Prosecution Insights
Last updated: October 04, 2026
Application No. 17/605,788

Flea Beetle-Specific RNAI-Based Pesticides

Non-Final OA §103§112
Filed
Oct 22, 2021
Priority
Apr 24, 2019 — provisional 62/837,958 +1 more
Examiner
MEYERING, SHABANA SHABBEER
Art Unit
1635
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
University of Manitoba
OA Round
3 (Non-Final)
71%
Grant Probability
Favorable
3-4
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 71% — above average
71%
Career Allowance Rate
48 granted / 68 resolved
+10.6% vs TC avg
Strong +42% interview lift
Without
With
+42.3%
Interview Lift
resolved cases with interview
Typical timeline
3y 0m
Avg Prosecution
43 currently pending
Career history
119
Total Applications
across all art units

Statute-Specific Performance

§101
7.5%
-32.5% vs TC avg
§103
36.2%
-3.8% vs TC avg
§102
11.0%
-29.0% vs TC avg
§112
31.0%
-9.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 68 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 4/27/2026 has been entered. PriorityAcknowledgement is made of Applicant’s National Stage entry of PCT Application PCT/CA2020/050497 filed on 4/14/2020, and Applicant’s claim to Domestic Benefit of provisional application 62/837958 filed on 4/24/2019. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Election/Restrictions Applicant’s election without traverse of species: SEQ ID NO: 3 in the reply filed on Mar 07, 2025, was previously acknowledged. Claim Amendments This action is in response to papers filed on 4/27/2026 in response to the Final Office Action dated 11/19/2025. All the amendments have been thoroughly reviewed and entered. No new claims have been added, claims 2-4, 7, 18, 20-22, and 28 have been cancelled. Applicant has amended claims to overcome: the 35 USC § 112(b) rejections; the 112(b) rejections of claims 15 and 26 is withdrawn. the 35 USC § 112(a) rejections; the 35 USC § 112(a) rejection of claims 1, 5-6, 8-17,19,23-27, and 29-32 is maintained. the § 103 rejection; § 103 rejection of claims 1, 5-6, 8-17,19,23-27, and 29-32 is withdrawn. Any rejection or objection not reiterated herein has been overcome by amendment. Applicant’s amendments and arguments have been thoroughly reviewed but are not persuasive to place the claims in condition for allowance for the reasons set forth at the end of this office action. Status of Claims Claims 1, 5-6, 8-17,19,23-27, and 29-32 are under consideration. Claim Rejections - 35 USC § 112 Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Emphasis here is on the elected species SEQ ID NO: 3. Claims 1, 5-6, 8-17,19,23-27, and 29-32 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for: Regarding claim 1: A method of pest control of flea-beetles by inducing RNAi by feeding a full length dsRNA encoded by SEQ ID NO: 3 or feeding said dsRNA in combination with other full length dsRNAs AND full length dsRNA encoded by SEQ ID NO: 14 / 15 encoding nuclease inhibitors of flea beetle RNAses, as recited; Regarding claims 12 and 23: A method of pest control of flea-beetles by inducing RNAi by feeding a full length dsRNA encoded by SEQ ID NO: 3 or feeding said dsRNA in combination with other full length dsRNAs, as recited; Regarding dependent claims 15 and 26: the method of pest control specifically for flea-beetles by inducing RNAi by co-administering a full-length dsRNA encoded by SEQ ID NO: 14 or 15, in combination with the full length dsRNA sequences encoded by SEQ ID NO: 3 above; does not reasonably provide enablement for: the instant breadth of nucleic acid sequences consisting of any 21 nucleotides from the elected sequence i.e., SEQ ID NO: 3. the instant breadth of nucleic acid sequences consisting of any 21 nucleotides from the recited sequences of nuclease inhibitors i.e., SEQ ID NO: 14 or 15. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. Factors to be considered in a determination of lack of enablement include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988) Breadth of the Claims The instant claims are broad. They are directed to: (i) any nucleic acid sequence comprising SEQ ID NO: 3, wherein the nucleic acid sequence is up to 353 nucleotides in length (i.e. 21 nucleotides of SEQ ID NO: 3 that must correspond to a target plus 353-21=332 non-specific nucleotides) (ii) or the complement of the above (iii) or the combination of (i) with any other similarly derived sequence (as recited in claims 30-32); (i) any nucleic acid sequence comprising SEQ ID NO: 14 or 15 corresponding to nuclease inhibitors, wherein the nucleic acid sequence is up to 280 nucleotides in length (i.e. 21 nucleotides of SEQ ID NO: 14 or 15 that must correspond to a target plus 280-21=259 non-specific nucleotides) (ii) or the complement of the above The specification hypothesizes that the instant sequences may act via controlling pests via RNAi. However, instant independent claims 1, 12, and 24 read on a single double-stranded oligomer which will be processed into a huge genus of sequences with minimal specificity to any target. Similarly, instant dependent claims 15 and 26 read on two double-stranded oligomers which will also be processed in to a huge genus of sequences with minimal specificity to any target. State of the Prior Art Yamaguchi (Yamaguchi J, Mizoguchi T, Fujiwara H (2011), PloS ONE 6(9): e25469.) present rules for designing short siRNA sequences targeting genes in insects. The rules are summarized in Fig. 1 shown below and the paragraph following the figure and legend corresponding to the figure (Rules A – H). PNG media_image1.png 405 669 media_image1.png Greyscale Bolognesi’s teachings (Bolognesi R., 2012, PLoS ONE 7(10): e47534), which post-date Yamaguchi, show that dsRNAs less than 60 nt failed to enter the gut cells efficiently but a 240 bp dsRNA was effective at inducing systemic knockdown of the targeted mRNA in leaf pests (abstract). Bolognesi further teaches ingested dsRNAs ≥60 bp, containing an active 27 bp sequence, were shown to be efficacious in 12-day bioassays against SCR, while dsRNAs <60 bp did not result in relatively high mortality in 12-day bioassays (pg. 5, left column). Bolognesi further hypothesize that a 240 bp dsRNA would produce 100’s of siRNAs (post in-vivo processing) (pg. 5, right column). Baum (US 20160230186A1) Baum discloses an invention encompassing providing in the diet of Diabrotica species larvae at least one recombinant RNA; wherein ingestion of said recombinant RNA by said Diabrotica species larvae results in mortality or stunting in said Diabrotica species larvae. The claims are broadly drawn to methods and recombinant DNA constructs comprising SEQ ID NOs: 1-15624. One nucleic acid sequence disclosed by Baum is SEQ ID NO: 8545, which is 1045 nucleotides in length. Shown below is a region of 26 contiguous nucleotides of instant SEQ Id NO: 3 which reads on the complement of Baum’s SEQ ID NO: 8545. Thus, instant dsRNA consisting of SEQ ID NO: 3 would have a sequence that has at least 21 consecutive nucleotides as set forth in Baum’s disclosed sequence. See alignment below: US-14-207-318A-8545/c Sequence 8545, US/14207318A Publication No. US20160230186A1 GENERAL INFORMATION APPLICANT: Monsanto Technology LLC APPLICANT: Baum, James A. APPLICANT: Bolognesi, Renata APPLICANT: Segers, Gerrit Cornelis TITLE OF INVENTION: Compositions and Methods for Controlling Diabrotica FILE REFERENCE: 38-21(59641)B CURRENT APPLICATION NUMBER: US/14/207,318A CURRENT FILING DATE: 2014-03-12 PRIOR APPLICATION NUMBER: 61/782,931 PRIOR FILING DATE: 2013-03-14 NUMBER OF SEQ ID NOS: 15624 SEQ ID NO 8545 LENGTH: 1045 TYPE: DNA ORGANISM: Diabrotica virgifera FEATURE: OTHER INFORMATION: SmartBlast Evalue=9E-79; Info=Ubiquitin-conjugating enzyme n=2 Tax=Endopterygota RepID=Q2Q469_BOMMO Query Match 7.4%; Score 26; Length 1045; Best Local Similarity 100.0%; Matches 26; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 48 AATTCTGGATTAAAATCATTCCGTGA 73 |||||||||||||||||||||||||| Db 809 AATTCTGGATTAAAATCATTCCGTGA 784 Beattie (US 9777288) Beattie disclosed an invention encompassing providing in the diet of Leptinotarsa species at least one recombinant dsRNA; wherein ingestion of said recombinant RNA by said Leptinotarsa species results in mortality or stunting in said Leptinotarsa species. The claims are broadly drawn to methods and recombinant DNA constructs targeting regions represented by SEQ ID NOs: 1-725. While the sequence is directed to Leptinotarsa species, regions “read” on a 29-nt contiguous sequence (underlined) of Phyllotreta sp. See alignment of instant SEQ ID NO: 2 with SEQ ID NO: 687 of Beattie: RESULT 2 US-61-856-137-687/c (NOTE: this sequence has 9 duplicates in the database searched. See complete list at the end of this report) Sequence 687, US/61856137 GENERAL INFORMATION APPLICANT: Monsanto Technology LLC APPLICANT: Beattie, Jodi Lynn APPLICANT: Crawford, Michael John APPLICANT: Flagel, Lex Even APPLICANT: Kapoor, Mahak APPLICANT: Taylor, Christina Marie TITLE OF INVENTION: Compositions and Methods for Controlling Leptinotarsa FILE REFERENCE: 40-21(60191)0000 CURRENT APPLICATION NUMBER: US/61/856,137 CURRENT FILING DATE: 2013-07-19 NUMBER OF SEQ ID NOS: 1086 SEQ ID NO 687 LENGTH: 1445 TYPE: DNA ORGANISM: Leptinotarsa decemlineata Query Match 48.0%; Score 166.4; Length 1445; Best Local Similarity 67.7%; Matches 233; Conservative 0; Mismatches 111; Indels 0; Gaps 0; Qy 4 GGACACCACGTTCACCATAAGGGTGGTGGAGCCGCTGAAGAGCGGCTTCAGCGAGCTGAC 63 || ||||| ||||| || | | || || || |||||||||| || ||| | | Db 709 GGGAACCACTTTCACAATCCGATTAGTTGAACCAATGAAGAGCGGATTTAGCAGCATATC 650 Qy 64 CCCCAAGCCCAGCAGGGGCAACACGGGGAAGAAAGGCTATGGCAGCGGCAGGGAGACTTT 123 || || | | || || | ||||||||| ||||| ||||||||||||||||| Db 649 ACCTAATACTGGAAGAGGGTCTTCTGGGAAGAAAATTTATGGTAGCGGCAGGGAGACTTT 590 Qy 124 GAGGTTCAAGGCGGATGGTAACGCGGAGGTGCAGGAGCAGGACGACGCCATGGAGGCGGG 183 |||||||||||| | ||| | ||||| | | || || ||||| | || | || Db 589 GAGGTTCAAGGCCGGTGGAGAAGCGGAAATCGAAGAAAGAGATGACGCACTAGATACTGG 530 Qy 184 CGTGGAGAAGATCAATGGGATACTGGAGTCCTTTATGGGTATAAATGATTCGGAGCTGGC 243 | | || || || || || ||||| || || ||||| || |||||||| || || || Db 529 CATTGAAAAAATTAACAATATTCTGGAATCGTTCATGGGAATCAATGATTCAGAACTCGC 470 Qy 244 TTCGCAGATATGGGATCTTTCGGTTGATAAGAAGAACTCGATGGACTTTGCGGAAGCGGT 303 | || || |||||| | || | || |||| || ||||| || || ||||| | Db 469 TAACCAAATTTGGGATATGTCTAAAGGAAAAGAGAATTCCATGGATTTCGCAGAAGCCAT 410 Qy 304 GGACGACTCGGAGTTGGCTGTGTTTGAGTTCACGGATGAGCTGA 347 |||||||| || | || |||||| ||||||||||| || | Db 409 CGACGACTCCGACCTCGCATCGTTTGAATTCACGGATGAACTCA 366 Baum II (US 9238822, IDS of 12/08/2023 cites the equivalent WO 2005110068) Baum II disclosed an invention encompassing providing in the diet of Diabrotica species at least one recombinant dsRNA; wherein ingestion of said recombinant RNA by said Diabrotica species results in mortality or stunting in said Diabrotica species. The claims are broadly drawn to methods and recombinant dsRNA transcribed from a nucleotide sequence selected from the group consisting of SEQ ID NO:1 through SEQ ID NO:20303, SEQ ID NO:40701 through SEQ ID NO:40746, and SEQ ID NO:40607 through SEQ ID NO:40700. While the sequence is directed to Diabrotica species, long stretches (underlined) of regions “read” on Phyllotreta sp. See alignment of instant SEQ ID NO: 10 with SEQ ID NO: 2120 of Baum: RESULT 1 US-13-226-353A-2120 Sequence 2120, US/13226353A Patent No. 9238822 GENERAL INFORMATION APPLICANT: Monsanto Technology LLC APPLICANT: Baum, James A APPLICANT: Gilbertson, Larry A APPLICANT: Kovalic, David K APPLICANT: La Rosa, Thomas J APPLICANT: Lu, Maolong APPLICANT: Munyikwa, Tichifa R. I. APPLICANT: Roberts, James K APPLICANT: Wu, Wei APPLICANT: Zhang, Bei TITLE OF INVENTION: COMPOSITIONS AND METHODS FOR CONTROL OF INSECT INFESTATION IN TITLE OF INVENTION: PLANTS FILE REFERENCE: 38-21(53597) CURRENT APPLICATION NUMBER: US/13/226,353A CURRENT FILING DATE: 2012-02-27 PRIOR APPLICATION NUMBER: US 60/669,175 PRIOR FILING DATE: 2005-04-07 PRIOR APPLICATION NUMBER: 60560842 PRIOR FILING DATE: 2004-04-09 PRIOR APPLICATION NUMBER: 60565632 PRIOR FILING DATE: 2004-04-27 PRIOR APPLICATION NUMBER: 60579062 PRIOR FILING DATE: 2004-06-11 PRIOR APPLICATION NUMBER: 60603421 PRIOR FILING DATE: 2004-08-20 PRIOR APPLICATION NUMBER: 60617261 PRIOR FILING DATE: 2004-10-11 NUMBER OF SEQ ID NOS: 40774 SEQ ID NO 2120 LENGTH: 1558 TYPE: DNA ORGANISM: Diabrotica virgifera FEATURE: NAME/KEY: misc_feature LOCATION: (1492)..(1493) OTHER INFORMATION: n is a, c, g, or t FEATURE: NAME/KEY: misc_feature LOCATION: (1522)..(1522) OTHER INFORMATION: n is a, c, g, or t FEATURE: NAME/KEY: misc_feature LOCATION: (1540)..(1540) OTHER INFORMATION: n is a, c, g, or t Query Match 53.8%; Score 162; Length 1558; Best Local Similarity 78.7%; Matches 233; Conservative 0; Mismatches 55; Indels 8; Gaps 3; Qy 12 ACGTCCAATGAGGTCAATAAAGTAACTAACAGGAACAGTTCCTCTCGCTACAACGTAATT 71 |||||||||||||||||||||||||| || | || ||||||| ||| || | ||| || Db 102 ACGTCCAATGAGGTCAATAAAGTAACCAAAAAGA--AGTTCCTGTCGAGACCAAGTACTT 159 Qy 72 TAAAGC---CACCCTGTACACGCCGACAGACTGGAGGGGCACAAGGTCCCTTTGCTATCC 128 ||| ||| |||| ||| | |||||||||||||||||||||| |||||||| ||| Db 160 TAAGAGGATCACGCTGTTCACTTCAACAGACTGGAGGGGCACAAGGTGCCTTTGCTTTCC 219 Qy 129 ACGGCGGATCCCCACACGTCGCGGCTGACGCCG---GGCTCCAGTCCGGACATGGACGAT 185 || |||| || || | || |||| | ||| ||||| ||||| || ||||||||| Db 220 ACTTCGGACCCACAAAGCACGAGGCTAGCTCCGTCCGGCTCTAGTCCAGATATGGACGAT 279 Qy 186 GGGGGCAAGCGGCAGGCCACCAGGGTGTTCAAGAAGAGCTCCCCCAACGGGAAGATCACC 245 || ||||| || || ||||||||||||||||||||||| ||||| || || ||||| || Db 280 GGAGGCAAACGACAAGCCACCAGGGTGTTCAAGAAGAGTTCCCCGAATGGAAAGATTACA 339 Qy 246 GTCTATTTGGGGAAGAGGGACTTCGTCGATCACATATCACACGTGGATCCCATAGA 301 || ||||| || || || || |||||||| ||||||||| ||| ||||| ||||| Db 340 GTATATTTAGGTAAAAGAGATTTCGTCGACCACATATCATGCGTTGATCCTATAGA 395 Thus, the prior art is helpful in providing direction for i) short siRNAs that follow certain rules of design and ii) 240bp dsRNA as carriers of short sequences of complementarity to target genes. It can also be concluded from the prior art that there is unpredictability in any random sequence of at least 21-bp functioning as effective siRNA agents for specific targets as sequences of instant invention are shown to have cross-species complementarity. Direction or Guidance Presented and Present Working Examples In Example 1 applicants show that they were successful in knocking-down known prior art targets, snf7 and vATPase in flea beetles, when the flea beetles were fed dsRNA to these targets albeit with some cross-species reactivity (Table 1). In Example 2 applicants show that a transcriptomic analyses of flea beetle genes identified 74 genes that were common between the two species of flea beetles tested: P. striolata and P. cruciferae and 143 genes did not share similarity of 21-nt length sequences with other beetle species. In Example 3 applicants show that some dsRNA topically applied to canola leaves killed feeding flea beetles more efficaciously than others (Figure 2). In Example 4 applicants show topically-applied dsRNAs on canola leaves reduces leaf consumption by flea beetles, before death of beetles is observed. In Example 5 applicants show combinations of dsRNAs result in synergism of insecticidal activity. In Example 6 applicants show the flea beetle dsRNA showed no negative impacts on five other insects typically found within canola crops that are predators of flea beetles. In Examples 7-9 applicants show identification of RNAses and that the combinations of dsRNA to canola leaves with dsRNase improved killing of feeding flea beetles. Applicants further extol the dsRNAs described in their experiments were selected on the basis of the lack of shared 21-mer matches (contained within the longer dsRNA sequences) to genes in Genbank, and their selectively for flea beetles was further confirmed by lack of negative impact on other beetles within the cropping system. Absence of Working Examples, Unpredictability, & Quantity of Experimentation Necessary It is doubtful that any 21-bp fragment of recited sequences will do the job as claimed. For e.g.,: I. a portion of SEQ ID NO: 3 matches Phyllotreta striolata genome assembly, chromosome 1; the database shows the matching sequence to be outside the CDS. This raises the question of whether inhibiting a region outside the CDS will have any inhibitory effect on Phyllotreta spp. CDS join(4631266..4632570,4662308..4663834,4669101..4669684, 4703527..4703560) Query Match 28.9%; Score 102; Length 4386041; Best Local Similarity 100.0%; Matches 102; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 125 GGATAATCCGCCTTACAACAAAGGAGCTTTTAAAATAGAAATTAATTTCCCCGCAGAATA 184 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4361982 GGATAATCCGCCTTACAACAAAGGAGCTTTTAAAATAGAAATTAATTTCCCCGCAGAATA 4362041 Qy 185 TCCTTTTAAGCCGCCAAAAATAAATTTTAAGACGAAAATTTA 226 |||||||||||||||||||||||||||||||||||||||||| Db 4362042 TCCTTTTAAGCCGCCAAAAATAAATTTTAAGACGAAAATTTA 4362083 II. a random 21bp region of SEQ ID NO: 3 also corresponds to: Sequence 301438, US/10301480C Patent No. H002220 GENERAL INFORMATION APPLICANT: Wang, David G. TITLE OF INVENTION: Identification and Mapping of Single TITLE OF INVENTION: Nucleotide Polymorphisms in the Human Genome FILE REFERENCE: 108827-137 CURRENT APPLICATION NUMBER: US/10/301,480C CURRENT FILING DATE: 2002-11-21 PRIOR APPLICATION NUMBER: US 10/215,598 PRIOR FILING DATE: 2002-08-09 PRIOR APPLICATION NUMBER: US 60/311,695 PRIOR FILING DATE: 2001-08-10 NUMBER OF SEQ ID NOS: 989478 SEQ ID NO 301438 LENGTH: 999 TYPE: DNA ORGANISM: Homo sapiens Query Match 5.9%; Score 21; Length 999; Best Local Similarity 100.0%; Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 135 CCTTACAACAAAGGAGCTTTT 155 ||||||||||||||||||||| Db 676 CCTTACAACAAAGGAGCTTTT 696 wherein Qy = instant SEQ ID NO: 3, Db = instant SEQ ID NO: 301438 found in prior art database. It is not known if this particular 21-bp sequence would have any utility in inhibiting Phyllotreta spp., as claimed. Since applicants have not tested all any length of nucleotide sequences as the claims recite, and the prior art is limited to showing the efficacy of 24bp siRNA wherein 20bp are complementary to target (Yamaguchi ) and 240-bp dsRNA wherein a single 21 bp complementary match to target (Bolognesi), is required, it is unlikely and highly unpredictable that any sequence that comprise a 21-nt matching target as set forth above would act in any specific manner, but would rather more likely be active against a different target wherein the longer portion of the sequences are specific to the different target or be non-specific in general. The amount of experimentation would not be reasonable because it would require determining which of the innumerable 21-bp or more sequences processed from the listed sequences in the instant claim would be reasonably efficacious in targeting Phyllotreta as claimed. Since, as discussed above, it is not routine to determine which fragment of sequences listed in the instant claim is efficacious, knowing only that some fragment of sequences listed in the instant claim inhibits Phyllotreta would mean that significant experimentation would be required to determine such fragment. This is because one cannot extrapolate between the activity of the full-length sequence as an Phyllotreta inhibitor and the innumerable innumerable 21-bp or more fragments of sequences listed in the instant claim, and there is little guidance (in both the prior art and the specification) with respect to the use of such fragments as claimed. Therefore the claims are only enabling for the full-length sequence and not any at least 21-bp fragment. Guidance from the MPEP MPEP 2164.03: Relationship of Predictability of the Art and the Enablement Requirement: In cases involving unpredictable factors, such as most chemical reactions and physiological activity, more may be required. In re Fisher, 427 F.2d 833, 839, 166 USPQ 18, 24 (CCPA 1970) (contrasting mechanical and electrical elements with chemical reactions and physiological activity). See also In re Wright, 999 F.2d 1557, 1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993); In re Vaeck, 947 F.2d 488, 496, 20 USPQ2d 1438, 1445 (Fed. Cir. 1991). This is because in art areas having a high degree of uncertainty (i.e. the unpredictable arts) it is not reasonably predictable from the disclosure of one species, what other species will work. MPEP 2164.01: Any analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention. Also, MPEP 2164.01(a): A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation. In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993). Conclusion of Scope of Enablement Without further guidance, one of skill in the art would have to practice a substantial amount of experimentation, an amount considered undue and not routine, to practice the instantly claimed invention. A conclusion of lack of enablement means that, based on the evidence regarding each of the above factors, the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention without undue experimentation (see MPEP 2164.01(a)). Dependent claims are similarly rejected for reciting the same language as independent claims and further, for not rectifying the lack of scope of enablement in the independent claims. Response to Arguments re § 112a Rejections Applicant's arguments filed 4/27/2026 have been fully considered but they are not persuasive. Applicants state, “It is believed that the amendment of claim 1 to include the limitations of claims 2-4, the amendment of claim 12 to include the limitations of claim 20 and the amendment of claim 23 to delete the reference to "at least 21 consecutive nucleotides" overcomes this objection” (last paras of pg. 9). These are not persuasive because: amendments were sufficient to overcome the § 112b rejection. However, § 112a (instant rejection) and § 112b are two very different statutory categories. Amendments made to overcome one statutory category may not overcome another statutory category. In the instant case, Applicants may consider amending claims to limit the applied sequences to the full-length sequences as these are free of the art of record and have support in the disclosure. Withdrawn Claim Rejections - 35 USC § 103 Applicants have amended claims. Further Applicants argue: 1. that it would be unpredictable for a given dsRNA sequence to effectively silence a target gene from a different insect genera, and point to specific citations in the specification (last two paras of pg. 11). 2. a person of skill in the art would not be motivated to select one sequence out of the innumerable sequences for Diabrotica and apply it to Phyllotreta (instant) even though there is coincidental sequence complementarity over a 26-nucleotide region as the likelihood of success would be small (first two paras of pg. 12). Applicants amendments and arguments are persuasive. The §103 rejection is withdrawn. Subject Matter Free of the Prior Art The sequences bearing SEQ ID NO: 1 – 15 recited in claims are free of the art of record. Conclusion No claims are allowed. Correspondence Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. SHABANA S. MEYERING, Ph.D. Examiner Art Unit 1635 /SHABANA S MEYERING/ Examiner, Art Unit 1635 /RAM R SHUKLA/ Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Oct 22, 2021
Application Filed
Jun 03, 2025
Non-Final Rejection mailed — §103, §112
Oct 01, 2025
Response Filed
Nov 19, 2025
Final Rejection mailed — §103, §112
Apr 27, 2026
Request for Continued Examination
Apr 29, 2026
Response after Non-Final Action
Jul 30, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12702721
GENE THERAPY FOR MACULAR DEGENERATION
5y 6m to grant Granted Aug 11, 2026
Patent 12686868
METHODS AND COMPOSITIONS FOR REJUVENATING CNS GLIAL POPULATIONS BY SUPPRESION OF TRANSCRIPTION FACTORS
3y 9m to grant Granted Jul 21, 2026
Patent 12680103
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jul 14, 2026
Patent 12644124
COMPOSITION FOR REGULATING PRODUCTION OF INTERFERING RIBONUCLEIC ACID
12m to grant Granted Jun 02, 2026
Patent 12605398
CRISPR-BASED METHODS AND NOVEL COMPOSITIONS FOR TREATING VASCULAR DISORDERS
4y 9m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
71%
Grant Probability
99%
With Interview (+42.3%)
3y 0m (~0m remaining)
Median Time to Grant
High
PTA Risk
Based on 68 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month