DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The amendment to the claims filed on 07/16/2025 does not comply with the requirements of 37 CFR 1.121(c) because the status identifier for claim 8 is incorrect. Its status identifier should be “Withdrawn” rather “Previously Presented”. This is because claim 8 was withdrawn from further consideration in the Non-Final rejection dated 07/16/2025 because it is directed to a non-elected species. However, for the purpose of a compact prosecution, Applicant’s amendment filed on 07/16/2025 has been entered.
Amended claims 1, 3-24 and new claims 25-26 are pending in the present application.
Applicant elected previously the Invention of Group I. Applicant also elected previously the following species: (i) Infantile Batten disease (IBD); and (ii) the intrathecal administration and the intravenous administration are performed post-symptoms on set.
Claim 22 was withdrawn previously from further consideration because it is directed to a non-elected invention. Additionally, claim 8 was also withdrawn from further consideration because it is drawn to a non-elected species.
Therefore, amended claims 1, 3-7, 9-21 and 23-26 are examined on the merits herein with the above elected species.
Response to Amendment
1. The rejection under 35 U.S.C. 102(a)(1) as being anticipated by Rozenberg et al (Abstract #550; Molecular Therapy 26, Supplement 1, May 9 2018; page 256; IDS) was withdrawn in light of currently amended independent claim 1, particularly with the new limitation “wherein the intrathecal administration precedes the intravenous administration”.
2. The rejection under 35 U.S.C. 102(a)(1) as being anticipated by Lykken et al (Abstract #36; Molecular Therapy 27, Supplement 1, April 15, 2019; page 21; IDS) was withdrawn in light of currently amended independent claim 1, particularly with the new limitation “wherein the intrathecal administration precedes the intravenous administration”.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Amended claims 1, 3-7, 9-21 and 23-26 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for:
A method for ameliorating one or more symptoms of infantile Batten Disease (IBD) or an IBD related disorder that is caused by a decreased expression of CLN1 gene in a subject, comprising an intrathecal administration of an effective amount of a first AAV viral particle comprising a polynucleotide comprising a CLN1 gene, and an intravenous administration of an effective amount of a second AAV viral particle comprising a polynucleotide comprising a CLN1 gene to the subject, thereby treating the IBD or the IBD related disorder; wherein the second AAV viral particle is an AAV9 viral particle;
does not reasonably provide enablement for a method of treating infantile Batten disease (IBD) or an IBD related disorder in a subject as claimed broadly. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims. This is a modified rejection necessitated by Applicant’s amendment.
The factors to be considered in the determination of an enabling disclosure have been summarized as the quantity of experimentation necessary, the amount of direction or guidance presented, the state of the prior art, the relative skill of those in the art, the predictability or unpredictability of the art and the breadth of the claims. Ex parte Forman, (230 USPQ 546 (Bd Pat. Appl & Unt, 1986); In re Wands, 858 F.2d 731, 8 USPQ 2d 1400 (Fed. Cir. 1988)).
The instant specification is not enabled for the instant broadly claimed invention for the reasons discussed below.
1. The breadth of the claims
Amended claims 1, 3-7, 9-21 and 25-26 encompass a method for treating infantile Batten Disease (IBD) or a IBD related disorder in a subject in need thereof that is caused by a decrease in CLN1 gene expression, comprising an intrathecal administration of an effective amount of any first AAV viral particle comprising a polynucleotide comprising a CLN1 gene, and an intravenous administration of an effective amount of a second AAV9 viral particle comprising a polynucleotide comprising a CLN1 gene, wherein the intrathecal administration precedes the intravenous administration, thereby treating IBD or an IBD related disorder.
Claims 23-24 encompass a method for treating infantile Batten Disease (IBD) or any IBD related disorder [e.g., a disease, disorder, syndrome or condition that is caused by an altered expression (both an increase or a decreased expression) of the CLN1 gene] in a subject in need thereof, comprising an intrathecal administration of an effective amount of any first AAV viral particle comprising a polynucleotide comprising a CLN1 gene, and an intravenous administration of an effective amount of any second AAV viral particle of any serotype (e.g., not necessarily limited to AAV9) comprising a polynucleotide comprising a CLN1 gene, thereby treating IBD or an IBD related disorder, wherein the polynucleotide of the first viral particle and/or the polynucleotide of the second viral particle comprises a codon-optimized CLN1 gene sequence having at least 99% identity to SEQ ID NO: 1.
It is noted that the term “treating” as defined by the present application encompasses to prevent the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; to arrest the disease development; or causing the regression of the disease or symptoms of the disease (see paragraph [0077] of the instant specification). Additionally, the term “IBD related disorder” is defined by the present application to be a disease, disorder, syndrome, or condition that is caused by or a symptom of decreased or altered expression of the CLN1 gene in a subject relative to the expression level or activity in a normal subject, a subject not exhibiting symptoms, or in a population (paragraph [0076] of the specification).
2. The state and the unpredictability of the prior art
At about the effective filing date of the present application (04/29/2019), little was known about the combined intrathecal and intravenous delivery of any AAV viral particle comprising a polynucleotide comprising a CLN1 gene to treat (e.g., to prevent the symptoms, to arrest the development, and/or to cause regression of the symptoms or the disease) infantile Batten disease (IBD) or an IBD related disorder in a subject in need thereof as evidenced at least by the teachings of Rozenberg et al (Abstract #550; Molecular Therapy 26, Supplement 1, May 9 2018; page 256; IDS), Shyng et al (PNAS, doi/10.1073/pnas.1701832114, E5920-E5929, 2017; IDS), Kielian et al (WO 2016/100575), Gray (WO 2017/218450; IDS) and Johnson et al (Nat. Rev. Neurol. 15:161-178; doi:10.1038/s41582-019-0138-8, 39 pages, 2019). In May 2018, Rozenberg et al still stated “Infantile neuronal ceroid lipofuscinosis (INCL), a lysosomal storage disorder caused by mutations in the CLN1 gene, is a severe neurodegenerative disease affecting both the central nervous system, including the spinal cord, and peripheral organs, for which there is currently no cure or treatments that address the underlying cause”. In a review of therapeutic landscape for Batten disease in March 2019, Johnson et al stated “[m]ouse models have been an integral part of Batten disease research. However, neurodevelopmental, neuroanatomical and mechanistic differences between mice and humans present challenges for translation and are apparent in the phenotypic presentation of Batten disease mouse models…Specifically, disease presentation varies depending on strain in several Batten disease mouse models, retinal degeneration does not occur or is limited in several models, and most models show delayed or reduced mortality compared with their human counterparts…Perhaps as a consequence of these differences, several clinical trials have shown that therapies that showed promise in these mouse models lacked efficacy in patients (although they have generally been safe and well tolerated” (last paragraph on page 6 continues to first two lines on page 7); and “With gene therapy, the field has seen success with combined forebrain and cerebellar delivery of AAV2-PPT1 in Ppt1-/- mice147, combined intracranial and intrathecal delivery of AAV9 in Ppt1-/- mice and AAV1 and AAV2 delivery across several distinct brain regions150,155” (page 16, bottom of first full paragraph).
3. The amount of direction or guidance provided
Apart from disclosing the combined intrathecal and intravenous administration of scAAV9/CLN1 expressing PPT1 protein delays symptom development and improves the life span of CLN1 knockout mice or improves the performance of CLN1 knockout mice in behavioral assays (see at least Examples 2-3 and 5); the specification fails to provide sufficient guidance for an ordinary skilled artisan on how to treat (e.g., including prevent the symptoms or disease from occurring in a subject, to arrest the disease development, or causing the regression of the disease or symptoms of the disease) infantile Batten disease (IBD) or an IBD related disorder in a subject, including a human subject, using a combination of intrathecal and intravenous delivery of any AAV viral particle comprising a polynucleotide comprising a CLN1 gene as encompassed broadly by the instant claims. Particularly, Rozenberg et al still stated in May 2018 “Infantile neuronal ceroid lipofuscinosis (INCL), a lysosomal storage disorder caused by mutations in the CLN1 gene, is a severe neurodegenerative disease affecting both the central nervous system, including the spinal cord, and peripheral organs, for which there is currently no cure or treatments that address the underlying cause”. There is no evidence of record indicating that IBD or any IBD related disorder in any subject has been successfully prevented, the disease progression and/or disease symptoms have been regressed to the original state. With respect to claims 23-24, the instant specification also fails to provide any guidance for an ordinary skill in the art on to treat any IBD related disorder that already has an increased expression of CLN1 gene (an embodiment of altered expression of CLN1 gene), and how the additional supplementation of an exogenous CLN1 gene product would yield any therapeutic effect as encompassed by the instant claims? Apart from disclosing the use of scAAV9/CLN1 viral particle for intravenous administration, the instant specification also fails to provide sufficient guidance for an ordinary skill in the art on how to use a recombinant viral particle of other serotypes such as AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, or AAV7 to cross the blood brain barrier via intravenous administration to target the brain tissue in order to yield the desired therapeutic effects for a subject in need of treatment as claimed broadly in claims 23-24, particularly Shyng et al taught that treating both the spinal cord and brain is needed to provide an effective therapeutic strategy. Zincarelli et al (Molecular Therapy 16:1073-1080, 2008) analyzed AAV serotypes 1-9 mediated gene expression and tropism in mice after systemic injection, and they found that AAV9 had the best viral genome distribution and highest protein level, including one of only two AAV serotypes (AAV8 and AAV9) that are capable of expressing luciferase protein expression in brain (see Abstract; and Figure 4). Additionally, Kaspar et al (WO 2010/071832) also stated “To date, efficient glial transduction has not been reported for any AAV serotype indicating that AAV9 has a unique transduction property in the CNS following intravenous delivery” (paragraph [0092]); and “In summary, these results demonstrate the unique capacity of AAV9 to efficiently target cells within the CNS, and in particular widespread neuronal and motor neuron transduction in the neonate, and extensive astrocyte transduction in the adult following intravenous delivery” (paragraph [0113]). The instant specification also fails to provide any guidance for a skill in the art how to modify and/or mutate any capsid protein, such that the resulting altered capsid protein has an ability to cross the blood brain barrier and/or efficiently transducing target cells within the CNS. For example, which specific modification(s) and/or mutation(s) in capsid proteins to alter the tropism of AAV2, AAV6 or AAV8 viral particles such that they are capable of crossing the blood brain barrier to transduce target cells within the CNS as efficiently as AAV9 following an intravenous administration, and particularly to yield the desired therapeutic effects as encompassed broadly by claims 23-24?
Since the prior art at the effective filing date of the present application failed to provide sufficient guidance regarding to the aforementioned issues, it is incumbent upon the present application to do so. Given the state of the prior art discussed above, coupled with the lack of sufficient guidance provided by the present application, it would have required undue experimentation for a skilled artisan to make and/or use the instant treatment method as claimed broadly.
The physiological art was already recognized as unpredictable (MPEP 2164.03). As set forth in In re Fisher, 166 USPQ 18 (CCPA 1970), compliance with 35 USC 112, first paragraph requires:
That scope of claims must bear a reasonable correlation to scope of enablement provided by specification to persons of ordinary skill in the art; in cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws; in cases involving unpredictable factors, such as most chemical reactions and physiological activity, scope of enablement varies inversely with degree of unpredictability of factors involved.
Moreover, the courts have also stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in the patent application (27 USPQ2d 1662 Ex parte Maizel.).
Accordingly, due to the lack of sufficient guidance provided by the specification regarding to the issues set forth above, the state and unpredictability of the relevant gene therapy art to attain the desired therapeutic effects, and the breadth of the instant claims, it would have required undue experimentation for one skilled in the art to make and use the instant broadly claimed invention.
Response to Arguments
Applicant’s argument related to the above modified 112(a) rejection in the Amendment dated 07/16/2025 (page 6) has been fully considered but it is respectfully not found persuasive for the reasons discussed below.
Applicant argued simply that currently amended independent claim 1 should overcome the rejection for lack of enablement.
Please refer to the above modified 112(a) rejection for details. With respect to currently amended independent claim 1, Applicant still has not addressed the issue of the broad breadth of “treating” that encompasses preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease, arresting the disease development, or causing the regression of the disease or symptoms of the disease. Additionally, independent claims 23-24 have not been amended and they are still not enabled for the same issues already set forth in the previous Non-Final rejection dated 04/17/2025.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Amended claims 1, 3-7, 9-21 and 23-26 are rejected under 35 U.S.C. 103 as being unpatentable over Gray (WO 2017/218450; IDS) in view of Shyng et al (PNAS, doi/10.1073/pnas.1701832114, E5920-E5929, 2017; IDS) and Kielian et al (WO 2016/100575). This is a slightly modified rejection necessitated by Applicant’s amendment.
Amended claims 1, 3-7, 9-21 and 25-26 are directed to a method for treating infantile Batten Disease (IBD) or a IBD related disorder in a subject in need thereof that is caused by a decrease in CLN1 gene expression, comprising an intrathecal administration of an effective amount of any first AAV viral particle comprising a polynucleotide comprising a CLN1 gene, and an intravenous administration of an effective amount of a second AAV9 viral particle comprising a polynucleotide comprising a CLN1 gene, wherein the intrathecal administration precedes the intravenous administration, thereby treating IBD or an IBD related disorder.
Claims 23-24 are drawn to a method for treating infantile Batten Disease (IBD) or an IBD related disorder in a subject in need thereof, comprising an intrathecal administration of an effective amount of a first AAV viral particle comprising a polynucleotide comprising a CLN1 gene, and an intravenous administration of an effective amount of a second AAV viral particle comprising a polynucleotide comprising a CLN1 gene, thereby treating IBD or an IBD related disorder, wherein the polynucleotide of the first viral particle and/or the polynucleotide of the second viral particle comprises a codon-optimized CLN1 gene sequence having at least 99% identity to SEQ ID NO: 1 (924-nucleotide sequence).
With respect to the elected species, Gray already taught at least a method of treating infantile neuronal liposuscinosis (infantile Batten disease) in a subject, comprising administering to the subject a therapeutically effective amount of a vector comprising an optimized CLN1 gene having SEQ ID NO: 1 that is 100% identical to SEQ ID NO: 1 of the present application (encoding the amino acid sequence of SEQ ID NO: 3) in the form of a recombinant AAV vector/viral particle (e.g., AAV9), wherein the administering comprises more than one administration (e.g., two, three, four or more) may be employed to achieve the desired level of gene expression over a period of various intervals, and wherein each administration may be by the same or different routes (e.g., two administrations 1 hour apart by different routes), and examples modes of administration includes intrathecal, parenteral (e.g., intravenous, subcutaneous, intramuscular), intracerebral among others (see at least Abstract; Summary of the Invention; particularly paragraphs [0044], [0075], [0097], [0107]-[0108],and [0150]-[0154]; and attached sequence searches below). Gray stated “[t]he viral vector is administered to the CNS, the peripheral nervous system, or both” (paragraph [0154]); “In some embodiments, the vector is a self-complementary or duplexed AAV (scAAV) vector….Use of scAAV to express the CLN1 ORF may provide an increase in the number of cells transduced, the copy number per transduced cell, or both” (paragraph [0113]); and “In certain embodiments, the expression cassette comprises an AAV ITR, an enhancer, a promoter, an intron, a human CLN1 open reading frame, a polyadenylation site, and an AAV ITR, optionally in the recited order. In certain embodiments, the expression cassette comprises a CMV enhancer, a chicken beta actin promoter, a hybrid/modified MVM intron, a human CLN1 open reading frame and a bovine growth hormone polyadenylation site, optionally in the recited order” (paragraph [0109]). Gray also disclosed exemplary doses for achieving therapeutic effects that include virus titers of at least 1012, 1013, 1014, 1015, 1016, 1017, or 1018 transducing units or more (paragraph [0151]); and in Example 1 CLN knockout mice at different ages were administered intrathecally with low (7 x 1010 vg), medium (2.2 x 1011 vg), or high dose (7 x 1011 vg) with the gene transfer of the CLN1 expression cassette via the AAV vector provided some benefit in motor function at all doses and ages of treatment as shown in Fig. 8, with earlier intervention at a higher dose providing the greatest benefit (paragraphs [0172]-[0175]; and Fig. 8).
Gray did not teach explicitly a method of treating infantile Batten disease in a subject in need thereof using the specific combination of an intrathecal administration of an effective amount of a first recombinant AAV viral particle comprising a CLN1 gene and an intravenous administration of an effective amount of a second recombinant AAV viral particle comprising a CLN1 gene, preferably the intrathecal administration precedes the intravenous administration.
Before the effective filing date of the present application (04/29/2019), Shyng et al disclosed that infantile neuronal ceroid lipofuscinosis (INCL, or infantile Batten disease or CLN1 disease) is an inherited neurodegenerative storage disorder caused by a deficiency of the lysosomal enzyme palmityol protein thioesterase 1 (PPT1); and it was widely believed that the pathology associated with INCL was limited to the brain but they found unexpected that profound pathology in the human INCL spinal cord (Abstract). They stated “Various forebrain-directed gene therapy approaches have only limited success in Ppt1-/- mice. Targeting the spinal cord via intrathecal administration of an adeno-associated virus (AAV) gene transfer vector significantly prevented pathology and produced significant improvements in life span and motor function in Ppt1-/- mice. Surprisingly, forebrain-directed gene therapy resulted in essentially no PPT1 activity in the spinal cord, and vice versa. This leads to a reciprocal pattern of histological correction in the respective tissues when comparing intracranial with intrathecal injections. However, the characteristic pathological features of INCL were also most completely absent in both the brain and the spinal cord when intracranial and intrathecal injections of the same AAV vector were combined. Targeting both the brain and spinal cord also produced dramatic and synergistic improvements in motor function with unprecedented increase in life span” (Abstract). Shyng et al used a third generation AAV2/9-hPPT1 vector for intrathecal (IT) injection alone or in combination with intracranial (IC) injection in Ppt1-/- mice (see sections titled “Recombinant AAV production” and “Intracranial and intrathecal injections” at page E5928, left column). Shyng et al also stated “Although the combination therapy can dramatically and significantly increase life span and improve motor function, the IC/IT-AAV2/9-hPPT1-treated mice still have a reduced life span compared with their wild-type littermates, suggesting that these mice may be succumbing either to the residual pathology in regions of the CNS such as the thalamus or to disease outside of the nervous system” (page E5927, right column, first sentence of second paragraph).
Moreover, Kielian et al already taught a method for delivering a transgene to CNS tissue in a subject (e.g., a human) that may comprise administering a rAAV that expresses the human gene CLN3 by a single route or by multiple routes for the treatment of juvenile Batten disease (see at least Abstract; and particularly paragraphs [0115] and [0065]). Kielian et al stated “For example, delivering a transgene to CNS tissue in a subject may comprise administering to the subject, by intravenous administration, an effective amount of a rAAV that crosses the blood-brain-barrier. Delivering at transgene to CNS tissue in a subject may comprise administering to the subject an effective amount of a rAAV by intrathecal administration or intracerebral administration….A method of delivering a transgene to CNS tissue in a subject may comprise co-administering of an effective amount of a rAAV by two different administration routes e.g., by intrathecal administration and by intracerebral administration. Co-administration may be performed at approximately the same time, or different time” (paragraph [0115]); and “As demonstrated herein AAV9 can cross the blood-brain barrier (BBB) following intravenous administration to transduce neurons and glia within the brain” (second last sentence in paragraph [0083]). Kiellian et al also taught that the effective amount of rAAV is 1010, 1011, 1012, 1013, 1014, 1015 or 1016 genome copies per kg (second last sentence of paragraph [0114] and paragraph [0028]). Fig. 3 showed scAAV9-mediated expression of hCLN3 in various brain regions that include cerebellum (CB), thalamus (TH), hippocampus (HP), striatum (ST) and visual cortex (VC) via intravenous injection of 2 x 1012 vg in one month-old CLN3∆ex7/8 mice (paragraph [0036] and Fig. 3).
Accordingly, it would have been obvious for an ordinary skilled artisan to modify the teachings of Gray by also at least administering an effective amount of a recombinant AAV9 viral particle comprising a CLN1 gene to the brain via intravenous administration subsequent to the intrathecal administration (targeting the spinal cord) of an effective amount of a recombinant AAV9 viral particle comprising a CLN1 gene (a combination of intrathecal and intravenous administrations) for the treatment of IBD in a subject in need thereof, in light of the teachings of Shyng et al and Kielian et al as presented above with a reasonable expectation of success.
An ordinary skilled artisan would have been motivated to carry out the above modification because: (i) Shyng et al already taught successfully in targeting both the brain and spinal cord for producing dramatic and synergistic improvements in motor function in treated Ppt1-/- mice; and noted that although the combination therapy can dramatically and significantly increase life span and improve motor function, the IC/IT-AAV2/9-hPPT1-treated mice still have a reduced life span compared with their wild-type littermates, suggesting that these mice may be succumbing either to the residual pathology in regions of the CNS such as the thalamus or to disease outside of the central nervous system; and (ii) Kielian et al already taught co-administering of an effective amount of a rAAV to the CNS by two different administration routes that includes intrathecal administration (targeting the spinal cord) and intravenous administration with an effective amount of a rAAV that crosses the blood-brain-barrier (targeting the brain) for the treatment of juvenile Batten disease; with an exemplification showing scAAV9-mediated expression of hCLN3 in various brain regions that include cerebellum (CB), thalamus (TH), hippocampus (HP), striatum (ST) and visual cortex (VC) via intravenous injection of 2 x 1012 vg in one month-old CLN3∆ex7/8 mice. Please also note that the primary Gray reference already taught that more than one administration may be employed to achieve the desired level of gene expression over a period of various intervals, and each administration may be by the same or different routes; with Example 1 already showed that CLN knockout mice at different ages were administered intrathecally with low (7 x 1010 vg), medium (2.2 x 1011 vg), or high dose (7 x 1011 vg) with the gene transfer of the CLN1 expression cassette via the AAV vector provided some benefit in motor function at all doses and ages of treatment.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Gray, Shyng et al and Kielian et al; coupled with a high level of skill of an ordinary skilled artisan in the relevant art.
The modified treatment method resulting from the combined teachings of Gray, Shyng et al and Kielian et al as set forth above is indistinguishable and encompassed by the claimed treatment methods of the present application.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment dated 07/16/2025 (pages 8-11) have been fully considered but they are respectfully not found persuasive for the reasons discussed below.
A. The combination of cited references teaches and suggests the combination of intrathecal and intravenous administration, including wherein the intrathecal administration precedes the intravenous administration.
Applicant argued that none of Shyng and Kielian cure the deficiency of Gray in explicitly teach the combination of intrathecal and intravenous administration. Applicant argued that the only combination of routes of administration suggested by Shyng is a combination of intracranial and intrathecal injections, and at no point does Shyng suggest combining a systemic administration (such as intravenous administration), let alone an intravenous administration preceded by an intrathecal administration as required by pending claims. Applicant also argued that Kilean does not relate to CLN1 replacement therapy at all and instead teaches AAV vectors to deliver a CLN3 gene; and a person of skill in the art would appreciate that the CLN1 gene and the CLN3 gene encode completely different proteins with different roles and expression patterns. Applicant also argued that Kilean suggests that high levels of CLN3 expression are not advantageous for correcting the phenotype in CLN3-deficient mice (paragraph [0146]). In contrast, the data in the instant specification demonstrate that supraphysiological levels of serum PPT1 (CLN1 gene product) had no detrimental effects (paragraphs [0165]-[0166]; and Figs. 9A-B, and 10). Thus, a person of skill in the art would not rely on the CLN3 data in Kielian to modify the CLN1 vector taught by Grey and Shyng. Applicant further argued that Kielian briefly mentions the administration of an AAV vector by two routes of administration, but the only examples given is the combination of intrathecal and intracerebral administration (paragraph [0115]); and at no point does the data in Kielian suggest that additional administration by the intrathecal route would have any benefit for CLN3 gene delivery, let alone for CLN1 gene delivery as presently claimed.
First, it is noted that independent claims 23-24 do not require the intrathecal administration precedes the intravenous administration, nor are they limited the use of a second AAV viral particle to be AAV9.
Second, since the above rejection was made under 35 U.S.C. 103 none of the cited references have to teach every limitation of the instant claims. It appears that Applicant considered each of the cited references in total isolation one from the others, and not the specific combination of Gray, Shyng et al and Kielian et al as set forth in the above 103 rejection.
Third, although the Shyng reference does not teach the specific combination of intrathecal administration and intravenous administration, including the intrathecal administration precedes the intravenous administration; the reference teaches explicitly that targeting both the brain and spinal cord produced dramatic and synergistic improvements in motor function with unprecedented increase in life span, with targeting the spinal cord via intrathecal administration of an adeno-associated virus (AAV) gene transfer vector significantly prevented pathology and produced significant improvements in life span and motor function in Ppt1-/- mice. The Shyng reference also disclosed clearly that the (intracranial/intrathecal) IC/IT-AAV2/9-hPPT1-treated mice still have a reduced life span compared with their wild-type littermates, suggesting that these mice may be succumbing either to the residual pathology in regions of the CNS such as the thalamus or to disease outside of the nervous system. The Kielian reference was cited to demonstrate that AAV9 can cross the blood-brain barrier (BBB) following intravenous administration to transduce neurons and glia within the brain, and Fig. 3 showed scAAV9-mediated expression of hCLN3 in various brain regions that include cerebellum (CB), thalamus (TH), hippocampus (HP), striatum (ST) and visual cortex (VC) via intravenous injection of 2 x 1012 vg in one month-old CLN3∆ex7/8 mice. Kielian et al also stated clearly “For example, delivering a transgene to CNS tissue in a subject may comprise administering to the subject, by intravenous administration, an effective amount of a rAAV that crosses the blood-brain-barrier” (paragraph [0115]); and that the teachings of Kielian et al are not necessarily limited only working examples. Accordingly, as already set forth in the above 103 rejection, it would have been obvious for an ordinary skilled artisan to modify the teachings of Gray by also at least administering an effective amount of a recombinant AAV9 viral particle comprising a CLN1 gene to the brain via intravenous administration subsequent to the intrathecal administration (targeting the spinal cord) of an effective amount of a recombinant AAV9 viral particle comprising a CLN1 gene (a combination of intrathecal and intravenous administrations) for the treatment of IBD in a subject in need thereof with a reasonable expectation of success because: (i) Shyng et al already taught successfully in targeting both the brain and spinal cord for producing dramatic and synergistic improvements in motor function in treated Ppt1-/- mice; and noted that although the combination therapy can dramatically and significantly increase life span and improve motor function, the IC/IT-AAV2/9-hPPT1-treated mice still have a reduced life span compared with their wild-type littermates, suggesting that these mice may be succumbing either to the residual pathology in regions of the CNS such as the thalamus or to disease outside of the central nervous system; and (ii) Kielian et al already taught co-administering of an effective amount of a rAAV to the CNS by two different administration routes that includes intrathecal administration (targeting the spinal cord) and intravenous administration with an effective amount of a rAAV that crosses the blood-brain-barrier (targeting the brain) for the treatment of juvenile Batten disease; with an exemplification showing scAAV9-mediated expression of hCLN3 in various brain regions that include cerebellum (CB), thalamus (TH), hippocampus (HP), striatum (ST) and visual cortex (VC) via intravenous injection of 2 x 1012 vg in one month-old CLN3∆ex7/8 mice. Please also note that the primary Gray reference already taught that more than one administration may be employed to achieve the desired level of gene expression over a period of various intervals, and each administration may be by the same or different routes; with Example 1 already showed that CLN knockout mice at different ages were administered intrathecally with low (7 x 1010 vg), medium (2.2 x 1011 vg), or high dose (7 x 1011 vg) with the gene transfer of the CLN1 expression cassette via the AAV vector provided some benefit in motor function at all doses and ages of treatment.
Fourth, with respect to paragraph [0146] in the Kielian reference that was cited by Applicant, it is noted that this paragraph merely states that high CLN3 expression in the brain was not advantageous for improved motor coordination, and not that high CLN3 expression in the brain was detrimental as implied by Applicant. Nevertheless, paragraph [0146] in the Kielian reference is relevant specifically to overexpression of CLN3 expression in CLN3∆ex7/8 mice; and not in the context of the combined teachings of Gray, Shyng et al and Kielian et al as set forth in the above 103 rejection.
B. The claimed invention does not exhibit unexpected superior properties.
Applicant argued that examples of the instant application show clearly that the claimed methods ameliorate lifespan and behavioral manifestations of CLN1 deficiency. Thus, the combined intrathecal and intravenous administration offered significantly larger survival benefits (Figs. 4B and 5B) and significantly slower disease progression (Figs. 6A-B) compared to intrathecal or intravenous administration alone. Additionally, Applicant argued that those that received combined intrathecal and intravenous of vector displayed significantly slower strength loss and performed better on these tasks than the knockout mice that received only intrathecal or only intravenous administration of the vector (Figs. 7A-B). Applicant also argued that contrary to the effects of CLN3 overexpression described by Kielian, the data in the instant application show that while administration of the CLN1 vector may lead to higher than normal level of PP1 protein in cells that only have slightly decreased CLN1 level, this would not be expected to have detrimental effects.
First, there is nothing that is “unexpected/surprising” regarding the combined intrathecal and intravenous administration offered significantly larger survival benefits, significantly slower disease progression, significantly slower strength loss and better performance compared to intrathecal or intravenous administration alone. This is because the Shyng reference teaches explicitly that targeting both the brain and spinal cord produced dramatic and synergistic improvements in motor function with unprecedented increase in life span, with targeting the spinal cord via intrathecal administration of an adeno-associated virus (AAV) gene transfer vector significantly prevented pathology and produced significant improvements in life span and motor function in Ppt1-/- mice; while the Kielian reference already demonstrated that AAV9 can cross the blood-brain barrier (BBB) following intravenous administration to transduce neurons and glia within the brain, and Fig. 3 showed scAAV9-mediated expression of hCLN3 in various brain regions that include cerebellum (CB), thalamus (TH), hippocampus (HP), striatum (ST) and visual cortex (VC) via intravenous injection of 2 x 1012 vg in one month-old CLN3∆ex7/8 mice.
Second, once again with respect to paragraph [0146] in the Kielian reference that was cited by Applicant, it is noted that this paragraph merely states that high CLN3 expression in the brain was not advantageous for improved motor coordination, and not that high CLN3 expression in the brain was detrimental as implied by Applicant. Nevertheless, paragraph [0146] in the Kielian reference is relevant specifically to overexpression of CLN3 expression in CLN3∆ex7/8 mice; and not in the context of the combined teachings of Gray, Shyng et al and Kielian et al as set forth in the above 103 rejection.
Third, should there be any “unexpected” result exist it must be commensurate with the scope of the claims. At least independent claims 23-24 do not require the intrathecal administration precedes the intravenous administration, nor are they limited the use of a second AAV viral particle to be AAV9. Currently amended independent claim 1 is also not necessarily limited the first AAV viral particle to be AAV9; and none of the pending claims require both the first AAV viral particle and the second AAV viral particle to be scAAV9/CLN1 particles used in Examples of the present application at specific dosages.
Fourth, please note that the standard under 35 U.S.C. 103 is a “reasonable” expectation of success.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Buj Bello et al (WO 2019/011817 with an effective filing date of 07/08/2017) taught a method of treating spinal muscular atrophy using a rAAV vector comprising a serotype 9 or rh10 AAV capsid to be administered locally with or without systemic co-delivery; and stated clearly “In some embodiment the rAAV vector may be administered by a combined intrathecal and/or intracerebral and/or peripheral (such as a vascular, for example intravenous or intra-arterial, in particular intravenous administration” (page 19, lines 22-25), and “Furthermore, thanks to its capacity to cross the blood brain barrier, the rAAV vector implemented in the invention (i.e. rAAV9 or rAAVrh10 vector) may be administered via a systemic route” (page 20, lines 25-27).
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763.
To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300.
Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
/QUANG NGUYEN/Primary Examiner, Art Unit 1631
WO2017218450-A1
Codon optimized CLN1 gene SEQ ID 1.
Query Match 100.0%; Score 924; Length 924;
Best Local Similarity 100.0%;
Matches 924; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGGCTTCTCCGGGGTGTCTGTGGCTGCTGGCAGTGGCACTCCTTCCCTGGACTTGCGCC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGCTTCTCCGGGGTGTCTGTGGCTGCTGGCAGTGGCACTCCTTCCCTGGACTTGCGCC 60
Qy 61 AGCCGGGCTCTGCAGCACCTCGACCCTCCAGCCCCTCTTCCACTGGTGATTTGGCACGGA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 AGCCGGGCTCTGCAGCACCTCGACCCTCCAGCCCCTCTTCCACTGGTGATTTGGCACGGA 120
Qy 121 ATGGGTGATTCCTGCTGTAATCCCCTGTCAATGGGAGCCATCAAGAAGATGGTGGAGAAG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 ATGGGTGATTCCTGCTGTAATCCCCTGTCAATGGGAGCCATCAAGAAGATGGTGGAGAAG 180
Qy 181 AAGATCCCTGGAATCTACGTGCTGTCACTGGAGATTGGAAAGACCCTGATGGAGGACGTC 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 AAGATCCCTGGAATCTACGTGCTGTCACTGGAGATTGGAAAGACCCTGATGGAGGACGTC 240
Qy 241 GAGAACTCCTTCTTCCTCAATGTCAACTCTCAAGTGACCACCGTCTGCCAGGCCCTGGCC 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GAGAACTCCTTCTTCCTCAATGTCAACTCTCAAGTGACCACCGTCTGCCAGGCCCTGGCC 300
Qy 301 AAGGACCCGAAGCTGCAGCAGGGGTATAATGCTATGGGGTTCAGCCAGGGAGGACAGTTC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 AAGGACCCGAAGCTGCAGCAGGGGTATAATGCTATGGGGTTCAGCCAGGGAGGACAGTTC 360
Qy 361 CTTCGGGCTGTGGCCCAACGCTGCCCTAGCCCACCCATGATCAACCTGATCTCAGTGGGT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 CTTCGGGCTGTGGCCCAACGCTGCCCTAGCCCACCCATGATCAACCTGATCTCAGTGGGT 420
Qy 421 GGCCAGCATCAGGGCGTGTTCGGACTTCCCCGGTGTCCCGGGGAATCCTCTCATATCTGC 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 GGCCAGCATCAGGGCGTGTTCGGACTTCCCCGGTGTCCCGGGGAATCCTCTCATATCTGC 480
Qy 481 GACTTCATCCGCAAAACTCTCAATGCAGGCGCTTATTCAAAGGTCGTCCAAGAGAGGCTG 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 GACTTCATCCGCAAAACTCTCAATGCAGGCGCTTATTCAAAGGTCGTCCAAGAGAGGCTG 540
Qy 541 GTGCAAGCCGAGTACTGGCACGATCCCATTAAGGAGGACGTGTACAGAAATCACTCAATC 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 541 GTGCAAGCCGAGTACTGGCACGATCCCATTAAGGAGGACGTGTACAGAAATCACTCAATC 600
Qy 601 TTTCTGGCCGACATTAACCAGGAGAGGGGAATTAACGAATCATATAAGAAGAATCTCATG 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 601 TTTCTGGCCGACATTAACCAGGAGAGGGGAATTAACGAATCATATAAGAAGAATCTCATG 660
Qy 661 GCCCTCAAAAAGTTCGTCATGGTGAAGTTCCTTAACGATAGCATTGTGGACCCAGTGGAC 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 661 GCCCTCAAAAAGTTCGTCATGGTGAAGTTCCTTAACGATAGCATTGTGGACCCAGTGGAC 720
Qy 721 AGCGAATGGTTCGGATTTTACCGCTCAGGCCAGGCAAAAGAAACCATCCCTCTCCAAGAG 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 721 AGCGAATGGTTCGGATTTTACCGCTCAGGCCAGGCAAAAGAAACCATCCCTCTCCAAGAG 780
Qy 781 ACTTCTCTTTACACCCAAGACAGACTTGGGCTTAAGGAAATGGATAACGCTGGTCAGCTG 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 781 ACTTCTCTTTACACCCAAGACAGACTTGGGCTTAAGGAAATGGATAACGCTGGTCAGCTG 840
Qy 841 GTGTTCCTCGCCACCGAAGGTGACCATCTGCAGCTCAGCGAAGAGTGGTTCTACGCTCAT 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 841 GTGTTCCTCGCCACCGAAGGTGACCATCTGCAGCTCAGCGAAGAGTGGTTCTACGCTCAT 900
Qy 901 ATCATCCCGTTTCTTGGTTGATAA 924
||||||||||||||||||||||||
Db 901 ATCATCCCGTTTCTTGGTTGATAA 924
WO2017218450-A1.
Codon optimized CLN1 gene SEQ ID 1.
Alignment Scores:
Length: 924
Score: 1628.00 Matches: 306
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 100.0% Indels: 0
Gaps: 0
US-17-607-315-3 (1-306) x BES79854 (1-924)
Qy 1 MetAlaSerProGlyCysLeuTrpLeuLeuAlaValAlaLeuLeuProTrpThrCysAla 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGCTTCTCCGGGGTGTCTGTGGCTGCTGGCAGTGGCACTCCTTCCCTGGACTTGCGCC 60
Qy 21 SerArgAlaLeuGlnHisLeuAspProProAlaProLeuProLeuValIleTrpHisGly 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 AGCCGGGCTCTGCAGCACCTCGACCCTCCAGCCCCTCTTCCACTGGTGATTTGGCACGGA 120
Qy 41 MetGlyAspSerCysCysAsnProLeuSerMetGlyAlaIleLysLysMetValGluLys 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 ATGGGTGATTCCTGCTGTAATCCCCTGTCAATGGGAGCCATCAAGAAGATGGTGGAGAAG 180
Qy 61 LysIleProGlyIleTyrValLeuSerLeuGluIleGlyLysThrLeuMetGluAspVal 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 AAGATCCCTGGAATCTACGTGCTGTCACTGGAGATTGGAAAGACCCTGATGGAGGACGTC 240
Qy 81 GluAsn