DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Withdrawal of Previous Office Action and Partial Withdrawal of Restriction Requirement
The Non-Final Office Action mailed 10/01/2025 is hereby withdrawn. The restriction requirement mailed 3/4/2025 has been modified and the new groups are as follows:
Group I – Claims 1-12, 18, and 27, drawn to methods and compositions related to the miR-10a-5p mimic
Group II – Claims 28, 37, 51-56, 62, and 65, drawn to methods and compositions involving the miR-10b-5p mimic
The Applicant had previously elected an invention group consisting of claims 28 and 65, without traverse, in the reply filed 9/3/2025. As new group II has been extended to include claims 37, 51-56, 62. According a new non-final office action examining claims 28, 37, 51-56, 62, and 65 is set forth below. Applicant’s election of SEQ ID NO: 7 to read on the claims is maintained.
Application Status
This action is written in response to applicant’s correspondence received on 10/22/2021. Claims 1-12, 18, 27, 28, 37, 51-56, 62, and 65 are pending. Claims 13-17, 19-26, 29-36, 38-50, 57-61, and 63-64 have been previously cancelled. Claims 28, 37, 51-56, 62, and 65 are currently under examination.
Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above.
Additionally, nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings.
Figures 5A and 13A-13B contain nucleotide sequences that are not identified by sequence identifiers (i.e., SEQ ID NOs) in the drawings or in the brief description of the drawings. Drawings containing nucleotide sequences must be accompanied with their proper SEQ ID numbers, either in the drawings themselves or in the brief description of the drawings in the specification. For instance, the brief description of Figure 5A does not include SEQ ID NOs for the sequences listed in Figure 5A. Additionally, SEQ ID numbers of the sequences shown in Figure 5A are not shown in the figure itself. The remaining figures listed above (13A-13B) have similar deficiencies, wherein the figures contain nucleotide sequences that are not identified with SEQ ID numbers and have no corresponding SEQ ID numbers recited in the brief description of said figures.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter.
Specification
The specification is objected to because of the following reason:
On page 35 of the specification, line 6, SEQ ID NO 7 is listed with the following sequence:
TTAUGGGACAUCUUGGCUUAAAC
However, the sequence listing file lists SEQ ID NO 7 as
AUGGGACAUCUUGGCUUAAAC
Note that SEQ ID NO 7 as listed in the specification is different from the sequence listed in the sequence listing because the sequence listed in the sequence listing file does not contain two “T”s at the beginning of the sequence, is shown in the specification (page 35, line 6).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 54-55 and 65 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 54, claim 54 recites the acronyms “PSC” and “PPC” and claim 55 recites the acronyms “INSR,” “IRS2,” and “IRS1;” it is not clear from the claim language to what these acronyms refer. To overcome this 112(b) issue, it is recommended that the acronyms recited in the claims be further defined in the claims.
Regarding claim 65, claim 65 recites SEQ ID NO 7. On page 35 of the specification, line 6, SEQ ID NO 7 is listed with the following sequence:
TTAUGGGACAUCUUGGCUUAAAC
However, the sequence listing file lists SEQ ID NO 7 as
AUGGGACAUCUUGGCUUAAAC
Note that SEQ ID NO 7 as listed in the specification is different from the sequence listed in the sequence listing because the sequence listed in the sequence listing file does not contain two “T”s at the beginning of the sequence, is shown in the specification (page 35, line 6). Claim 65 is therefore indefinite and unclear because it is unclear what is meant by “SEQ ID NO 7,” as there are two separate definitions of SEQ ID NO 7 offered by the Applicant, where the sequence is defined as two different sequences in the specification and in the sequence listing.
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 28, 37, 51-56, and 65 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
Regarding claim 28, claim 28 is claiming a method of increasing ICC cell proliferation comprising administering an effective amount of a miR-10b-5p mimic to a subject in need, thereby increasing the ICC proliferation in the subject. Claim 37 claims a method of increasing KIT expression in ICC by administering a miR-10b-5p mimic. Claim 51 recites a method of increasing insulin sensitivity by administration of a miR-10b-5p mimic. Claim 52 and its dependent claim 53 recite a method of treating diabetes type 1 or 2 by administering a miR-10b-5p mimic. Claim 54 recites a method of increasing KIT expression in PSC or PPC cells by administering a miR-10b-5p mimic. Claim 55 recites a method of increasing INSR, INSR1,or INSR2 in skeletal muscle cells by administering miR-10b-5p mimic. Claim 56 recites a method of reducing diabetes related inflammation by administering a miR-10b-5p mimic. Thus, the Applicant is broadly claiming the genus of “miR-10b-5p mimic” in various method claims to treat diabetes, where such a genus furthermore is recited with the functional language of performing some function in the treatment (e.g., increasing ICC proliferation, reducing inflammation, increasing KIT expression, etc.). This claim language is problematic because miRNA mimics are known in the art to be unpredictable, and the Applicant has not shown representative species of miRNA mimics commensurate in scope with the presently claimed genus.
With regards to guidance provided in the specification concerning miR-10b-5p mimics which increase the proliferation of ICC cells, the Applicant has demonstrated that miR-10b-5p shows increased expression in WT cells compared with diabetic mouse animal models (Example 1), and further demonstrated diabetes-associated physiologies using miR-10b-5p KO mice (Examples 2-4) and pathway analysis (Example 5). The Applicant has shown examples related to reducing diabetic physiologies after injection with a few miR-10b-5p mimics, showing restoration of ICC after miR-10b-5p mimic injections with (Examples 6-7). The Applicant has shown data supporting ICCs detected after a an miR-10b-5p mimic was injected compared with diabetic models (Example 8). The Applicant has preventative effects of a miR-10b-5p mimic in diabetic conditions (Example 9) and has modeled KIT and diabetic status and its relation to miR-10b (Example 10-12). However, the Applicant has not shown data which broadly demonstrates that the genus of miR-10b-5p mimic which has the recited limitations (e.g., increases proliferation of ICC cells, claim 28, reduces inflammation, claim 56, and each condition recited in claims 28, 37, 51-56, and 65) has been defined with structure-function relationship to an extent which is adequate to show possession, as the Applicant appears to have only tested a few 10-5b-5p mimics.
With regards to the genus of miRNA mimics, this genus is known to be unpredictable in the art with regards to the efficacy of such miRNA molecules. For instance, Segal (Segal M et al. Expert Opin Drug Discov. 2020 Sep;15(9):987-992) is a review article which discusses challenges with delivering miRNAs to cells for targeted treatment of cancers (Title, Abstract, throughout). Although Segal is focused on the treatment of cancer with miRNAs, the teachings apply to the present context because the challenges described by Segal relate to the in vivo delivery of such molecules and not the specific disease state; thus, the problems taught by Segal reasonably apply to the delivery of miRNAs to promote ICC proliferation and other claim limitations, as presently recited. Segal teaches that:
“RNA oligonucleotides have features that complicate drug design and efficacy. Challenging characteristics include: (i) degradation by nucleases upon addition into biological systems (ii) poor cell membrane penetration (iii) entrapment in the endosome (iv) poor binding affinity for complementary sequences (v) poor delivery to desired target tissues (vi) off-target and unwanted toxicities and (vii) activation of innate immune responses,” (page 1, right column, second paragraph).
Segal further teaches that such challenges were not overcome at the time of filing, and furthermore that more research is needed to elucidate miRNA efficacy modeling (“Conclusions” and “Expert Opinion”).
Furthermore, Nature (Nat Biotechnol 42, 1623–1624 (2024, Editorial) teaches that, with regards to the administration of miRNA mimics, the administration of such mimics is known to be associated with severe immune-related toxicities and patient death (page 1623, center column, first paragraph). Thus, it is unclear what an “effective amount” of the mimic would be, as presently recited, as an effective amount reasonably includes a dose which is not lethal over prolonged usage within the subject. The Applicant has not characterized either the genus of mimic presently recited nor its effective amount when administered to a subject.
Given the unpredictability concerning effective dosage amounts and unreliability of the genus of “miR-10b-5p” as a whole, the Applicant has not characterized the genus of miR-10b-5p mimic, as presently recited.
Furthermore, regarding claim 65, claim 65 recites that the miR-10b-5p mimic comprises SEQ ID NOs 6-10 and 12-13, or any combination thereof. The Applicant does not appear to have tested combinations of the recited sequences where the overall effect is to produce an increase in the proliferation of ICC. The Applicant has not shown effective combinations of the above sequences. Furthermore, claim 65 broadly encompasses the administration of any of the sequences used alone (e.g., Applicant-elected SEQ ID NO 7). However, the Applicant appears to have tested SEQ ID NO 7 in combination with its sense strand SEQ ID NO 6 and not alone (see page 35 of the specification, lines 5-6). Thus, the Applicant does not appear to have tested individual sense and antisense miR-10b-5p mimics (page 35, lines 1-22, figures 5B-5C). Furthermore, figures 5B-5C appear to indicate that different miR-10b-5p have varying degrees of efficacy, and therefore demonstrate the unpredictability of the genus as a whole and/or the unpredictability of using only either the sense or antisense strand of the molecule.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim 62 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Sigma (Sigma Aldrich product insert for miR-10b-5p mimic, product HMI0044, published 2014).
Regarding claim 62, Sigma teaches a commercially available miR-10b-5p mimic (see top of page 3, “Synonyms: hsa-miR-10b-5p”). Furthermore, Sigma teaches that such mimics are reconstituted in water (i.e., a pharmaceutically acceptable carrier, page 1, “Preparation Instructions”).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 28, 37, 51-56, and 62 are rejected under 35 U.S.C. 103 as being unpatentable over Octavio (Octaviano Ralph ET AL: "Micro RNA 1 Ob downregulates KIT expression through NCOR2 in diabetic interstitial cells of Cajal", May 2015, XP093076033) in view of Bader (Bader AG et al. Cancer Res. 2010 Sep 15;70(18):7027-30).
Regarding claim 28, Octavio is a thesis document which teaches that miR-10b-5p is significantly downregulated in ICC cells associated with diabetics (Abstract, lines 12-13). Furthermore, Octavio teaches that miRNAs related to diabetes play an important role in the disease and have significant therapeutic implications (Abstract, final lines). Thus, Octavio teaches the role or miR-10-5p in ICC proliferation and disease states, and furthermore teaches that miRNA has a significant implication as a therapeutic.
Octavio does not expressly teach administering a miR-10b-5p mimic to a subject in need to increase ICC proliferation.
Bader is a review article which teaches the administration of miR mimics to restore a loss-of-function in a disease state (Abstract, page 2, second paragraph). Bader teaches that, at the time of filing, miRNA mimic administration was viewed as a promising technology, and that such mRNA replacement therapy would have advantages such as having the same sequence as depleted RNA, and was therefore expected to have the same effect as natural RNA (page 2, second paragraph). Bader teaches that, at the time of filing, miRNA replacement therapy using miRNA mimics was taught to be a promising therapeutic strategy (page 4, second paragraph).
It would have been obvious to a person of ordinary skill in the art before the effective filing date to modify the teachings of Octavio and to administer a miR-10b-5p mimic to increase ICC proliferation because Octavio has already taught the miR-10b-5p target, has taught its role and significance in disease states related to ICC cells, and has furthermore implicated this miRNA as a therapeutic potential. Furthermore, Bader had already taught the strategy of using miRNA mimics once a target was known, and furthermore that at the time of filing this was viewed as being a promising therapeutic strategy. Thus, both the target for enhancing ICC proliferation in a subject and its potential as a therapeutic (miR-10b-5p, Octavio) were known, as well as the method of administering miR mimics (Bader). Thus, a practitioner would be motivated to use a miR-10b-5p mimic given that this miRNA was already known to be associated with a disease state and had been suggested to have significant therapeutic significance. At the time of filing miR mimic administration was a promising strategy for disease mitigation (Bader), which would have motivated a practitioner to apply miRNA mimics to known targets (Octavio, miR-10b-5p).
Regarding claim 37, Octavio teaches that reduction in KIT expression in ICC cells is known to be linked with diabetic states (Abstract). Given that the combination of Octavio and Bader renders obvious the administration of miR-10b-5p mimic in a diabetic context, the downstream outcomes recited in claim 37, where miR-10b-5p mimic also increases KIT expression in ICC cells, would flow naturally from the administration of miR-10b-5p mimic to treat a diabetic cause, as rendered obvious by the combination of Octabio and Bader.
Regarding claim 51, Octavio teaches that diabetes is associated with insulin resistance resulting in inadequate use of insulin in the body (Introduction, page 1, first paragraph). Octavio further teaches that individuals with diabetes typically suffer GI tract issues, where ICC cells are particularly effected in the GI tract (Introduction, page 1, paragraphs 2-4). Thus, Octavio teaches that insulin resistance (i.e., insulin sensitivity) is state related to the diabetic disease state, where the disease state of diabetes is further associated with abnormalities in ICC proliferation and KIT expression. Thus, given that the combination of Octavio and Bader render obvious the administration of a miR-10b-5p mimic in the context of the disease state of diabetes, downstream effects of the administration of miR-10b-5p mimics in the context such as those recited (i.e., increasing insulin sensitivity) would flow naturally as part of the treatment of enhancing ICC proliferation as rendered obvious by the combination of Octavio and Bader.
Regarding claim 52, Octavio teaches the significance of miRNAs in therapeutic intervention of diabetic conditions (Abstract), and furthermore the combination of Octavio and Bader render obvious the administration of miR-10b-5p mimic to enhance ICC proliferation, which is a form of treatment of diabetes as ICC cells were known to be dysfunctional in diabetics (Octavio Abstract and Introduction, paragraphs 2-4).
Regarding claim 53, Octavio teaches type I and type II diabetes (Introduction, first paragraph).
Regarding claim 54, the combination of Octavio and Bader renders obvious the administration of a miR-10b-5p mimic to a subject with diabetes; the resultant downstream effects of the administration of the miR-10b-5p mimic as they result to other components of the diabetic condition, including the status of pancreatic stem cells, would flow naturally from the administration of the administration of the miR-10b-5p mimic to a diabetic as rendered obvious by Octavio/Bader.
Regarding claim 55, Octavio teaches that miR-10b-5p is significantly downregulated in diabetic skeletal muscle (Discussion, first paragraph). Given that Octavio and Bader render obvious the administration of miR-10b-5p mimics to diabetics, and that Octavio further teaches the downregulation of miR-10b-5p in skeletal muscle, the downstream effects of the administration of miR-10b-5p to a diabetic and the resultant effects on skeletal muscle cells would flow naturally as a result of the administration of miR-10b-5p to a diabetic, as rendered obvious by Octavio and Bader.
Regarding clam 56, the combination of Octavio and Bader renders obvious the administration of a miR-10b-5p mimic to a subject with diabetes; the resultant downstream effects of the administration of the miR-10b-5p mimic as they result to other components of the diabetic condition, including diabetes-related inflammation, would flow naturally from the administration of the administration of the miR-10b-5p mimic to a diabetic as rendered obvious by Octavio/Bader.
Regarding claim 62, Octavio teaches miRNAs and their significance in therapeutics as well as the role of miR10-b-5p in the disease state of diabetes (Abstract). Furthermore, Bader is specifically directed to miRNAs and their use as a therapeutics (Title, Abstract, and throughout). Given that both documents suggest the therapeutic potentials of miRNAs, which would be administered to a subject in order to act as a therapeutic, it would be immediately obvious to a person of ordinary skill in the art to generate a composition comprising the miR-10b-5p mimic rendered obvious by Octavio/Bader and a pharmaceutically acceptable carrier, as such a carrier would be required for the administration of an RNA molecule to a subject.
Claims 65 is rejected under 35 U.S.C. 103 as being unpatentable over Octavio (Octaviano Ralph ET AL: "Micro RNA 1 Ob downregulates KIT expression
through NCOR2 in diabetic interstitial cells of Cajal", May 2015, XP093076033) in view of Bader (Bader AG et al. Cancer Res. 2010 Sep 15;70(18):7027-30) as applied to claim 28, above, and further in view of Sigma (Sigma Aldrich product insert for miR-10b-5p mimic, product HMI0044, published 2014).
A discussion of Octavio as it relates to claim 28 is given above.
Octavio teaches the miR-10b-5p target, its downregulation in disease states, and its potential as being therapeutically significant (Abstract). Bader teaches the administration of miRNA mimics to restore/replace RNA as a known method to target disease states (Abstract, page 2, second paragraph, page 4, second paragraph).
Neither Octavio nor Bader teaches the miR-10b-5p mimic of SEQ ID NO 7.
Sigma Aldrich is a product insert for commercially available miR-10b-5p mimic (product number HMI0044, throughout). With regards to the Sigma Aldrich document, note that the first two pages are generic product descriptions for miR mimics, which includes HMI0044 (the specific miR-10b-5p mimic, see first Table on page 1 of Sigma Aldrich, which includes the catalogue number for HMI0044 and therefore establishes its publication date). Sigma Aldrich teaches that the mimic is double-stranded (page 4, “General Description”). Sigma Aldrich teaches that the sequence for the mimic HMI0044 is:
UACCCUGUAGAACCGAAUUUGUG (page 4, properties)
AUGGGACAUCUUGGCUUAAACAC (implied antisense strand since the mimic is double-stranded)
AUGGGACAUCUUGGCUUAAAC (instant SEQ ID NO 7)
Note that the antisense strand of the double-stranded mimic taught by Sigma Aldrich comprises a 100% match for the instantly recited SEQ ID NO 7 (above, alignment). Thus, SEQ ID NO 7 is comprised in a known, commercially available miR-10b-5p mimic, as taught by Sigma Aldrich (page 4).
It would have been obvious to a person of ordinary skill in the art before the effective filing date to modify the teachings of Octavio/Bader, who had already rendered obvious miR-10b-5p as a potential therapeutic and its connection with enhanced ICC proliferation in the context of disease, where Bader further taught the potential therapeutic potential of using RNA mimics once a target has been identified, to include SEQ ID NO 7 as the mimic because such a combination is the simple combination of known prior art elements with predictable success. In the present case, SEQ ID NO 7 was a commercially available product, and was therefore readily available and already identified as a miR-10b-5p mimic. Thus, a practitioner would be motivated to use such a commercially available product given that Octavio/Bader render obvious the application of miR-10b-5p mimics to enhance ICC proliferation. The fact that SEQ ID NO 7 was already commercially available speaks to its lack of novelty, especially in light of the fact that administering miRNA mimics was known technique and that Octavio had already defined the therapeutic target (i.e., miR-10b-5p).
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/D.C.R./Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635