 TTCGCAGATATGGGATCTTTCGGTTGATAAGAAGAACTCGATGGACTTTGCGGAAGCGGT 303
| || || |||||| | || | || |||| || ||||| || || ||||| |
Db 469 TAACCAAATTTGGGATATGTCTAAAGGAAAAGAGAATTCCATGGATTTCGCAGAAGCCAT 410
Qy 304 GGACGACTCGGAGTTGGCTGTGTTTGAGTTCACGGATGAGCTGA 347
|||||||| || | || |||||| ||||||||||| || |
Db 409 CGACGACTCCGACCTCGCATCGTTTGAATTCACGGATGAACTCA 366
The ordinary skilled artisan, seeking a pest-control method for Phyllotreta spp. would have been motivated to add into the teachings of Baum, Crawford, and Raemaekers with respect to Phyllotreta, the dsRNA induced pest control teachings of Beattie with respect to Leptinotarsa for the advantage Beattie have shown in the method of pest control using dsRNAs in silencing pests’ genes and resulting in the death of the pests in studies of Leptinotarsa spp. It would have been prima facie obvious for the skilled artisan to introduce a synthetic design of oligonucleotides as disclosed by Beattie and feed it to the Phyllotreta spp in a mixture with SEQ ID NO: 3 in the method of pest control as it would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that combining the dsRNA of Baum, Crawford, and Raemaekers with the dsRNA sequence comprising Beattie’s dsRNA could be effective and work as predicted because all references teach a preventive approach to halt plant damage by feeding a dsRNA to the beetle pests. See MPEP 2143 I (A).
Thus, Baum, Crawford, and Raemaekers in view of Beattie make obvious instant claims 10, 21, and 31 by teaching the mixture of dsRNA is Pc3 and a second dsRNA comprising at least 21 consecutive nucleotides of Pc2.
Claims 11, 22, and 32 are rejected under 35 U.S.C. 103 as being unpatentable over Baum (US 20160230186A1), Crawford (US 20170260522 A1; IDS cites the WO equivalent), Raemaekers (US 8906876 B2, cited in IDS of 5/10/2022), and Beattie (US 9777288) as applied to claims 10, 21, and 31 above, and further in view of Baum II (US 9238822, IDS of 12/08/2023 cites the equivalent WO 2005110068).
Regarding claims 11, 22, and 32, the method of reducing feeding damage/protecting a plant/killing flea beetles of Baum, Crawford, Raemaekers, and Beattie are taught above.
Specifically, Raemaekers taught applying a mixture of at least 2 different dsRNA sequences as cited above ([100]), and Baum, Crawford, Raemaekers, and Beattie have taught using a mixture of SEQ ID NO: 3 and 2 in the method.
Neither Baum, Crawford, Raemaekers, nor Beattie teach wherein the dsRNAs in the mixture is Pc2 and a second dsRNA comprising at least 21 consecutive nucleotides of Pc1,Pc3, Pc4, Pc5, Pc7, Pc9 or Pc10.
However, before the effective filing date of the instant application, Baum II disclosed an invention encompassing providing in the diet of Diabrotica species at least one recombinant dsRNA; wherein ingestion of said recombinant RNA by said Diabrotica species results in mortality or stunting in said Diabrotica species. The claims are broadly drawn to methods and recombinant dsRNA transcribed from a nucleotide sequence selected from the group consisting of SEQ ID NO:1 through SEQ ID NO:20303, SEQ ID NO:40701 through SEQ ID NO:40746, and SEQ ID NO:40607 through SEQ ID NO:40700. While the sequence is directed to Diabrotica species, long stretches (underlined) of regions “read” on Phyllotreta sp.
See alignment of instant SEQ ID NO: 10 with SEQ ID NO: 2120 of Baum:
RESULT 1
US-13-226-353A-2120
Sequence 2120, US/13226353A
Patent No. 9238822
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
APPLICANT: Baum, James A
APPLICANT: Gilbertson, Larry A
APPLICANT: Kovalic, David K
APPLICANT: La Rosa, Thomas J
APPLICANT: Lu, Maolong
APPLICANT: Munyikwa, Tichifa R. I.
APPLICANT: Roberts, James K
APPLICANT: Wu, Wei
APPLICANT: Zhang, Bei
TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR CONTROL OF INSECT INFESTATION IN
TITLE OF INVENTION: PLANTS
FILE REFERENCE: 38-21(53597)
CURRENT APPLICATION NUMBER: US/13/226,353A
CURRENT FILING DATE: 2012-02-27
PRIOR APPLICATION NUMBER: US 60/669,175
PRIOR FILING DATE: 2005-04-07
PRIOR APPLICATION NUMBER: 60560842
PRIOR FILING DATE: 2004-04-09
PRIOR APPLICATION NUMBER: 60565632
PRIOR FILING DATE: 2004-04-27
PRIOR APPLICATION NUMBER: 60579062
PRIOR FILING DATE: 2004-06-11
PRIOR APPLICATION NUMBER: 60603421
PRIOR FILING DATE: 2004-08-20
PRIOR APPLICATION NUMBER: 60617261
PRIOR FILING DATE: 2004-10-11
NUMBER OF SEQ ID NOS: 40774
SEQ ID NO 2120
LENGTH: 1558
TYPE: DNA
ORGANISM: Diabrotica virgifera
FEATURE:
NAME/KEY: misc_feature
LOCATION: (1492)..(1493)
OTHER INFORMATION: n is a, c, g, or t
FEATURE:
NAME/KEY: misc_feature
LOCATION: (1522)..(1522)
OTHER INFORMATION: n is a, c, g, or t
FEATURE:
NAME/KEY: misc_feature
LOCATION: (1540)..(1540)
OTHER INFORMATION: n is a, c, g, or t
Query Match 53.8%; Score 162; Length 1558;
Best Local Similarity 78.7%;
Matches 233; Conservative 0; Mismatches 55; Indels 8; Gaps 3;
Qy 12 ACGTCCAATGAGGTCAATAAAGTAACTAACAGGAACAGTTCCTCTCGCTACAACGTAATT 71
|||||||||||||||||||||||||| || | || ||||||| ||| || | ||| ||
Db 102 ACGTCCAATGAGGTCAATAAAGTAACCAAAAAGA--AGTTCCTGTCGAGACCAAGTACTT 159
Qy 72 TAAAGC---CACCCTGTACACGCCGACAGACTGGAGGGGCACAAGGTCCCTTTGCTATCC 128
||| ||| |||| ||| | |||||||||||||||||||||| |||||||| |||
Db 160 TAAGAGGATCACGCTGTTCACTTCAACAGACTGGAGGGGCACAAGGTGCCTTTGCTTTCC 219
Qy 129 ACGGCGGATCCCCACACGTCGCGGCTGACGCCG---GGCTCCAGTCCGGACATGGACGAT 185
|| |||| || || | || |||| | ||| ||||| ||||| || |||||||||
Db 220 ACTTCGGACCCACAAAGCACGAGGCTAGCTCCGTCCGGCTCTAGTCCAGATATGGACGAT 279
Qy 186 GGGGGCAAGCGGCAGGCCACCAGGGTGTTCAAGAAGAGCTCCCCCAACGGGAAGATCACC 245
|| ||||| || || ||||||||||||||||||||||| ||||| || || ||||| ||
Db 280 GGAGGCAAACGACAAGCCACCAGGGTGTTCAAGAAGAGTTCCCCGAATGGAAAGATTACA 339
Qy 246 GTCTATTTGGGGAAGAGGGACTTCGTCGATCACATATCACACGTGGATCCCATAGA 301
|| ||||| || || || || |||||||| ||||||||| ||| ||||| |||||
Db 340 GTATATTTAGGTAAAAGAGATTTCGTCGACCACATATCATGCGTTGATCCTATAGA 395
The ordinary skilled artisan, seeking a pest-control method for Phyllotreta spp. would have been motivated to substitute SEQ ID NO: 3 in the teachings of Baum, Crawford, and Raemaekers with respect to Phyllotreta, with SEQ ID NO: 10, which is the dsRNA induced pest control teachings of Baum II with respect to Diabrotica, for the advantage Baum II have shown in the method of pest control using dsRNAs in silencing pests’ genes and resulting in the death of the pests in studies of Diabrotica spp. It would have been prima facie obvious for the skilled artisan to introduce a synthetic design of oligonucleotides as disclosed by Baum II and feed it to the Phyllotreta spp in the method of pest control as it would have merely amounted to a simple substitution of similar prior art elements according to known methods to yield predictable results. The skilled artisan would have had a reasonable expectation that substituting the dsRNA of Baum II, Crawford, and Raemaekers with the dsRNA sequence comprising Baum II’s dsRNA could be effective and work as predicted because all references teach a preventive approach to halt plant damage by feeding a dsRNA to the beetle pests. See MPEP 2143 I (B).
Thus, Baum, Crawford, Raemaekers, and Beattie in view of Baum II make obvious instant claims 11, 22, and 32 by teaching the mixture of dsRNA is Pc2 and a second dsRNA comprising at least 21 consecutive nucleotides of Pc10.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Claim Objections
Regarding claims 4, 15, and 26, that recite wherein the nuclease inhibitor is a nuclease inhibitor dsRNA selected from the group consisting of: …SEQ ID NO: 14 and …SEQ ID NO: 15; SEQ ID NO: 14 and 15 are not taught in the prior art of record.
Regarding claims 9, 20, and 30, that recite wherein the dsRNA is a mixture of Pc1 and a second dsRNA comprising at least 21 consecutive nucleotides of Pc2 or Pc3, the particular combination of sequences is not taught in the prior art of record. Specifically, a sequence which consists of 21 contiguous nucleotides of Pc1 (sequence of SEQ ID NO: 1) is not taught in the prior art of record.
Therefore, claims 4, objected to as being dependent upon a rejected base claim, but would be allowable, following any other rejection is corrected, if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Response to Arguments
Applicant's arguments on pgs. 10 – 13, filed 10/01/2025 to §101 rejection of amended claims have been fully considered and are persuasive. Rejection is withdrawn.
Applicant's arguments on pg. 13, filed 10/01/2025 to § 112a Scope of Enablement rejections have been fully considered but they are not persuasive.
Applicants point to specification disclosure where the method of RNAi has been discussed and make reference to paragraphs in the specification that teach this limitation. Then they assert: 1) the claims are directed to 21-mers and the specification discloses that 21-mers have been effectively used to result in mortality of the pest species; and 2) cite the reference of Yamaguchi that successfully used the method of 21-mers to silence genes in insects.
The Remarks are not found persuasive. While the disclosure of instant application and reference that Applicants cite, does show that the applied 21-mer has some efficacy, neither the disclosure nor the cited reference shows that any 21-mer will work as expected. This has been discussed at length in the rewritten Scope of Enablement rejection above, section on Prior Art. The claims are broadly drawn to any 21-mer. Hence, the §112a Scope of Enablement rejection stands.
To elaborate, for e.g.,
I. a portion of SEQ ID NO: 3 matches Phyllotreta striolata genome assembly, chromosome 1; the database shows the matching sequence to be outside the CDS. This raises the question of whether inhibiting a region outside the CDS will have any inhibitory effect on Phyllotreta spp.
CDS join(4631266..4632570,4662308..4663834,4669101..4669684,
4703527..4703560)
Query Match 28.9%; Score 102; Length 4386041;
Best Local Similarity 100.0%;
Matches 102; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 125 GGATAATCCGCCTTACAACAAAGGAGCTTTTAAAATAGAAATTAATTTCCCCGCAGAATA 184
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 4361982 GGATAATCCGCCTTACAACAAAGGAGCTTTTAAAATAGAAATTAATTTCCCCGCAGAATA 4362041
Qy 185 TCCTTTTAAGCCGCCAAAAATAAATTTTAAGACGAAAATTTA 226
||||||||||||||||||||||||||||||||||||||||||
Db 4362042 TCCTTTTAAGCCGCCAAAAATAAATTTTAAGACGAAAATTTA 4362083
II. a random 21bp region of SEQ ID NO: 3 also corresponds to:
Sequence 301438, US/10301480C
Patent No. H002220
GENERAL INFORMATION
APPLICANT: Wang, David G.
TITLE OF INVENTION: Identification and Mapping of Single
TITLE OF INVENTION: Nucleotide Polymorphisms in the Human Genome
FILE REFERENCE: 108827-137
CURRENT APPLICATION NUMBER: US/10/301,480C
CURRENT FILING DATE: 2002-11-21
PRIOR APPLICATION NUMBER: US 10/215,598
PRIOR FILING DATE: 2002-08-09
PRIOR APPLICATION NUMBER: US 60/311,695
PRIOR FILING DATE: 2001-08-10
NUMBER OF SEQ ID NOS: 989478
SEQ ID NO 301438
LENGTH: 999
TYPE: DNA
ORGANISM: Homo sapiens
Query Match 5.9%; Score 21; Length 999;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 135 CCTTACAACAAAGGAGCTTTT 155
|||||||||||||||||||||
Db 676 CCTTACAACAAAGGAGCTTTT 696
wherein Qy = instant SEQ ID NO: 3, Db = instant SEQ ID NO: 301438 found in prior art database. It is not known if this particular 21-bp sequence would have any utility in inhibiting Phyllotreta spp., as claimed.
Applicant's arguments on pgs. 13 - 18, filed 10/01/2025 to § 103 rejections have been fully considered but they are not persuasive.
Applicants provide a thorough discussion on 1) how testing a gene sequence for efficacy is essential to its use as an inhibitory agent because of i) gene redundancy, ii) transcript abundance, iii) regulatory feedback and iv) cellular sensitivity; and 2) point to specification disclosure where several sequences for RNAi have been tested and make reference to paragraphs in the specification that teach this limitation.
This is not found persuasive. Applicants have not pointed out any deficiencies in the applied references. Hence, the §103 rejection is maintained.
Conclusion
No claims are allowed.
THIS ACTION IS MADE FINAL. Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SHABANA S MEYERING/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635