Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I (Claims 1-9 and 22-27; drawn to an in vitro or ex vivo method for correcting at least one of the USH2A mutations selected among c.2276G>T and c.2299delG mutations) in the reply filed on November 21, 2024, is acknowledged.
DETAILED ACTION
The amended claims filed on July 14, 2025, have been acknowledged. Claims 10-21 and 28-40 were cancelled. Claims 1-4, 9, and 22-24 were amended. Claim 41 is new. Claims 1-9, 22-27, and 41 are pending and examined on the merits.
Priority
The applicant claims foreign priority from EP19305558.9 filed on April 30, 2019. Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55, received October 25, 2021. Claims 1-9, 22-27, and 41 find support in foreign application EP19305558.9 filed on April 30, 2019.
Information Disclosure Statement
The information disclosure statement (IDS) filed on October 25, 2021, has been considered.
Withdrawn Nucleotide and/or Amino Acid Sequence Disclosures
The prior objection to the Nucleotide and/or Amino Acid Sequence Disclosures is withdrawn in light of Applicant’s amendments to the Brief Description of the Drawings to identify the sequences of Figures 2B, 2C, 3B, 3C, 3D, 3F, and 3G.
New Nucleotide and/or Amino Acid Sequence Disclosures
REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES
Items 1) and 2) provide general guidance related to requirements for sequence disclosures.
37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted:
In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying:
the name of the ASCII text file;
ii) the date of creation; and
iii) the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying:
the name of the ASCII text file;
the date of creation; and
the size of the ASCII text file in bytes;
In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or
In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended).
When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical.
If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical.
Specific deficiencies and the required response to this Office Action are as follows:
Specific deficiency - This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.821(a)(1) and (a)(2). However, this application fails to comply with the requirements of 37 CFR 1.821 - 1.825.
The sequence disclosures are located in Figures 1A, 1D, 2C, 3B, 3C, 3D, 3F, and 3G.
The brief description of Figure 1A identifies the sequences in Figure 1A as corresponding to SEQ ID NO: 10 and SEQ ID NO: 11, respectively. However, SEQ ID NOs: 10-11 do not correspond to the sequences of Figure 1A. The Sequence listing specifically identifies SEQ ID NO: 11 as corresponding to a part of SEQ ID NO: 10 in Figure 1D. SEQ ID NO: 10 seems to correspond to ssODN1 of Figure 1D and SEQ ID NO: 11 seems to correspond to the PAM and gRNA1 sequence of Figure 1D.
The brief description of Figure 1D only identifies two of the four sequences and incorrectly identies SEQ ID NO: 11 of corresponding to the ssODN2 sequence.
2B, 2C, 3B, 3C, 3D, 3F, and 3G all include sequences without a corresponding SEQ ID NO: either in the figures or in the Brief Description of the Drawings.
When a sequence is presented in a drawing, regardless of the format or the manner of presentation of that sequence in the drawing, the sequence must still be included in the Sequence Listing and the sequence identifier,("SEQ ID NO:X") must be used, either in the drawing or in the Brief Description of the Drawings. See MPEP §2422.02.
It is often convenient to identify sequences in figures by amending the Brief Description of the Drawings section (see MPEP 244.02). If the sequences are already present in the sequence listing, it would be remedial to amend the Brief Description of the Drawings or specification to include the appropriate sequence identifiers. Applicants are required to comply with all of the requirements of 37 CFR 1.821 - 1.825. Any response to this office action that fails to meet all of these requirements will be considered non-responsive.
37 CFR 1.821(f) states that in addition to the paper copy required by paragraph (c) of this section and the computer readable form required by paragraph (e) of this section, a statement that the content of the paper and computer readable copies are the same must be submitted with the computer readable form, e.g., a statement that "the information recorded in computer readable form is identical to the written sequence listing."
Note that if the SEQ.txt file was received via EFSWeb and the text file meets the requirements for the paper copy and CRF, no statement is required.
Required response – Applicant must provide:
A "Sequence Listing" part of the disclosure, as described above in item 1); as well as
An amendment specifically directing entry of the "Sequence Listing" part of the disclosure into the application in accordance with 1.825(b)(2);
A statement that the "Sequence Listing" includes no new matter in accordance with 1.825(b)(5); and
A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.825(b)(4).
If the "Sequence Listing" part of the disclosure is submitted according to item 1) a) or b) above, Applicant must also provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of:
A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
A copy of the amended specification without markings (clean version); and
A statement that the substitute specification contains no new matter;
If the "Sequence Listing" part of the disclosure is submitted according to item 1) b), c), or d) above, Applicant must also provide:
A replacement CRF in accordance with 1.825(b)(6); and
Statement according to item 2) a) or b) above.
Withdrawn Claim Rejections - 35 USC § 112
The prior rejection of claim 23 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention is withdrawn in light of Applicant’s removal of the eSpCas9 (1.1) language.
The prior rejection of claims 22-24 under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention is withdrawn in light of Applicant’s amendments to claim 22 to recite “the at least one Clustered regularly interspaced short palindromic repeats (CRISPR) associated nuclease” and to claim 24 to recite “the at least one donor nucleic acid”.
Withdrawn Claim Rejections - 35 USC § 102
The prior rejection of claims 1-4, 9, 22, and 24-26 under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by World Intellectual Property Organization Patent No. 2015/134812 (Maeder; referenced in IDS) is withdrawn in light of Applicant’s amendments to claim 1 to recite that the method corrects the c.2276G>T mutation with a gRNA comprising SEQ ID NO: 7.
Withdrawn Claim Rejections - 35 USC § 103
The prior rejection of claims 1 and 5-6 under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) as applied to claim 1 above, and further in view of Richardson et al. (Nature Biotechnology 34: 339-344. 2016; referenced in IDS) is withdrawn in light of Applicant’s amendments to claim 1 to recite that the method corrects the c.2276G>T mutation with a gRNA comprising SEQ ID NO: 7.
The prior rejection of claims 1 and 7 and 27 under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) as applied to claim 1 above, and further in view of Renaud et al. (Cell Reports 14: 2263-2272. 2016; referenced in IDS) is withdrawn in light of Applicant’s amendments to claim 1 to recite that the method corrects the c.2276G>T mutation with a gRNA comprising SEQ ID NO: 7.
The prior rejection of claims 1 and 8 under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) as applied to claim 1 above, and further in view of Richardson et al. (Nature Biotechnology 34: 339-344. 2016) and Renaud et al. (Cell Reports 14: 2263-2272. 2016) is withdrawn in light of Applicant’s amendments to claim 1 to recite that the method corrects the c.2276G>T mutation with a gRNA comprising SEQ ID NO: 7.
The prior rejection of claims 1 and 22-23 under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) as applied to claims 1 and 22 above, and further in view of Slaymaker et al. (Science 351: 84-88. 2016) is withdrawn in light of Applicant’s amendments to claim 1 to recite that the method corrects the c.2276G>T mutation with a gRNA comprising SEQ ID NO: 7.
New Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-4, 22, 24-26, and 41 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) in view of Fuster-Garcia et al. (Molecular Therapy: Nucleic Acids 8: 529-541. 2017; cited in IDS), and Lenassi et al. (European Journal of Human Genetics 23: 1318–1327. 2015).
Regarding claims 1 and 41, Maeder teaches an ex vivo method of modifying a patient’s cell wherein the patient is suffering from a mutation in the USH2A gene (2299delG). Maeder teaches that the target cell can be an induced pluripotent stem cell derived from the subject. Maeder teaches that the method involves contacting the target cell with a gRNA (which can include sequences from Table 3, page 95) such as USH2A-36 (95% sequence identity to SEQ ID NO: 7);
a Cas9 molecule;
and a template donor strand that serves as a repair template for the mutated USH2A gene (page 228, lines 19-25 and claims 1, 18, 153-159, 216-222, 227-231).
The method of Maeder would require culturing the iPSC cell with the gRNA, Cas9, and donor template for modification of the cell to occur to correct the USH2A 2299delG mutation.
Maeder does not teach treating the USH2A mutation c.2276G>T.
However, Fuster-Garcia teaches that the c.2299del G mutation and the c.2276G>T mutation are highly prevalent mutations associated with autosomal recessive retinitis pigmentosa located 22 base pairs from each other (page 529, column 1, paragraph 2-column 2, paragraph 1). Fuster-Garcia teaches that the aim of their study was to set up a CRISPR toolkit to correct the c.2299delG and c.2276G>T mutations in cells from patients harboring these mutations. Editing primary cell lines is known to be difficult. For that reason, the broadly used HEK293 cells were selected for the first trial, since they are easy to handle and transfect. However, this cell line presents a wild-type (WT) genome; to overcome this problem, a decision was made to reverse the strategy by introducing the c.2299delG and c.2276G>T mutations in these cells instead of their correction (page 530, column 1, paragraph 2-column 2, paragraph 1). As shown in Figures 3 and 4, the same sgRNA (sgRNA-1) can be used to insert the desired repair template DNA through homologous recombination.
[AltContent: rect][AltContent: textbox (Maeder gRNA)][AltContent: rect][AltContent: textbox ( PAM)]The USH2A-36 gRNA of Maeder targets a similar region as the gRNAs used by Fuster-Garcia (represented by the black box overlayed over the USH2A sequence as shown in Figure 1 of Fuster-Garcia):
PNG
media_image1.png
82
825
media_image1.png
Greyscale
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention that the ex vivo method of correcting 2299delG mutations in iPSCs of Maeder could also be used to correct the c.2276G>T mutation to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to use the method of Maeder to correct the c.2276G>T mutation with a reasonable expectation of success because Fuster-Garcia teaches that the c.2299del G mutation and the c.2276G>T mutation are highly prevalent mutations associated with autosomal recessive retinitis pigmentosa located 22 base pairs from each other and as shown in Figures 3 and 4, the same sgRNA (sgRNA-1) can be used to insert the desired repair template DNA that overlaps with both mutation sites through homologous recombination. As such, it would have been obvious that the method of Maeder could use the same gRNA (USH2A-36) to insert a desired repair template that corrects the mutation(s) of c.2276G>T and c.2299delG together, or both mutations depending which are present in the patient cells. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
The combined teachings of Maeder and Fuster-Garcia do not teach wherein the gRNA is 100% identical to SEQ ID NO: 7 of the instant application.
However, as stated supra, USH2A-36 of Maeder (top line) is 95% identical to SEQ ID NO: 7 (bottom line) of the instant application, as shown below:
1 AGAATTTGTTCACTGAGCCA 20 USH2A-36 (SEQ ID NO: 466)
||||:::|::|||:|||||
1 AGAAUUUGUUCACUGAGCCG 20 Instant Application SEQ ID NO: 7
The lone modification is a G at position 20 compared to an A at position 20. Lenassi teaches that in patients with the c.2276G>T mutation, each one also exhibited the polymorphism c.2256T>C (page 1326, column 1, paragraph 2).
As can be seen in the modified Figure 1 of Fuster Garcia, the 2256 T>C mutation would occur at position 20 of the Maeder gRNA and would require the gRNA to become a G to pair with the mutated C at position 20.
[AltContent: textbox (2256)][AltContent: rect][AltContent: rect][AltContent: textbox (Maeder gRNA)][AltContent: rect][AltContent: textbox ( PAM)]
PNG
media_image1.png
82
825
media_image1.png
Greyscale
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the gRNA sequence of Maeder to have a G at position 20 to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify the gRNA sequence with a reasonable expectation of success because Lenassi teaches that in patients with the c.2276G>T mutation, each one also exhibited the polymorphism c.2256T>C. Therefore, patients with the c.2276G>T mutation would also have the polymorphism c.2256T>C. As shown above, this 2256 mutation corresponds to position 20 of the gRNA of Maeder. In order for the gRNA to maintain 100% sequence pairing between the target sequence and the gRNA, the gRNA sequence would need to change position 20 to a G to pair with the mutated C. As such, it would have been obvious to modify USH2A-36 to have a G at position 20 to ensure full pairing between the gRNA and target sequence for treating patients with the c.2276G>T mutation as they are known to also have the polymorphism c.2256T>C. This would lead to a sequence that is 100% identical to SEQ ID NO: 7 of the instant application. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding claim 2, Maeder as stated supra, teaches that the iPSC is derived from the subject with the USH2A mutation (page 228, lines 19-25) and Fuster-Garcia, as stated supra, teaches that the aim of this study was to set up a CRISPR toolkit to correct the c.2299delG and c.2276G>T mutations in cells from patients harboring these mutations (page 530, column 1, paragraph 2-column 2, paragraph 1).
Regarding claims 3 and 25-26, Maeder teaches that their method is for treating Usher syndrome 2A and retinitis pigmentosa (inherited retinal dystrophies) (page 3, lines 9-21) and Fuster-Garcia teaches that the c.2299delG mutation and the c.2276G>T mutation are highly prevalent mutations associated with autosomal recessive retinitis pigmentosa located 22 base pairs from each other (page 529, column 1, paragraph 2-column 2, paragraph 1).
Regarding claim 4, the combined teachings of Maeder, Fuster-Garcia, and Lenassi, as stated supra, a gRNA which is 100% identical to SEQ ID NOs: 7, as shown below:
modified USH2A-36 gRNA based on teachings of Fuster-Garcia and Lenassi
1 AGAATTTGTTCACTGAGCCG 20
||||:::|::|||:||||||
1 AGAAUUUGUUCACUGAGCCG 20
Instant Application SEQ ID NO: 7
Regarding claim 22, Maeder, as stated supra, teaches that the Cas is a Cas9 protein (claim 216).
Regarding claim 24, Maeder teaches that the donor template nucleic acid can be designed as an ssODN (page 213, lines 1-12) and Fuster-Garcia uses an ssODN donor template (Figures 3-4).
Claims 1, 5-6, and 9 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) in view of Fuster-Garcia et al. (Molecular Therapy: Nucleic Acids 8: 529-541. 2017), and Lenassi et al. (European Journal of Human Genetics 23: 1318–1327. 2015) as applied to claim 1 above, and further in view of Richardson et al. (Nature Biotechnology 34: 339-344. 2016).
Regarding claim 5, the teachings of Maeder, Fuster-Garcia, and Lenassi are as discussed above.
The combined teachings of Maeder, Fuster-Garcia, and Lenassi do not teach wherein the donor nucleic acid is complementary to the strand not targeted by the gRNA.
However, Richardson teaches that Cas9 asymmetrically releases the 3' end of the cleaved DNA strand that is not complementary to the sgRNA (nontarget strand) and that it is advantageous to use a single-stranded DNA donor complementary "to the strand that is released first”, i.e. the strand not complementary to the sgRNA which results in an increase in the rate of HDR in human cells when using Cas9 or nickase variants to up to 60% (abstract).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the ex vivo method of correcting c.2276G>T mutations in iPSCs of the combined teachings of Maeder, Fuster-Garcia, and Lenassi with the method of homologous directed recombination using a donor strand complementary to the non-target strand of Richardson to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Richardson teaches that it is advantageous to use a single-stranded DNA donor complementary "to the strand that is released first”, i.e. the strand not complementary to the sgRNA which results in an increase in the rate of HDR in human cells up to 60%. As such, it would have been obvious to use a donor template that’s complementary to the non-target strand of the gRNA to increase the rate of homologous directed repair (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, and Lenassi). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding claim 6, the teachings of Maeder, Fuster-Garcia, and Lenassi are as discussed above.
Maeder, Fuster-Garcia, and Lenassi do not teach wherein the donor nucleic acid is asymmetrical.
However, Richardson teaches that a donor DNA that was not symmetric around the break yielded a greater HDR frequency than when using symmetric donor DNA (page 342, column 1, paragraph 2-column 2, paragraph 1).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the ex vivo method of correcting c.2276G>T mutations in iPSCs of the combined teachings of Maeder, Fuster-Garcia, and Lenassi by using asymmetrical repair templates, as identified by Richardson, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Richardson teaches that a donor DNA that was not symmetric around the break yielded a greater HDR frequency than when using symmetric donor DNA.
As such, it would have been obvious to use an asymmetrical repair template to increase the rate of homologous directed repair (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, and Lenassi). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Regarding claim 9, the teachings of Maeder, Fuster-Garcia, and Lenassi are as discussed above. Maeder teaches SEQ ID NO: 390 which corresponds to template repair construct 2 (pages 211-212). The reverse complement of SEQ ID NO: 390 (bottom sequence) comprises a sequence with 98.7% sequence identity to SEQ ID NO: 6 (top sequence), as shown below:
1 TACAATTGGTGACATCTAACCCATAAAAGTTTTCTCTGCAGGTGTCACACTGAAGTCCTT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
631 TACAATTGGTGACATCTAACCCATAAAAGTTTTCTCTGCAGGTGTCACACTGAAGTCCTT 572
61 TGGCTTCTTTTTTGCACTCACACTGGCCAGAGTGAGGATTGCAGAATTTGTTCACTGAGC 120
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
571 TGGCTTCTTTTTTGCACTCACACTGCCCAGAGTGAGGATTGCAGAATTTGTTCACTGAGC 512
121 CATGGAG 127
|||||||
511 CATGGAG 505
The combined teachings of Maeder, Fuster-Garcia, and Lenassi do not teach wherein the donor nucleic acid is complementary (i.e. the reverse complement of SEQ ID NO: 390 of Maeder) to the strand not targeted by the gRNA.
However, Richardson teaches that Cas9 asymmetrically releases the 3' end of the cleaved DNA strand that is not complementary to the sgRNA (nontarget strand) and that it is advantageous to use a single-stranded DNA donor complementary "to the strand that is released first”, i.e. the strand not complementary to the sgRNA which results in an increase in the rate of HDR in human cells when using Cas9 or nickase variants to up to 60% (abstract).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the ex vivo method of correcting c.2276G>T mutations in iPSCs of the combined teachings of Maeder, Fuster-Garcia, and Lenassi with the method of homologous directed recombination using a donor strand complementary to the non-target strand of Richardson to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Richardson teaches that it is advantageous to use a single-stranded DNA donor complementary "to the strand that is released first”, i.e. the strand not complementary to the sgRNA which results in an increase in the rate of HDR in human cells up to 60%. As such, it would have been obvious to use a donor template that’s complementary to the non-target strand of the gRNA to increase the rate of homologous directed repair (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, and Lenassi). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Furthermore, Fuster-Garcia teaches that they placed silent mutations at position c.2292G>C (corresponds to position 86 (the mismatch) of SEQ ID NO: 6 of the instant application) in their ssODN constructs as this variant creates the new recognition site for the MlsI restriction enzyme for editing detection (Figure 3).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the donor nucleic acid complementary to the strand not targeted by the gRNA of the combined teachings of Maeder, Fuster-Garcia, Lenassi, and Richardson by introducing a silent mutation to the donor nucleic acid corresponding to position 2292G>C to generate a MlsI restriction enzyme for editing detection, as identified by Fuster-Garcia, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Fuster-Garcia teaches that this variant creates the new recognition site for the MlsI restriction enzyme for editing detection. As such, it would have been obvious to make this single nucleotide modification to allow for examining editing efficiency in the ex vivo modification method of Maeder, Fuster-Garcia, Lenassi, and Richardson. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Claims 1, 7, and 27 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) in view of Fuster-Garcia et al. (Molecular Therapy: Nucleic Acids 8: 529-541. 2017), and Lenassi et al. (European Journal of Human Genetics 23: 1318–1327. 2015) as applied to claim 1 above, and further in view of Renaud et al. (Cell Reports 14: 2263-2272. 2016).
The teachings of Maeder, Fuster-Garcia, and Lenassi are as discussed above. Maeder teaches that the donor template nucleic acid can be designed as an ssODN (page 213, lines 1-12) and Fuster-Garcia (Figures 3-4).
The combined teachings of Maeder, Fuster-Garcia, and Lenassi do not teach wherein the donor nucleic acid comprises a modified terminal base.
However, Renaud teaches that we show that using phosphorothioate-modified oligonucleotides strongly enhances genome editing efficiency of single stranded oligonucleotide (ssODN) donors in cultured cells. In addition, it provides better design flexibility, allowing insertions more than 100 bp long (abstract). Renaud teaches PS [phosphorothioate] chemical modifications were incorporated at two terminal nucleotides of both 5’ and 3’ ends (page 2264, column 2, paragraph 1). Renaud teaches that chemically modified ssODNs provide several important benefits to the design of ssODN donors for genome editing. They showed that the use of PS-ssODN donors can give rise to much-higher levels of KI [knock-in], especially for long inserts, both in cells and in rodents. Chemical modifications, PS, stabilize ssODNs and probably contribute by increasing the effective concentration of ssODN available during DNA repair (page 2269, column 2, paragraph 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the ex vivo method of correcting c.2276G>T mutations in iPSCs of the combined teachings of Maeder, Fuster-Garcia, and Lenassi by using phosphorothioate terminal modified ssODN donors, as identified by Renaud, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Renaud teaches that chemically modified ssODNs provide several important benefits to the design of ssODN donors for genome editing. They showed that the use of PS-ssODN donors can give rise to much-higher levels of KI [knock-in], especially for long inserts, both in cells and in rodents. Chemical modifications, PS, stabilize ssODNs and probably contribute by increasing the effective concentration of ssODN available during DNA repair. As such, it would have been obvious to use PS-ssODN donor templates to increase the rate of HDR and genetic knock-in (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, and Lenassi). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Claims 1 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) in view of Fuster-Garcia et al. (Molecular Therapy: Nucleic Acids 8: 529-541. 2017), and Lenassi et al. (European Journal of Human Genetics 23: 1318–1327. 2015) as applied to claim 1 above, and further in view of Richardson et al. (Nature Biotechnology 34: 339-344. 2016) and Renaud et al. (Cell Reports 14: 2263-2272. 2016).
The teachings of Maeder, Fuster-Garcia, and Lenassi are as discussed above. Maeder teaches that the donor template nucleic acid can be designed as an ssODN (page 213, lines 1-12) amd Fuster-Garcia teaches that the donor template nucleic acid can be designed as an ssODN (Figures 3-4).
The combined teachings of Maeder, Fuster-Garcia, and Lenassi do not teach wherein the donor nucleic acid is complementary to the strand not targeted by the gRNA.
However, Richardson teaches that Cas9 asymmetrically releases the 3' end of the cleaved DNA strand that is not complementary to the sgRNA (nontarget strand) and that it is advantageous to use a single-stranded DNA donor complementary "to the strand that is released first”, i.e. the strand not complementary to the sgRNA which results in an increase in the rate of HDR in human cells when using Cas9 or nickase variants to up to 60% (abstract).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the ex vivo method of correcting c.2276G>T mutations in iPSCs of the combined teachings of Maeder, Fuster-Garcia, and Lenassi with the method of homologous directed recombination using a donor strand complementary to the non-target strand of Richardson to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to combine with a reasonable expectation of success because Richardson teaches that it is advantageous to use a single-stranded DNA donor complementary "to the strand that is released first”, i.e. the strand not complementary to the sgRNA which results in an increase in the rate of HDR in human cells up to 60%. As such, it would have been obvious to use a donor template that’s complementary to the non-target strand of the gRNA to increase the rate of homologous directed repair (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, and Lenassi). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Maeder, Fuster-Garcia, and Lenassi do not teach wherein the donor nucleic acid is asymmetrical.
However, Richardson teaches that a donor DNA that was not symmetric around the break yielded a greater HDR frequency than when using symmetric donor DNA (page 342, column 1, paragraph 2-column 2, paragraph 1).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the ex vivo method of correcting c.2276G>T mutations in iPSCs of the combined teachings of Maeder, Fuster-Garcia, and Lenassi by using asymmetrical repair templates, as identified by Richardson, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Richardson teaches that a donor DNA that was not symmetric around the break yielded a greater HDR frequency than when using symmetric donor DNA.
As such, it would have been obvious to use an asymmetrical repair template to increase the rate of homologous directed repair (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, and Lenassi). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
The combined teachings of Maeder, Fuster-Garcia, Lenassi, and Richardson are as discussed above.
The combined teachings of Maeder, Fuster-Garcia, Lenassi, and Richardson do not teach wherein the donor nucleic acid comprises a modified terminal base at both the 5’ and 3’ ends.
However, Renaud teaches that we show that using phosphorothioate-modified oligonucleotides strongly enhances genome editing efficiency of single stranded oligonucleotide (ssODN) donors in cultured cells. In addition, it provides better design flexibility, allowing insertions more than 100 bp long (abstract). Renaud teaches PS [phosphorothioate] chemical modifications were incorporated at two terminal nucleotides of both 5’ and 3’ ends (page 2264, column 2, paragraph 1). Renaud teaches that chemically modified ssODNs provide several important benefits to the design of ssODN donors for genome editing. They showed that the use of PS-ssODN donors can give rise to much-higher levels of KI [knock-in], especially for long inserts, both in cells and in rodents. Chemical modifications, PS, stabilize ssODNs and probably contribute by increasing the effective concentration of ssODN available during DNA repair (page 2269, column 2, paragraph 2).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the ex vivo method of correcting c.2276G>T mutations in iPSCs of the combined teachings of Maeder, Fuster-Garcia, Lenassi, and Richardson by using phosphorothioate modified ssODN donors, as identified by Renaud, to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to modify with a reasonable expectation of success because Renaud teaches that chemically modified ssODNs provide several important benefits to the design of ssODN donors for genome editing. They showed that the use of PS-ssODN donors can give rise to much-higher levels of KI [knock-in], especially for long inserts, both in cells and in rodents. Chemical modifications, PS, stabilize ssODNs and probably contribute by increasing the effective concentration of ssODN available during DNA repair. As such, it would have been obvious to use PS-ssODN donor templates to increase the rate of HDR and genetic knock-in (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, Lenassi, and Richardson). Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
As such, it would have been obvious to use a repair template comprising a ssODN that is complementary to the strand non-targeted by the gRNA, that is asymmetrical, and that comprises two phosphorothioate-modified terminal bases at both ends because each of these modifications increase the rate of homologous directed repair and knock-in of the donor template strand (the ultimate goal of the ex vivo modification method of Maeder, Fuster-Garcia, Lenassi, Richardson, and Renaud).
Claims 1 and 22-23 are rejected under 35 U.S.C. 103 as being unpatentable over World Intellectual Property Organization Patent No. 2015/134812 (Maeder) in view of Fuster-Garcia et al. (Molecular Therapy: Nucleic Acids 8: 529-541. 2017), and Lenassi et al. (European Journal of Human Genetics 23: 1318–1327. 2015) as applied to claims 1 and 22 above, and further in view of Slaymaker et al. (Science 351: 84-88. 2016).
The teachings of Maeder, Fuster-Garcia, and Lenassi are as discussed above.
The combined teachings of Maeder, Fuster-Garcia, and Lenassi do not teach wherein the Cas9 is an eSpCas9.
However, Slaymaker teaches that eSPCas9 (1.1) exhibits enhanced specificity with a reduction in off-target effects while maintaining high on-target cleavage (abstract and page 3, paragraphs 2-5).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the Cas9 of the combined teachings of Maeder, Fuster-Garcia, and Lenassi with the eSpCas9 (1.1) of Slaymaker to arrive at the instantly claimed invention. One of ordinary skill in the art would have a reason to substitute with a reasonable expectation of success because Slaymaker teaches that eSPCas9 (1.1) exhibits enhanced specificity with a reduction in off-target effects while maintaining high on-target cleavage. Because the prior art teaches all of the elements of the claimed invention, there is a reasonable expectation of success.
Response to Arguments
Applicant's arguments filed July 14, 2025, are acknowledged.
Applicant argues that the amendments overcome the rejections based on Maeder.
Applicant's arguments have been fully considered but they are not persuasive.
The prior 102 and 103 rejections based on Maeder have been withdrawn and new rejections have been made based on the combined teachings of Maeder, Fuster-Garcia, and Lenassi.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEENAN A BATES whose telephone number is (571)270-0727. The examiner can normally be reached M-F 7:30-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Doug Schultz can be reached on (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEENAN A BATES/Examiner, Art Unit 1631
/JAMES D SCHULTZ/Supervisory Patent Examiner, Art Unit 1631