DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 32, 34-44, and 46-58 are pending. Claims 44, 46-52, and 56-58 are withdrawn from consideration as being drawn to a nonelected invention
Status of the Application
Applicant’s response and amendment filed 31 July 2025 are acknowledged and entered.
Applicant has amended Claims 32, 35, 41-42 and withdrawn Claims 44, 49, 49. Applicant has added Claims 54-55 and withdrawn Claims 56-58. Applicant has cancelled Claims 37-38, 40 and withdrawn Claims 48 and 50.
Response to Amendment
The amendment to the claims filed on 31 July 2025 does not comply with the requirements of 37 CFR 1.121(c) because Applicant has not properly indicated all altered text in the Claims. Claim 32 (a) previously recited:
wherein the sequence of said… SEQ ID NOs: 4, 6, 10, or 17 or an active fragment thereof…
The claim now recites:
comprising the sequence… SEQ ID NOs: 2-[[4, ]]6,U 10, 17, or 41-48, wherein the nucleotide sequence of said synthetic oligonucleotide molecule consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 + 10Kb C-to-T mutation…
The amended Claim is improper because it does not show that the claim previously recited or an active fragment thereof or what happened to that text.
Amendments to the claims filed on or after July 30, 2003 must comply with 37 CFR 1.121(c) which states:
(c) Claims. Amendments to a claim must be made by rewriting the entire claim with all changes (e.g., additions and deletions) as indicated in this subsection, except when the claim is being canceled. Each amendment document that includes a change to an existing claim, cancellation of an existing claim or addition of a new claim, must include a complete listing of all claims ever presented, including the text of all pending and withdrawn claims, in the application. The claim listing, including the text of the claims, in the amendment document will serve to replace all prior versions of the claims, in the application. In the claim listing, the status of every claim must be indicated after its claim number by using one of the following identifiers in a parenthetical expression: (Original), (Currently amended), (Canceled), (Withdrawn), (Previously presented), (New), and (Not entered).
(1) Claim listing. All of the claims presented in a claim listing shall be presented in ascending numerical order. Consecutive claims having the same status of “canceled” or “not entered” may be aggregated into one statement (e.g., Claims 1–5 (canceled)). The claim listing shall commence on a separate sheet of the amendment document and the sheet(s) that contain the text of any part of the claims shall not contain any other part of the amendment.
(2) When claim text with markings is required. All claims being currently amended in an amendment paper shall be presented in the claim listing, indicate a status of “currently amended,” and be submitted with markings to indicate the changes that have been made relative to the immediate prior version of the claims. The text of any added subject matter must be shown by underlining the added text. The text of any deleted matter must be shown by strike-through except that double brackets placed before and after the deleted characters may be used to show deletion of five or fewer consecutive characters. The text of any deleted subject matter must be shown by being placed within double brackets if strike-through cannot be easily perceived. Only claims having the status of “currently amended,” or “withdrawn” if also being amended, shall include markings. If a withdrawn claim is currently amended, its status in the claim listing may be identified as “withdrawn—currently amended.”
(3) When claim text in clean version is required. The text of all pending claims not being currently amended shall be presented in the claim listing in clean version, i.e., without any markings in the presentation of text. The presentation of a clean version of any claim having the status of “original,” “withdrawn” or “previously presented” will constitute an assertion that it has not been changed relative to the immediate prior version, except to omit markings that may have been present in the immediate prior version of the claims of the status of “withdrawn” or “previously presented.” Any claim added by amendment must be indicated with the status of “new” and presented in clean version, i.e., without any underlining.
(4) When claim text shall not be presented; canceling a claim.
(i) No claim text shall be presented for any claim in the claim listing with the status of “canceled” or “not entered.”
(ii) Cancellation of a claim shall be effected by an instruction to cancel a particular claim number. Identifying the status of a claim in the claim listing as “canceled” will constitute an instruction to cancel the claim.
(5) Reinstatement of previously canceled claim. A claim which was previously canceled may be reinstated only by adding the claim as a “new” claim with a new claim number.
Although it would be proper to send a notice of noncompliance (Since the reply filed on 31 July 2025 appears to be bona fide, applicant is given a TIME PERIOD of ONE (1) MONTH or THIRTY (30) DAYS from the mailing date of this notice, whichever is longer, within which to submit an amendment in compliance with 37 CFR 1.121 in order to avoid abandonment. EXTENSIONS OF THIS TIME PERIOD MAY BE GRANTED UNDER 37 CFR 1.136(a).) in the interest of compact prosecution and as a one-time courtesy the claims as submitted will be examined. See §Claim interpretation.
Applicant has amended the Spec. and Drawings to overcome Objections; the objections are withdrawn.
Applicant has amended the claims to overcome the 112(a) written description and enablement rejections; the 112(a) rejections are withdrawn.
Applicant has amended the claims to overcome the 112(b) and 112(d) rejections; the 112(b) and 112(d) rejections are withdrawn. The Markush rejection is maintained.
The 102 and 103 rejections are maintained.
The NSDP rejections are maintained. The NSDP rejections over US487, US907, and US777, are withdrawn because the instant claims no longer read on an additional agent that could read on the invention of the patented/copending clams. The NSDP rejection over App985 is withdrawn because the instant claims no longer read on a general antibiotic. The NSDP rejections over App274 and App025 are withdrawn because the applications have been abandoned.
Claims 32, 34-36, 39, 41-43, and 53-55 are examined.
Arguments applicable to newly applied rejections to amended or newly presented claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Information Disclosure Statement
The Information Disclosure Statements filed February 27, 2022 and January 22, 2025 have been considered.
Claim Interpretation
The term “intron 22 cryptic exon” is interpreted as an 84 base pair cryptic exon that is included in the mature mRNA of patients who have the 3849 + 10kb C-to-T splicing mutation. That interpretation is based on the Spec. (¶5) which teaches:
About 10-15% of CFTR mutations affect the correct splicing of the gene transcripts. Among these is the splicing mutation 3849 + 10kb C-to-T which leads to inclusion of an 84 base pair cryptic exon in the mature messenger RNA (mRNA) (denoted "intron 22 cryptic exon inclusion" mutation). This mutation is the 12th most common CFTR mutation in the world, which occurs in hundreds of CF patients worldwide (Kerem et al., 1997).
As discussed above, Applicant has submitted an improper amendment that fails to indicate all the text that was in the previous version of the claims. The claims are interpreted as they are currently written. Claim 32 recites:
A synthetic oligonucleotide molecule characterized by suppressing the inclusion of intron 22 cryptic exon in the mature mRNA of a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation,
a) comprising the sequence as set forth in any one of SEQ ID NOs: 2-6, 8, 10, or 17, or 41-48, wherein the nucleotide sequence of said synthetic oligonucleotide molecule consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation; or
b) consisting of the sequence as set forth in any one of SEQ ID NOs: 2-6,8, 10, 17, or 41-48, or an active fragment thereof wherein said active fragment consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation.
A sequence that meets the terms of either (a) or (b) will meet the terms of the claims. (a) is a synthetic oligont that comprises any one of SEQ ID NOs: 2-6, 8, 10, or 17, or 41-48, wherein the nucleotide sequence has a segment of exactly 17, 18, 19, 20, or 21 bases that are complementary to a pre-mRNA transcript of the specified mutant CFTR gene. (b) is a synthetic oligont that consists of any one of SEQ ID NOs: 2-6, 8, 10, or 17, or 41-48, or an “active fragment” of one of those sequences wherein the active fragment has a segment of exactly 17, 18, 19, 20, or 21 bases that are complementary to a pre-mRNA transcript of the specified mutant CFTR gene. Each of the recited SEQ ID NOs consists of 17, 18, 19, 20, or 21 nt. See also the 112(b) rejection.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 32, 34-36, 39, 41-43, and 53-55 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This rejection is necessitated by the claim amendments.
A claim may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173. In the present instance, Claim 32 recites the following which renders the claims indefinite:
A synthetic oligonucleotide molecule characterized by suppressing the inclusion of intron 22 cryptic exon in the mature mRNA of a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation,
a) comprising the sequence as set forth in any one of SEQ ID NOs: 2-6, 8, 10, 17, or 41-48, wherein the nucleotide sequence of said synthetic oligonucleotide molecule consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation; or
b) consisting of the sequence as set forth in any one of SEQ ID NOs: 2-6,8, 10, 17, or 41-48, or an active fragment thereof wherein said active fragment consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation.
The claims are indefinite because (a) recites that the sequence both compris[es] SEQ ID NOs … and also consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation. The claim recites both the open language of comprising and the closed language of consists of. It is not clear what Applicant intends. The claim is particularly unclear because (b) recites sequences consisting of the claimed SEQ ID NOs.
Claim 32 is rejected for those reasons and Claims 34-36, 39, 41-43, and 53-55 are rejected because they depend from Claim 32 and don’t remedy the issues. In the interest of compact prosecution the claims are interpreted as requiring that the synthetic oligont sequence comprises one of the recited SEQ ID NOs and also has a segment of exactly 17, 18, 19, 20, or 21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation.
Applicant should clarify whether (a) recites that the sequence comprises or consists of SEQ ID NOs.
Claims 41-42 are rejected on the basis that they contain an improper Markush grouping of alternatives. This rejection is maintained and updated in view of the claim amendments.
See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117.
The Markush groupings of (Claim 41):
… (a) a CFTR potentiator comprising N-(2,4-Di-tert-butyl-5-hydroxyphenyl)-4- oxo-1,4-dihydroquinoline-3-carboxamide (ivacaftor), QBW251, PTI-808, or VX-561 (deuterated ivacaftor);
(b) a CFTR corrector comprising 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl)cyclopropanecarbonyl] amino}-3-methylpyridin-2-yl}benzoic acid (lumacaftor), 1-(2,2-difluoro-1,3-benzodioxol-5-yl)-~{N}-[1-[(2~{R})-2,3-dihydroxypropyl]-6-fluoro-2-(1-hydroxy-2-methylpropan-2-yl)indol-5-yl]cyclopropane-1-carboxamide (tezacaftor), VX-659, VX-445, VX-152, VX-440, GLPG2222, FDL169, or PTI-801;
(c) a translational read-through agent comprising 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (Ataluren), or ELX-02;
(d) a CFTR amplifier comprising PTI-428; or
(e) a combination thereof
and (Claim 42):
the pharmaceutical composition of claim 39, further comprising an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof, wherein the antibiotic drug is cloxacillin, dicloxacillin, cephalosporin, trimethoprim, sulfamethoxazole, erythromycin, amoxicillin, clavulanate, ampicillin, tetracycline, linezolid, tobramycin or aztreonam lysine, fluoroquinolone, gentamicin, or monobactam
are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons:
The items across each list (i.e., CFTR potentiators/CFTR correctors/translational read through agents/CFTR amplifiers) do not share a common use because they are recited on lists of compounds that have different functions of potentiating, correcting, etc.
As discussed previously, the items within each list (i.e., all the CFTR potentiators, all the CFTR correctors, etc.) do share a common use but they do not share a common structure because they clearly have different chemical structures. For example, here are pictures of ELX-02 (top left) (from MedChemExpress.com. 2025. Exaluren Product Data Sheet. Accessed 08 October 2025), Ataluren (top right), lumacaftor (bottom left) and elexacaftor (bottom right) (Ataluren and elexacaftor from Wikipedia.org. 2025. “Ataluren” and “elexacaftor”. Available online. Accessed 08 October 2025.; lumacaftor modified from Wikipedia.org. 2024. “lumacaftor/ivacaftor”. Accessed 03 October 2024, of record):
PNG
media_image1.png
600
600
media_image1.png
Greyscale
PNG
media_image2.png
106
250
media_image2.png
Greyscale
PNG
media_image3.png
66
240
media_image3.png
Greyscale
PNG
media_image4.png
115
250
media_image4.png
Greyscale
Clearly those compounds have no shared structural similarity.
Regarding Claim 42, the Markush groupings of an antibiotic drug, a bronchodilator, a corticosteroid are improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: the items are recited to have different functions. A corticosteroid is a hormone whereas an antibiotic is an antimicrobial substance that have detrimental effects on bacteria. A bronchodilator is a different class of drugs that increase respiration. Additionally, the items have different structures. For example, the antibiotic penicillin (left) and the corticosteroid cortisol (right) have the following structures, which are clearly not the same (from Wikipedia.org. 2024. “antibiotic” and “corticosteroid”. Available online. Accessed 03 October 2024, of record.):
PNG
media_image5.png
114
170
media_image5.png
Greyscale
PNG
media_image6.png
162
200
media_image6.png
Greyscale
Clearly those compounds have different structures.
In addition, the different antibiotics recited in Claim 42 fall into different classes of antibiotics. One of skill in the art would not consider the use of one antibiotic synonymous with another recited antibiotic. Case in point, Smith (et al. 2018. Inhaled anti-pseudomonal antibiotics for long-term therapy in cystic fibrosis [Review]. Cochrane Database Syst. Rev. 3[3]:CD001021, “Smith”) teach that (§Abstract-Main results) tobramycin and aztreonam are used in the management of CF patients, while Rey (et al. 1998. Drug Disposition in Cystic Fibrosis. Clinic. Pharmacokinet. 35:313-329, “Rey”) teaches (§1.1 Antimicrobials, entire §; Table II) patients with CF metabolize some antibiotics differently from patients without CF, indicating one antibiotic cannot be readily exchanged for another.
To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 32, 34-36, 39, 41, 43, and 53-55 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by US Patent Application Publication No. 2015/0211010, published 30 July 2015, “App010”; App010 was issued on 01 October 2019 as US Patent No. US 10428328, of record on IDS. This rejection is maintained and updated in view of the claim amendments.
App010 is drawn to (§Abstract) oligonucleotides [oligos or oligont(s)] capable of binding to and modulating the splicing of the pre-mRNA of the CFTR gene, compositions including the oligonucleotides…and uses thereof. App010 teaches that (¶4) their invention includes the splicing mutation 3849+10 kb C-to-T which leads to inclusion of an 84 base pair cryptic exon in the mature messenger RNA (mRNA) (denoted “intron 22 cryptic exon inclusion” mutation). That is the same mutation as what is disclosed in the instant claims. The teachings of App010 indicate that it encompasses the instant invention. App010 teaches that the invention provides an oligo that binds to a pre-mRNA transcript of CFTR and suppresses the inclusion of a cryptic exon that exists in intron 22:
(¶39) the present invention provides a synthetic polynucleotide molecule, comprising a nucleotide sequence comprising a sequence of at least 20 consecutive nucleotide bases, wherein said synthetic polynucleotide molecule is capable of binding to a pre-mRNA transcript of the CFTR gene, and suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA. The phrase “suppress intron 22 cryptic exon inclusion” as used herein refers to lowering the occurrence of the addition of 84 nucleotides (SEQ ID NO: 5) found within intron 22 of the CFTR gene to the mature CFTR mRNA, leading to degradation of said mRNA by the nonsense mediated mRNA decay (NMD) mechanism, as illustrated in FIG. 6. In certain embodiments, said nucleotide sequence is complementary to the nucleotide sequence set forth in SEQ ID NO: 3, or to a fragment thereof.
App010 teaches (¶14, 60) their nt sequences comprise at least 18 nts and (¶15) are complementary to a fragment of SEQ ID NO 2, which is CFTR RNA. Those descriptions encompass the instantly claimed compounds because they teach that App010 encompasses oligonts that are complementary to a fragment of SEQ ID NO 2 (a 983-mer) or SEQ ID NO 3 (a 122-mer). ¶14 and ¶60 indicate that the oligos can be as short as 18-mers, so they encompass instant SEQ ID NOs 2-6, 8, 10, 17, and 41-44 because all of those are at least 18-mer and are complementary to a fragment of App010 SEQ ID NO 3.
Regarding Claim 32, App010 teaches (¶106, Tables 1-2) specific oligonts that modulate splicing. The following sequence alignments show that claimed SEQ ID NOs 5-6 and 8 are comprised by 25-mer sequences SEQ ID NOs 6-7 (i.e., Oligos #1 and 2) of App010:
RESULT 6
US-14-667-285A-6
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 6, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 6
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense Oligonucleotide
Query Match 100.0%; Score 20; Length 25;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AUCAAGAUGACAAGUCAACU 20 SEQ ID NO 5
||||||||||||||||||||
Db 3 AUCAAGAUGACAAGUCAACU 22 App010 SEQ ID NO 6
RESULT 2
US-14-667-285A-7
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 7, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 7
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense Oligonucleotide
Query Match 100.0%; Score 19; Length 25;
Best Local Similarity 100.0%;
Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GUGGUCUCCAGAAAUCAAG 19 SEQ ID NO 6
|||||||||||||||||||
Db 4 GUGGUCUCCAGAAAUCAAG 22 App010 SEQ ID NO 7
RESULT 2
US-14-667-285A-6
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 6, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 6
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense Oligonucleotide
Query Match 100.0%; Score 21; Length 25;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAAGAUGACAAGUCAACUGAA 21 SEQ ID NO 8
|||||||||||||||||||||
Db 5 CAAGAUGACAAGUCAACUGAA 25 App010 SEQ ID NO 6
Furthermore, App010 SEQ ID NO 7 comprises 17/19 consecutive nts of claimed SEQ ID NOs 3 and 10, as shown by the following alignments:
US-17-607-908-3
Query Match 6 NASEQ2_04302025_192553
Query Match 89.5%; Score 17; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CUCCAGAAAUCAAGAUG 17 SEQ ID NO 3
|||||||||||||||||
Db 9 CUCCAGAAAUCAAGAUG 25 App010 SEQ ID NO 7
NASEQ2_04302025_192802
Query Match 89.5%; Score 17; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 3 CUUGUGGUCUCCAGAAA 19 SEQ ID NO 10
|||||||||||||||||
Db 1 CUUGUGGUCUCCAGAAA 17 App010 SEQ ID NO 7
Additionally, App010 teaches (¶106, Tables 1-2) SEQ ID NO 8 (Oligo #3) which comprises 18/19 consecutive nts of claimed SEQ ID NO 2, as shown by the following alignment:
NASEQ2_04302025_192903
Query Match 94.7%; Score 18; DB 1; Length 25;
Best Local Similarity 100.0%;
Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 2 AACAGAUGGAAGACUCUU 19 SEQ ID NO 2
||||||||||||||||||
Db 1 AACAGAUGGAAGACUCUU 18 App010 SEQ ID NO 8
Since each App010 SEQ ID NO is a 25-mer, and App010 teaches ¶14 and ¶60 their invention encompasses oligos that can be as short as 18-mers, together that reads on the instant claim requirement that (32-[a]) the synthetic oligont comprises a sequence that consists of 17-21 consecutive bases complementary to the target or (32-[b]) the active fragment thereof consists of 17, 18, 19, 20, or 21 consecutive bases complementary to the target.
App010 Fig. 8 demonstrates that App010 Oligos #1-4 produce outcomes of suppressing the inclusion of intron 22 crypton exon in the mature mRNA of a CFTR gene having a 3849 + 10Kb C-to-T mutation (“3849 mutation”) because App010 teaches (¶50) Fig. 8A shows that following treatment of cells with the oligos, a marked elevation in the level of correctly spliced transcript (total CFTR) was observed. Under the same conditions aberrantly spliced transcripts were undetectable. An excerpt of Fig. 8 is shown here:
PNG
media_image7.png
479
1152
media_image7.png
Greyscale
That figure shows that (¶118) FIG. 8A depicts that oligonucleotides 1-4 completely prevented the formation of the CFTR 84 bp splicing variant in the transfected cells in both concentrations (25 and 10 nM). FIG. 8B depicts that oligonucleotides 1-4 were further able to dramatically increase by several folds the level of total CFTR mRNA [emphasis added]. Going to “undetectable” amounts or “completely prevent[ing] the formation” of aberrant CFTR mRNA easily meets the instant claim requirement of suppressing inclusion of intron 22 cryptic exon.
As discussed, App010 discloses (¶18, ¶60) synthetic polynt that can comprise 18 nt and (¶39) at least 20 nt.
Therefore the App010 sequences read on the limitations of Claim 32: App010 discloses sequences that comprise SEQ ID NOs 5-6 and 8 wherein the nt sequence consists of 17-21 bases complementary to a CFTR gene having a 3849+10Kb C[Wingdings font/0xE0]T mutation. App010 discloses sequences that encompass all the claimed SEQ ID NOs because App010 discloses (¶39) sequences complementary to SEQ ID NO 3 or a fragment thereof and which are at least (¶39, 60) 18 or 20 nt. That teaching encompasses all the claimed SEQ ID NOs 2-6, 8, 10, 17, and 41-48 because App010 teaches (¶18, 60) sequences that complementary to a fragment of SEQ ID NO 3 and which are at least 18 nt long.
Since the claimed SEQ ID NOs have the characteristic of consisting of 17, 18, 19, 20, or 21 bases that are complementary to a pre-mRNA transcript of CFTR gene having a 3849+10Kb C[Wingdings font/0xE0]T mutation, sequences that comprise those claimed sequences (i.e., those disclosed by App010) also share that same characteristic.
Regarding Claim 34, App010 SEQ ID NO 8 comprises claimed SEQ ID NO 38. The alignment of App010 SEQ ID NO 8 to claimed SEQ ID NO 2 shown above has bold/underlined claimed SEQ ID NO 38. Therefore App010 anticipates Claim 34.
Regarding Claim 35, the alignments of SEQ ID NOs 5-6 and 8 shown above indicate that App010 SEQ ID NOs 6-7 comprise 20, 19, and 21 consecutive nt bases of claimed SEQ ID NOs 5, 6, and 8 (respectively). App010 discloses (¶18, 57, 60) synthetic oligont can comprise at least 18 or 19 nt, indicating that their invention encompasses shortened versions of their sequences. Therefore App010 anticipates Claim 35.
Regarding Claims 36 and 53, App010 teaches (¶6-7, ¶17) splice-switching “antisense oligonucleotides”, or AOs, can be chemically modified and can include the following kinds of modifications that maintain AO stability, improve target affinity, and provide favorable pharmacokinetic properties: 2'-O-methyl-phospho-rothioate (2OMP), phosphorodiamidate morpholino oligomer (PMO), peptide nucleic acids (PNAs), 2-methoxyethyl phosphorothioate (MOE) and alternating locked nucleic acids (LNAs). App010 discloses (¶107) 2-O-methyl oligos comprising a phosphorothioate backbone. Those are modifications to the oligont backbone or sugar. Therefore App010 anticipates Claims 36 and 53.
Regarding Claim 39, App010 discloses (¶40) a pharmaceutical composition comprising the synthetic oligont and a pharmaceutically acceptable carrier. Therefore App010 anticipates Claim 39.
Regarding Claim 41, App010 teaches (¶21-23) the pharmaceutical compositions of the invention can comprise at least one additional anti-CF agent, that the additional anti-Cystic-Fibrosis agent is selected from the group consisting of a CFTR-splicing-modulating agent, a CFTR potentiator and a CFTR corrector, and that the CFTR potentiator can be N-(2,4-Di-tert-butyl-5-hy-droxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide (Ivacaftor), and that the CFTR corrector can be selected from the group consisting of 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (Ataluren) and 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl) cyclopro-panecarbonyl]amino}-3-methylpyridin-2-yl}benzoic acid (Lumacaftor). Therefore App010 anticipates Claim 41.
Regarding Claim 43, App010 teaches that (¶68) the pharmaceutical composition is formulated for oral, nasal, aerosol, inhalational, abdominal, subcutaneous, intra-peritoneal or intravenous administration. Therefore App010 anticipates Claim 43.
App010 teaches (¶108) the CFP15a nasal epithelial cell line is established from a patient heterozygous for W1282X and 3849+10 kb C to T mutations. App010 teaches (Example 2, ¶118-119, Fig. 8) the oligonts modified splicing in those cells. That indicates that the oligos were suitable for treating a subject heterozygous for the 3849+10 kb C to T mutation.
Regarding Claims 54-55, App010 discloses (¶39, 60) synthetic oligont that comprise 18 nt. Since comprise is open language, it can encompass synthetic oligont that are longer than 18 nt, but it does not have to encompass synthetic oligont that are longer than 18 nt. Therefore, the teachings of App010 encompass synthetic oligont that are exactly 18-mers, exactly 19-mers, exactly 20-mers, and exactly 21-mers. That reads on all of the claimed SEQ ID NOs that are 18-mer or longer: SEQ ID NOs 2-6, 8, 10, 17, and 41-44. Therefore App010 anticipates Claims 54-55.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 32, 34-36, 39, 41-43, and 53-55 are rejected under 35 U.S.C. 103 as being unpatentable over US Patent Application Publication No. 2015/0211010 (published 30 July 2015, “App010”; App010 was issued on 01 October 2019 as US Patent No. US 10428328, of record on IDS) as applied to claims 32, 34-41, 43, and 53 above, and further in view of Turnbull (and Davies. 2016. New drug developments in the management of cystic fibrosis lung disease. Expert Opinion on Pharmacotherapy Volume 17[8]:1103-1112, “Turnbull”, of record on IDS). This rejection is maintained and updated in view of the claim amendments.
The teachings of App010 as applicable to Claim(s) 32, 34-36, 39, 41, 43, and 53-55 have been described above in the 102 rejection.
App010 discloses synthetic oligonts (i.e., SEQ ID NOs 6-8) comprising claimed SEQ ID NOs 5-6 and 8. App010 SEQ ID NOs 6-8 are 25-mers. Those sequences comprise active fragments wherein the active fragment consists of 17-21 bases that are complementary to a pre-mRNA transcript of CFTR gene having a 3849+10KB C[Wingdings font/0xE0]T mutation.
App010 does not explicitly teach oligonts that consist of 18 or 19 consecutive bases.
However, App010 teaches (¶14, ¶18, ¶57, ¶60) in certain embodiments the nt sequence comprises at least 18 or 19 nts.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the sequences of App010 with their teaching about altering the length of the sequences to 18- or 19-mer for the benefit of identifying sequences shorter than 25-mer which possess similar function. One would have been motivated to do so with a reasonable expectation of success because App010 teaches making oligos that are 18 or 19-mer and shorter oligos are cheaper than longer oligos.
Altering the length of the oligos to identify the shortest length with effective function would have been a matter of routine experimentation. The Court has stated that generally such differences amount to mere optimization and will not support patentability unless there is evidence indicating the claimed feature is critical. “[W]here the general conditions of a claim are disclosed in the prior art, it is not inventive to discover the optimum or workable ranges by routine experimentation.” In the instant case, the specification as filed provides no evidence that the particular amount or range recited within the claims is critical because the amount of a specific ingredient in a composition is clearly a result-effective parameter that a person of ordinary skill in the art would have routinely optimized, as demonstrated by the fact that App010 allows for the oligos to be shorter than 25-mer, including 18- or 19-mer. Optimization of parameters is a routine practice that would have been obvious for a person of ordinary skill in the art to employ.
Therefore the limitations of Claims 32, 34-36, 39, 41, 43, and 53-55 would have been obvious in view of App010. That is the case because at least some of the SEQ ID NOs in Claim 32(a) and 32(b) are 18- or 19-mers (which App010 teaches). Claimed SEQ ID NOs 2-4, 6, 10, and 41 are 18-mers and SEQ ID NOs 42-44 are 19-mers.
Regarding Claim 42, App010 teaches (¶21) administering at least one additional anti-CF agent.
App010 does not teach the additional anti-CF agent is an antibiotic.
App010 does not teach the pharmaceutical composition, further comprising a therapeutically effective amount of an antibiotic drug (Claim 42).
However, Turnbull teaches that antibiotics are used to treat downstream manifestations of CF. Turnbull is drawn to a review of drug developments in management of CF. Turnbull teaches (§1.1. The basic defect in CF) the basic defect in CF leads to bronchial infection by bacteria. Turnbull teaches using antibiotics to treat downstream effects caused by the basic CF defect and that there is evidence that supporting the use of antibiotics in prophylaxis, i.e., to prevent infection: (§3.1.1. Antibiotics) Antibiotics, used orally, intravenously and through inhalation have long been a mainstay of CF pulmonary therapy, with evidence to support their use in prophylaxis,[59] eradication of early stage infection,[60] during exacerbations and as chronic, suppressive therapies.[61,62].
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligos of App010 with the antibiotics of Turnbull for the benefit of preventing bacterial infection in patients. One would have been motivated to do so with a reasonable expectation of success because Turnbull teaches that antibiotics have long been a mainstay of CF pulmonary therapy and evidence supports that they eradicate early stage infection and because App010 teaches (¶21) administering ASOs with an additional anti-CF agent. One would have been further motivated because an artisan would have realized that no medication works immediately so there is a gap in time between when ASOs or oligos are delivered and when symptoms including the thick mucus accumulation are alleviated, and an artisan would have wanted to administer antibiotics to prevent antibiotic infection during that time. Modifying the oligos of App010 with the antibiotics of Turnbull would have produced the limitations of Claim 42.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
***********Note: the instant claims recite pharmaceutical compositions and methods comprising combination therapies comprising the instant oligos and another agent that can be a CFTR-splicing-modulating agent, a CFTR potentiator, a CFTR corrector, a translational read-through agent, a CFTR amplifier, or a combination thereof (including the specific agents recited in Claims 40-41) and other CF drugs selected from an antibiotic drug, a bronchodilator, a corticosteroid, or any combination thereof. Therefore ANY and ALL of Applicant’s patented or copending claims that are directed to any of those categories of agent are subject to a nonstatutory double patenting rejection. Because time for examination does not permit an individual rejection over every single patent/copending application, a selection of patents and copending applications are rejected below. But any patent or copending application that is directed to any of the agents discussed is subject to an NSDP rejection.***********
Claims 32, 34-36, 39, 41-43, and 53-55 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following U.S. Patents in view of US Patent Application Publication No. 2015/0211010 (published 30 July 2015, “App010”; App010 was issued on 01 October 2019 as US Patent No. US 10428328) and Turnbull (and Davies. 2016. New drug developments in the management of cystic fibrosis lung disease. Expert Opinion on Pharmacotherapy Volume 17[8]:1103-1112, “Turnbull”). This rejection is maintained and updated in view of the claim amendments.
Application No.
Issued Patent No.
Abbreviation
issue date
Claims
15/869664
US 10731156
US156
2020-08-04
1-20
14/667285
US 10428328
US328
2019-10-01
1-9
Although the claims at issue are not identical, they are directed to overlapping subject matter.
The patented US156 Claims 1-20 are directed to a pharmaceutical composition comprising CFTR-splicing modulating agents that suppress exon 10 exclusion and that are complementary to SEQ ID NO 2, wherein the sequence can be 18-30 nts, to nts comprising modifications, polynts comprising SEQ ID NOs 6-8 or any active fragment thereof, and methods for using them to treat CF, to particular formulations, and to a kit that comprises the compounds and an additional anti-CF agent.
The patented US328 Claims 1-9 are directed to methods of improving at least one clinical parameter of CF in a patient by administering a CFTR-splicing modulating agent that suppresses exon 10 exclusion and which is complementary to SEQ ID NO 2, and to methods of using the compounds with an additional anti-CF agent.
The instant claims are directed to a synthetic oligonucleotide molecule characterized by suppressing the inclusion of intron 22 cryptic exon in the mature mRNA of a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation, a) comprising the sequence as set forth in any one of SEQ ID NOs: 2-6, 8, 10, or 17, or 41-48, wherein the nucleotide sequence of said synthetic oligonucleotide molecule consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation; or b) consisting of the sequence as set forth in any one of SEQ ID NOs: 2-6,8, 10, 17, or 41-48, or an active fragment thereof wherein said active fragment consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation and wherein the oligo can comprise SEQ ID NO 38 or comprises certain lengths (Claims 32, 34-35, 54-55), to the oligos comprising modifications (Claims 36, 53), to a pharmaceutical composition comprising the oligo and a pharmaceutically acceptable carrier (Claim 39) and in a particular delivery formulation (Claim 43), to the pharmaceutical composition further comprising a CFTR modifier that can be a CFTR-splice-modifying agent, CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others (Claim 41); and wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator (Claim 42). The instant claims require that the sequence of the oligo must comprise or consist of any of SEQ ID NOs 2-6, 8, 10, 17, and 41-48.
All the claim sets are directed to compositions for treating CF by administering an agent that targets the same mutation and which comprise the same sequences plus an additional anti-CF agent (which in the instant claims can be a CFTR-splice-modifying agent or a readthrough agent or a CFTR amplifier). An artisan might not know what are the patented SEQ ID NOs 6-8 so they’d look in the Spec. and find that those sequences comprise claimed SEQ ID NOs 2-3, 5-6, 8, and 10. All the claim sets are directed to the same anti-CF agents, so all the claim sets read on each other.
The patented claims do not recite the specific outcome of intron 22 cryptic exon suppression in the instant claims but App010, drawn to identical subject matter as the patented claims, teaches that the patented formulations result in the instantly claimed outcomes. Therefore, the instantly claimed compounds and formulations with additional agents would have been obvious in view of App010. App010 is drawn to (§Abstract) oligonucleotides [oligos or oligonts] capable of binding to and modulating the splicing of the pre-mRNA of the CFTR gene, compositions including the oligonucleotides…and uses thereof.
App010 Fig. 8 demonstrates that App010 Oligos #1-4 produce the claimed outcomes of suppressing the inclusion of intron 22 crypton exon in the mature mRNA of a CFTR gene having a 3849 + 10Kb C-to-T mutation (“3849 mutation”) because App010 teaches (¶50) Fig. 8A shows that following treatment of cells with the oligos, a marked elevation in the level of correctly spliced transcript (total CFTR) was observed. Under the same conditions aberrantly spliced transcripts were undetectable. An excerpt of Fig. 8 is shown here:
PNG
media_image7.png
479
1152
media_image7.png
Greyscale
That figure shows that (¶118) FIG. 8A depicts that oligonucleotides 1-4 completely prevented the formation of the CFTR 84 bp splicing variant in the transfected cells in both concentrations (25 and 10 nM). FIG. 8B depicts that oligonucleotides 1-4 were further able to dramatically increase by several folds the level of total CFTR mRNA [emphasis added]. Going to “undetectable” amounts or “completely prevent[ing] the formation” of aberrant CFTR mRNA easily meets the instant claim requirement of some suppression.
Regarding the claimed lengths, App010 discloses (¶18, 60) synthetic polynt that target the same exon skipping and can comprise 18 nt and (¶39) at least 20 nt.
Therefore the App010 sequences (oligos 1-4) read on all the limitations of Claim 32 and disclose sequences that encompass SEQ ID NOs 3, 5-6, 8, and 10, active fragments of those SEQ ID NOs, and an active fragment of SEQ ID NO 2.
Regarding the specific additional agents of Claim 41, App010 teaches (¶21-23) the pharmaceutical compositions of the invention can comprise at least one additional anti-CF agent, that the additional anti-Cystic-Fibrosis agent is selected from the group consisting of a CFTR-splicing-modulating agent, a CFTR potentiator and a CFTR corrector, and that the CFTR potentiator can be N-(2,4-Di-tert-butyl-5-hy-droxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide (Ivacaftor), and that the CFTR corrector can be selected from the group consisting of 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (Ataluren) and 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl) cyclopro-panecarbonyl]amino}-3-methylpyridin-2-yl}benzoic acid (Lumacaftor). Therefore App010 teaches Claim 41.
Regarding the antibiotic of instant Claim 42, Turnbull teaches that antibiotics are used to treat downstream manifestations of CF. Turnbull teaches (§3.1.1. Antibiotics) using antibiotics to treat downstream effects caused by the basic CF defect and that there is evidence that supporting the use of antibiotics in prophylaxis, i.e., to prevent infection.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant invention to modify the oligos of the patented claims with the teachings of App010 and the antibiotics of Turnbull for the benefit of optimizing the molecules and preventing bacterial infection in patients. One would have been motivated to do so with a reasonable expectation of success because App010 teaches the benefits of oligos that are identical to the patented compounds and because Turnbull teaches that antibiotics have long been a mainstay of CF pulmonary therapy and evidence supports that they eradicate early stage infection. Modifying the patented oligos of US156 and US328 with the teachings ofApp010 with the antibiotics of Turnbull would have produced the claimed invention.
This is a nonstatutory double patenting rejection.
Claims 32, 34-36, 39, 41-43, and 53-55 are rejected on the ground of nonstatutory double patenting as being unpatentable over the following claims of the following patents in view of App010 and Turnbull. This rejection is maintained and updated in view of the claim amendments.
Application No.
Issued Patent No.
Abbreviation
Publication or issue date
Claims
16/246920
US 10624851
US851
2020-04-21
12-15
14/115869
US 10179106
US106
2019-01-15
15-18
Although the claims at issue are not identical, they are directed to overlapping subject matter.
The patented US851 Claims 12-15 and US106 Claims 15-18 recite a method of treating a pathological condition in a subject, wherein the condition can be CF, comprising administering to the subject a liposome that can comprise a bioactive agent for treating the pathological condition.
The instant claims are directed to a synthetic oligonucleotide molecule characterized by suppressing the inclusion of intron 22 cryptic exon in the mature mRNA of a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation, a) comprising the sequence as set forth in any one of SEQ ID NOs: 2-6, 8, 10, or 17, or 41-48, wherein the nucleotide sequence of said synthetic oligonucleotide molecule consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation; or b) consisting of the sequence as set forth in any one of SEQ ID NOs: 2-6,8, 10, 17, or 41-48, or an active fragment thereof wherein said active fragment consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation and wherein the oligo can comprise SEQ ID NO 38 or comprises certain lengths (Claims 32, 34-35, 54-55), to the oligos comprising modifications (Claims 36, 53), to a pharmaceutical composition comprising the oligo and a pharmaceutically acceptable carrier (Claim 39) and in a particular delivery formulation (Claim 43), to the pharmaceutical composition further comprising a CFTR modifier that can be a CFTR-splice-modifying agent, CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others (Claim 41); and wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator (Claim 42). The instant claims require that the sequence of the oligo must comprise or consist of any of SEQ ID NOs 2-6, 8, 10, 17, and 41-48.
Both claim sets are directed to compositions for treating CF.
The patented US851 and US106 claims do not disclose the specific synthetic oligos of the instant claims.
However that composition is taught by the prior art because App010 teaches that (¶4) their invention includes the splicing mutation 3849+10 kb C-to-T which leads to inclusion of an 84 base pair cryptic exon in the mature messenger RNA (mRNA) (denoted “intron 22 cryptic exon inclusion” mutation). That is the same mutation as what is disclosed in the instant claims. The teachings of App010 indicate that it encompasses the instant invention. App010 teaches that (¶39, 60)the invention provides an oligo that binds to a pre-mRNA transcript of CFTR and suppresses the inclusion of a cryptic exon that exists in intron 22 and ¶57 and ¶60 teach that App010 encompasses 18-mers that are complementary to a fragment of SEQ ID NO 3. ¶14 indicates that the oligos can be as short as 18-mers, so they encompass instant SEQ ID NOs 2-6, 17, and 41-44 because all of those are at least 18-mer and are complementary to a fragment of App010 SEQ ID NO 3.:
App010 also teaches sequences that comprise SEQ ID NOs 2-3, 5-6, 8, and 10, or an active fragment thereof. App010 teaches (¶106, Tables 1-2) specific oligonts that modulate splicing. An exemplary alignment is shown here, but alignments to the other oligos can be found above in the 102 rejection:
RESULT 6
US-14-667-285A-6
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 6, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 6
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense Oligonucleotide
Query Match 100.0%; Score 20; Length 25;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AUCAAGAUGACAAGUCAACU 20 SEQ ID NO 5
||||||||||||||||||||
Db 3 AUCAAGAUGACAAGUCAACU 22 App010 SEQ ID NO 6
Further regarding Claim 32, App010 Fig. 8 demonstrates that App010 Oligos #1-4 produce the claimed outcomes of suppressing the inclusion of intron 22 crypton exon in the mature mRNA of a CFTR gene having a 3849 + 10Kb C-to-T mutation (“3849 mutation”) because App010 teaches (¶50) Fig. 8A shows that following treatment of cells with the oligos, a marked elevation in the level of correctly spliced transcript (total CFTR) was observed. Under the same conditions aberrantly spliced transcripts were undetectable. An excerpt of Fig. 8 is shown here:
PNG
media_image7.png
479
1152
media_image7.png
Greyscale
That figure shows that (¶118) FIG. 8A depicts that oligonucleotides 1-4 completely prevented the formation of the CFTR 84 bp splicing variant in the transfected cells in both concentrations (25 and 10 nM). FIG. 8B depicts that oligonucleotides 1-4 were further able to dramatically increase by several folds the level of total CFTR mRNA [emphasis added]. Going to “undetectable” amounts or “completely prevent[ing] the formation” of aberrant CFTR mRNA easily meets the instant claim requirement of some suppression. Therefore the App010 sequences read on all the limitations of Claim 32 and disclose sequences that encompass the claimed SEQ ID NOs.
Regarding Claims 36 and 53, App010 teaches (¶17) modifications.
Regarding Claim 41, App010 teaches (¶21-23) the pharmaceutical compositions of the invention can comprise at least one additional anti-CF agent, that the additional anti-Cystic-Fibrosis agent is selected from the group consisting of a CFTR-splicing-modulating agent, a CFTR potentiator and a CFTR corrector, and that the CFTR potentiator can be N-(2,4-Di-tert-butyl-5-hy-droxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide (Ivacaftor), and that the CFTR corrector can be selected from the group consisting of 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (Ataluren) and 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl) cyclopro-panecarbonyl]amino}-3-methylpyridin-2-yl}benzoic acid (Lumacaftor). Therefore App010 teaches Claim 41.
Regarding the antibiotic of instant Claim 42, Turnbull teaches that antibiotics are used to treat downstream manifestations of CF. Turnbull teaches (§3.1.1. Antibiotics) using antibiotics to treat downstream effects caused by the basic CF defect and that there is evidence that supporting the use of antibiotics in prophylaxis, i.e., to prevent infection.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the claimed invention to modify the oligos of the patented claims with the teachings of App010 and the antibiotics of Turnbull for the benefit of optimizing the molecules and preventing bacterial infection in patients. One would have been motivated to do so with a reasonable expectation of success because App010 teaches the benefits of oligos that are identical to the patented compounds and because Turnbull teaches that antibiotics have long been a mainstay of CF pulmonary therapy and evidence supports that they eradicate early stage infection.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant invention to package the oligos of App010 and Turnbull in the liposome of the US851 and US106 claims for the benefit of delivering the agents. Doing so would have produced the limitations of Claims 32, 34-36, 39, 41-43, and 53-55.
This is a nonstatutory double patenting rejection.
Claims 32, 34-36, 39, 41-43, and 53-55 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 32-52 of copending Application No. 18765286 (reference application, “App286”). NOTE: this application has been allowed as US Pat. No. 12351803 and is no longer provisional. This rejection is maintained and updated in view of the claim amendments.
Although the claims at issue are not identical, they are not patentably distinct from each other because the allowed App286 claims are directed to a synthetic oligonucleotide molecule complementary to a pre-mRNA transcript of a cystic fibrosis transmembrane conductance regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation, wherein the sequence of said synthetic oligonucleotide molecule consists of the sequence as set forth in SEQ ID NO: 1 or SEQ ID NO: 40 and characterized by increasing the percentage of correctly spliced mature CFTR mRNA by at least 10%; and decreasing the level of aberrantly spliced mature CFTR mRNA by at least 20%, to pharmaceutical compositions comprising the oligos that comprise additional components (CFTR modifier/potentiator/etc.), and to methods of using the oligos to treat CF.
The instant claims are directed to a synthetic oligont that at least partially suppresses the inclusion of a CFTR gene having a 3849 kb C[Wingdings font/0xE0]T mutation, wherein the sequence can be SEQ ID NOs 2-6, 8, 10, 17, or 41-48 and can comprise a chemically modified nt including the modification 2’OMP, to a pharmaceutical composition comprising the oligo and a pharmaceutically acceptable carrier, to the pharmaceutical composition further comprising a CFTR modifier that can be a CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others, wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator, and to methods of administering the oligos to treat CF (including via oral/nasal/inhalation and other kinds of administration), wherein the treatment can improve a clinical outcome including lung function and others.
The instant claims are directed to the same subject matter as App286 except App286 requires the sequence of the oligo to be either instant SEQ ID NOs 1 or 40 and the instant claims allow the sequence to be sequences shorter versions of those sequences. For example, App286 SEQ ID NO 1 comprises instant SEQ ID NOs 41-48. An exemplary alignment is shown here:
US-18-765-286-1
Query Match 100.0%; Score 17; DB 1; Length 20;
Best Local Similarity 88.2%;
Matches 15; Conservative 2; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAACAGAUGGAAGACU 17 SEQ ID NO 48
||||||||:|||||||:
Db 3 GCAACAGATGGAAGACT 19 App286 SEQ ID NO 1
Therefore it would not be possible to possess or use the instant compounds without the App286 compounds.
Claims 32, 34-36, 39, 41-43, and 53-55 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-12 of copending Application No. 17709485 (reference application, “App485”). This rejection is maintained and updated in view of the claim amendments.
Although the claims at issue are not identical, they are not patentably distinct from each other because the copending App485 claims are directed to methods of treating CF in a subject heterozygous for the 3849 kb C[Wingdings font/0xE0]T mutation (including wherein the patient also has an F508del mutation), the methods comprising administering (including via oral/nasal/inhalation and other kinds of administration) a therapeutically effective amount of one or more CFTR modifiers and a synthetic oligont that suppresses the inclusion of a CFTR gene having a 3849 kb C[Wingdings font/0xE0]T mutation, wherein the sequence can be SEQ ID NOs 1 or 40 and can comprise a chemically modified nt including 2-OMP, wherein the CFTR modifier can be a CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others, wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator, and, wherein the treatment can improve a clinical outcome including lung function and others.
The instant claims are directed to a synthetic oligont that at least partially suppresses the inclusion of a CFTR gene having a 3849 kb C[Wingdings font/0xE0]T mutation, wherein the sequence can be SEQ ID NOs 2-6, 8, 10, 17, and 41-48 and can comprise a chemically modified nt, to a pharmaceutical composition comprising the oligo and a pharmaceutically acceptable carrier, to the pharmaceutical composition further comprising a CFTR modifier that can be a CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others, wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator, and to methods of administering the oligos to treat CF (including via oral/nasal/inhalation and other kinds of administration), wherein the treatment can improve a clinical outcome including lung function and others. The instant claims require that the sequence of the oligo comprise SEQ ID NOs 2-6, 8, 10, 17, and 41-48. App485 SEQ ID NO 1 comprises instant SEQ ID NOs 41-48. An alignment of SEQ ID NOs 1 is shown here:
US-17-709-485-1
Query Match 100.0%; Score 17; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 17; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GCAACAGAUGGAAGACU 17
|||||||||||||||||
Db 3 GCAACAGAUGGAAGACU 19
It would not be possible to possess or use the instant compounds without the App485 compounds.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 32, 34-36, 39, 41-43, and 53-55 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over the listed claims of the listed copending Applications in view of App010 and Turnbull. This rejection is maintained and updated in view of the claim amendments.
Application No.
PGP Pub No
Abbreviation
Publication or claims date
Claims
17/911665
US 20230142669
App665
2023-05-11
1, 3, 5-13, 15-17, 19, 21-25
17/598272
US 20220040219
App272
2022-02-10
38-63
Although the claims at issue are not identical, they are directed to overlapping subject matter.
The copending App665 claims are directed to a method of exon skipping of CFTR exon 24, comprising administering a synthetic ASO wherein the method can comprise further administering a CFTR modifier that is a translational readthrough agent.
The copending App272 Claims 38-63 are directed to a method for treating CF in a subject, comprising administering exon skipping agents that induce skipping of exon 23 wherein the method can include further administering a CFTR modifier that is an amplifier.
The instant claims are directed to a synthetic oligonucleotide molecule characterized by suppressing the inclusion of intron 22 cryptic exon in the mature mRNA of a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation, a) comprising the sequence as set forth in any one of SEQ ID NOs: 2-6, 8, 10, or 17, or 41-48, wherein the nucleotide sequence of said synthetic oligonucleotide molecule consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation; or b) consisting of the sequence as set forth in any one of SEQ ID NOs: 2-6,8, 10, 17, or 41-48, or an active fragment thereof wherein said active fragment consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation and wherein the oligo can comprise SEQ ID NO 38 or comprises certain lengths (Claims 32, 34-35, 54-55), to the oligos comprising modifications (Claims 36, 53), to a pharmaceutical composition comprising the oligo and a pharmaceutically acceptable carrier (Claim 39) and in a particular delivery formulation (Claim 43), to the pharmaceutical composition further comprising a CFTR modifier that can be a CFTR-splice-modifying agent, CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others (Claim 41); and wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator (Claim 42). The instant claims require that the sequence of the oligo must comprise or consist of any of SEQ ID NOs 2-6, 8, 10, 17, and 41-48.
All the claim sets are directed to methods of treating CF by administering an agent plus an additional agent that can be a CFTR-splice-modifying agent or a readthrough agent or a CFTR amplifier, so all the claim sets read on each other.
In addition, the instantly claimed compounds would have been obvious in view of App010. The claimed composition is taught by or would have been obvious in view of the prior art because App010 teaches that (¶4) their invention includes the splicing mutation 3849+10 kb C-to-T which leads to inclusion of an 84 base pair cryptic exon in the mature messenger RNA (mRNA) (denoted “intron 22 cryptic exon inclusion” mutation). That is the same mutation as what is disclosed in the instant claims. The teachings of App010 indicate that it encompasses the instant invention. App010 teaches that (¶39)the invention provides an oligo that binds to a pre-mRNA transcript of CFTR and suppresses the inclusion of a cryptic exon that exists in intron 22 and ¶57 and ¶60 teach that App010 encompasses 18-mers that are complementary to a fragment of SEQ ID NO 3. ¶14 indicates that the oligos can be as short as 18-mers, so they encompass instant SEQ ID NOs 2-6, 17, and 41-44 because all of those are at least 18-mer and are complementary to a fragment of App010 SEQ ID NO 3.:
App010 also teaches sequences that comprise SEQ ID NOs 2-3, 5-6, 8, and 10, or an active fragment thereof. App010 teaches (¶106, Tables 1-2) specific oligonts that modulate splicing. An exemplary alignment is shown here, but alignments to the other oligos can be found above in the 102 rejection:
RESULT 6
US-14-667-285A-6
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 6, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 6
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense Oligonucleotide
Query Match 100.0%; Score 20; Length 25;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AUCAAGAUGACAAGUCAACU 20 SEQ ID NO 5
||||||||||||||||||||
Db 3 AUCAAGAUGACAAGUCAACU 22 App010 SEQ ID NO 6
Further regarding Claim 32, App010 Fig. 8 demonstrates that App010 Oligos #1-4 produce the claimed outcomes of suppressing the inclusion of intron 22 crypton exon in the mature mRNA of a CFTR gene having a 3849 + 10Kb C-to-T mutation (“3849 mutation”) because App010 teaches (¶50) Fig. 8A shows that following treatment of cells with the oligos, a marked elevation in the level of correctly spliced transcript (total CFTR) was observed. Under the same conditions aberrantly spliced transcripts were undetectable. An excerpt of Fig. 8 is shown here:
PNG
media_image7.png
479
1152
media_image7.png
Greyscale
That figure shows that (¶118) FIG. 8A depicts that oligonucleotides 1-4 completely prevented the formation of the CFTR 84 bp splicing variant in the transfected cells in both concentrations (25 and 10 nM). FIG. 8B depicts that oligonucleotides 1-4 were further able to dramatically increase by several folds the level of total CFTR mRNA [emphasis added]. Going to “undetectable” amounts or “completely prevent[ing] the formation” of aberrant CFTR mRNA easily meets the instant claim requirement of some suppression. Therefore the App010 sequences read on all the limitations of Claim 32 and disclose sequences that encompass the claimed SEQ ID NOs.
Regarding Claims 36 and 53, App010 teaches (¶17) modifications.
Regarding Claim 41, App010 teaches (¶21-23) the pharmaceutical compositions of the invention can comprise at least one additional anti-CF agent, that the additional anti-Cystic-Fibrosis agent is selected from the group consisting of a CFTR-splicing-modulating agent, a CFTR potentiator and a CFTR corrector, and that the CFTR potentiator can be N-(2,4-Di-tert-butyl-5-hy-droxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide (Ivacaftor), and that the CFTR corrector can be selected from the group consisting of 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (Ataluren) and 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl) cyclopro-panecarbonyl]amino}-3-methylpyridin-2-yl}benzoic acid (Lumacaftor). Therefore App010 teaches Claim 41.
Regarding the antibiotic of instant Claim 42, Turnbull teaches that antibiotics are used to treat downstream manifestations of CF. Turnbull teaches (§3.1.1. Antibiotics) using antibiotics to treat downstream effects caused by the basic CF defect and that there is evidence that supporting the use of antibiotics in prophylaxis, i.e., to prevent infection.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant invention to modify the oligos of the patented claims with the teachings of App010 and the antibiotics of Turnbull for the benefit of optimizing the molecules and preventing bacterial infection in patients. One would have been motivated to do so with a reasonable expectation of success because App010 teaches the benefits of oligos that are identical to the patented compounds and because Turnbull teaches that antibiotics have long been a mainstay of CF pulmonary therapy and evidence supports that they eradicate early stage infection.
Therefore the inventions of the App665 and App272 claims could be used with the invention of App010 and Turnbull, and doing that would produce the instant claims. Similarly, since the App665and App272 claims are directed to methods of treating CF that include administering a readthrough agent or amplifier and some claims recite administering an additional readthrough agent or amplifier, and the instant claims are directed to a compound that can be considered readthrough agent or amplifier, the App665 and App272, claims could require the instant claims.
This is a provisional nonstatutory double patenting rejection.
Claims 32, 34-36, 39, 41-43, and 53-55 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 33, 43-50, 52-54, 56-58, 60-62, 65-67 of copending Application No. 17997840 (“App840”) in view of App010 and Turnbull. This rejection is maintained and updated in view of the claim amendments.
Although the claims at issue are not identical, they are directed to overlapping subject matter.
The copending App840 claims are directed to a composition comprising glyceryltriacetate (GTA) and a method of improving breathing of a subject experiencing a breathing difficulty, said method comprises administering to a subject in need of such treatment an amount of GTA.
The instant claims are directed to a synthetic oligonucleotide molecule characterized by suppressing the inclusion of intron 22 cryptic exon in the mature mRNA of a Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene having a 3849 +10Kb C-to-T mutation, a) comprising the sequence as set forth in any one of SEQ ID NOs: 2-6, 8, 10, or 17, or 41-48, wherein the nucleotide sequence of said synthetic oligonucleotide molecule consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation; or b) consisting of the sequence as set forth in any one of SEQ ID NOs: 2-6,8, 10, 17, or 41-48, or an active fragment thereof wherein said active fragment consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation and wherein the oligo can comprise SEQ ID NO 38 or comprises certain lengths (Claims 32, 34-35, 54-55), to the oligos comprising modifications (Claims 36, 53), to a pharmaceutical composition comprising the oligo and a pharmaceutically acceptable carrier (Claim 39) and in a particular delivery formulation (Claim 43), to the pharmaceutical composition further comprising a CFTR modifier that can be a CFTR-splice-modifying agent, CFTR potentiator, CFTR corrector, Translational Read-Through agent, and CFTR amplifier, wherein the CFTR modifier can be ivacaftor, lumacaftor, tezacaftor, elexacaftor, or others (Claim 41); and wherein the composition can comprise an antibiotic/corticosteroid/bronchodilator (Claim 42). The instant claims require that the sequence of the oligo must comprise or consist of any of SEQ ID NOs 2-6, 8, 10, 17, and 41-48.
Both claim sets are directed to compositions for treating lung disease. It would have been obvious to use the invention of the App840 claims to deliver the instantly claimed invention.
In addition, the instantly claimed compounds would have been obvious in view of App010. The claimed composition is taught by or would have been obvious in view of the prior art because App010 teaches that (¶4) their invention includes the splicing mutation 3849+10 kb C-to-T which leads to inclusion of an 84 base pair cryptic exon in the mature messenger RNA (mRNA) (denoted “intron 22 cryptic exon inclusion” mutation). That is the same mutation as what is disclosed in the instant claims. The teachings of App010 indicate that it encompasses the instant invention. App010 teaches that (¶39)the invention provides an oligo that binds to a pre-mRNA transcript of CFTR and suppresses the inclusion of a cryptic exon that exists in intron 22 and ¶57 and ¶60 teach that App010 encompasses 18-mers that are complementary to a fragment of SEQ ID NO 3. ¶14 indicates that the oligos can be as short as 18-mers, so they encompass instant SEQ ID NOs 2-6, 17, and 41-44 because all of those are at least 18-mer and are complementary to a fragment of App010 SEQ ID NO 3.:
App010 also teaches sequences that comprise SEQ ID NOs 2-3, 5-6, 8, and 10, or an active fragment thereof. App010 teaches (¶106, Tables 1-2) specific oligonts that modulate splicing. An exemplary alignment is shown here, but alignments to the other oligos can be found above in the 102 rejection:
RESULT 6
US-14-667-285A-6
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 6, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 6
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense Oligonucleotide
Query Match 100.0%; Score 20; Length 25;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AUCAAGAUGACAAGUCAACU 20 SEQ ID NO 5
||||||||||||||||||||
Db 3 AUCAAGAUGACAAGUCAACU 22 App010 SEQ ID NO 6
Further regarding Claim 32, App010 Fig. 8 demonstrates that App010 Oligos #1-4 produce the claimed outcomes of suppressing the inclusion of intron 22 crypton exon in the mature mRNA of a CFTR gene having a 3849 + 10Kb C-to-T mutation (“3849 mutation”) because App010 teaches (¶50) Fig. 8A shows that following treatment of cells with the oligos, a marked elevation in the level of correctly spliced transcript (total CFTR) was observed. Under the same conditions aberrantly spliced transcripts were undetectable. An excerpt of Fig. 8 is shown here:
PNG
media_image7.png
479
1152
media_image7.png
Greyscale
That figure shows that (¶118) FIG. 8A depicts that oligonucleotides 1-4 completely prevented the formation of the CFTR 84 bp splicing variant in the transfected cells in both concentrations (25 and 10 nM). FIG. 8B depicts that oligonucleotides 1-4 were further able to dramatically increase by several folds the level of total CFTR mRNA [emphasis added]. Going to “undetectable” amounts or “completely prevent[ing] the formation” of aberrant CFTR mRNA easily meets the instant claim requirement of some suppression. Therefore the App010 sequences read on all the limitations of Claim 32 and disclose sequences that encompass the claimed SEQ ID NOs.
Regarding Claims 36 and 53, App010 teaches (¶17) modifications.
Regarding Claim 41, App010 teaches (¶21-23) the pharmaceutical compositions of the invention can comprise at least one additional anti-CF agent, that the additional anti-Cystic-Fibrosis agent is selected from the group consisting of a CFTR-splicing-modulating agent, a CFTR potentiator and a CFTR corrector, and that the CFTR potentiator can be N-(2,4-Di-tert-butyl-5-hy-droxyphenyl)-4-oxo-1,4-dihydroquinoline-3-carboxamide (Ivacaftor), and that the CFTR corrector can be selected from the group consisting of 3-[5-(2-fluorophenyl)-1,2,4-oxadiazol-3-yl]benzoic acid (Ataluren) and 3-{6-{[1-(2,2-difluoro-1,3-benzodioxol-5-yl) cyclopro-panecarbonyl]amino}-3-methylpyridin-2-yl}benzoic acid (Lumacaftor). Therefore App010 teaches Claim 41.
Regarding the antibiotic of instant Claim 42, Turnbull teaches that antibiotics are used to treat downstream manifestations of CF. Turnbull teaches (§3.1.1. Antibiotics) using antibiotics to treat downstream effects caused by the basic CF defect and that there is evidence that supporting the use of antibiotics in prophylaxis, i.e., to prevent infection.
Therefore, it would have been obvious to a person of ordinary skill in the art before the effective filing date of the instant invention to modify the oligos of the patented claims with the teachings of App010 and the antibiotics of Turnbull for the benefit of optimizing the molecules and preventing bacterial infection in patients. One would have been motivated to do so with a reasonable expectation of success because App010 teaches the benefits of oligos that are identical to the patented compounds and because Turnbull teaches that antibiotics have long been a mainstay of CF pulmonary therapy and evidence supports that they eradicate early stage infection.
Therefore the inventions of the App840 claims could be used with the invention of App010 and Turnbull, and doing that would produce the instant claims. Similarly, since the App840 claims are directed to methods of treating lung diseases, and the instant claims are directed to a compound for treating CF, a lung disease, the App840 claims could require the instant claims.
This is a provisional nonstatutory double patenting rejection.
Response to Arguments
Applicant's arguments filed 31 July 2025 have been fully considered but they are not persuasive. Arguments are addressed below. Arguments that are no longer relevant are not addressed.
112b
The claims are rejected for indefiniteness because Claim 32(a) recites that the sequence both comprises SEQ ID NOs … and also consists of 17-21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation. The claim recites both the open language of comprises and the closed language of consists of. It is not clear what Applicant intends. The claim is particularly unclear because (b) recites sequences consisting of the claimed SEQ ID NOs, so if (a) means the claimed SEQ ID NOs consist of 17-21 bases, what would differentiate (a) from (b)? It is simply unclear. That is why the claims are interpreted as requiring that the synthetic oligont sequence comprises one of the recited SEQ ID NOs and also has a segment of exactly 17, 18, 19, 20, or 21 bases that are complementary to a pre-mRNA transcript of said CFTR gene having a 3849 +10Kb C-to-T mutation.
Applicant should choose whether they want (a) to recite that the sequence comprises or consists of SEQ ID NO…
The transitional phrases "comprising", "consisting essentially of" and "consisting of" define the scope of a claim with respect to what unrecited additional components or steps, if any, are excluded from the scope of the claim. The determination of what is or is not excluded by a transitional phrase must be made on a case-by-case basis in light of the facts of each case.
I. COMPRISING
The transitional term "comprising", which is synonymous with "including," "containing," or "characterized by," is inclusive or open-ended and does not exclude additional, unrecited elements or method steps. See, e.g., Mars Inc. v. H.J. Heinz Co., 377 F.3d 1369, 1376, 71 USPQ2d 1837, 1843 (Fed. Cir. 2004) ("[L]ike the term ‘comprising,’ the terms ‘containing’ and ‘mixture’ are open-ended."). Invitrogen Corp. v. Biocrest Manufacturing, L.P., 327 F.3d 1364, 1368, 66 USPQ2d 1631, 1634 (Fed. Cir. 2003) ("The transition ‘comprising’ in a method claim indicates that the claim is open-ended and allows for additional steps."); Genentech, Inc. v. Chiron Corp., 112 F.3d 495, 501, 42 USPQ2d 1608, 1613 (Fed. Cir. 1997) ("Comprising" is a term of art used in claim language which means that the named elements are essential, but other elements may be added and still form a construct within the scope of the claim.); Moleculon Research Corp. v. CBS, Inc., 793 F.2d 1261, 229 USPQ 805 (Fed. Cir. 1986); In re Baxter, 656 F.2d 679, 686, 210 USPQ 795, 803 (CCPA 1981); Ex parte Davis, 80 USPQ 448, 450 (Bd. App. 1948) ("comprising" leaves "the claim open for the inclusion of unspecified ingredients even in major amounts"). In Gillette Co. v. Energizer Holdings Inc., 405 F.3d 1367, 1371-73, 74 USPQ2d 1586, 1589-91 (Fed. Cir. 2005), the court held that a claim to "a safety razor blade unit comprising a guard, a cap, and a group of first, second, and third blades" encompasses razors with more than three blades because the transitional phrase "comprising" in the preamble and the phrase "group of" are presumptively open-ended. "The word ‘comprising’ transitioning from the preamble to the body signals that the entire claim is presumptively open-ended." Id. In contrast, the court noted the phrase "group consisting of" is a closed term, which is often used in claim drafting to signal a "Markush group" that is by its nature closed. Id. The court also emphasized that reference to "first," "second," and "third" blades in the claim was not used to show a serial or numerical limitation but instead was used to distinguish or identify the various members of the group. Id.
In Amgen Inc. v. Amneal Pharmaceuticals LLC, 945 F.3d 1368, 1379, 2020 USPQ2d 3197 (Fed. Cir. 2020), in an infringement suit, the court interpreted a claim for a pharmaceutical composition having a "comprising" transition phrase and following limitations, including limitations requiring "at least one" binder and "at least one" disintegrant, each "consisting of" items listed in a Markush group. The court found that the Markush grouping recited particular binders or disintegrants, but while the components of the Markush grouping are closed as to the components therein, the claim transition "comprising" allowed for additional component(s) that were functionally similar to the members of the Markush grouping. Thus, the plain language of the claim requires "at least one" of the Markush members and does not further limit the claim to only binders and disintegrants listed in the Markush grouping. See also MPEP § 2117 for further discussion of a Markush group.
II. CONSISTING OF
The transitional phrase "consisting of" excludes any element, step, or ingredient not specified in the claim. In re Gray, 53 F.2d 520, 11 USPQ 255 (CCPA 1931); Ex parte Davis, 80 USPQ 448, 450 (Bd. App. 1948) ("consisting of" defined as "closing the claim to the inclusion of materials other than those recited except for impurities ordinarily associated therewith"). But see Norian Corp. v. Stryker Corp., 363 F.3d 1321, 1331-32, 70 USPQ2d 1508, 1516 (Fed. Cir. 2004) (holding that a bone repair kit "consisting of" claimed chemicals was infringed by a bone repair kit including a spatula in addition to the claimed chemicals because the presence of the spatula was unrelated to the claimed invention). A claim which depends from a claim which "consists of" the recited elements or steps cannot add an element or step.
A claim element defined by selection from a group of alternatives (a Markush grouping; see MPEP §§ 2117 and 2173.05(h)) requires selection from a closed group "consisting of" (rather than "comprising" or "including") the alternative members. Abbott Labs. v. Baxter Pharmaceutical Products Inc., 334 F.3d 1274, 1280, 67 USPQ2d 1191, 1196-97 (Fed. Cir. 2003). If the claim element is intended to encompass combinations or mixtures of the alternatives set forth in the Markush grouping, the claim may include qualifying language preceding the recited alternatives (such as "at least one member" selected from the group), or within the list of alternatives (such as "or mixtures thereof"). Id. In the absence of such qualifying language there is a presumption that the Markush group is closed to combinations or mixtures. Cf. Multilayer Stretch Cling Film Holdings, Inc. v. Berry Plastics Corp., 831 F.3d 1350, 1363-64, 119 USPQ2d 1773, 1784-85 (Fed. Cir. 2016) (presumption that Markush grouping does not encompass mixtures of listed resins overcome by intrinsic evidence in a dependent claim and the specification). See also Amgen Inc. v. Amneal Pharmaceuticals LLC, 945 F.3d 1368, 1378-79, 2020 USPQ2d 3179 (Fed. Cir. 2020) (the claim’s "comprising" transition phrase does not foreclose additional binders and disintegrants when an accused infringing product contains and meets the limitation’s requirements for one of the binders or disintegrants recited in the Markush groupings – there is no inconsistency with another binder or disintegrant outside of the Markush group also being part of the claimed formulation).
When the phrase "consisting of" appears in a clause of the body of a claim, rather than immediately following the preamble, there is an "exceptionally strong presumption that a claim term set off with ‘consisting of’ is closed to unrecited elements." Multilayer Stretch Cling Film Holdings, Inc. v. Berry Plastics Corp., 831 F.3d 1350, 1359, 119 USPQ2d 1773, 1781 (Fed. Cir. 2016) (a layer "selected from the group consisting of" specific resins is closed to resins other than those listed). However, the "consisting of" phrase limits only the element set forth in that clause; other elements are not excluded from the claim as a whole. Mannesmann Demag Corp. v. Engineered Metal Products Co., 793 F.2d 1279, 230 USPQ 45 (Fed. Cir. 1986). See also In re Crish, 393 F.3d 1253, 73 USPQ2d 1364 (Fed. Cir. 2004) (The claims at issue "related to purified DNA molecules having promoter activity for the human involucrin gene (hINV)." Id., 73 USPQ2d at 1365. In determining the scope of applicant’s claims directed to "a purified oligonucleotide comprising at least a portion of the nucleotide sequence of SEQ ID NO:1 wherein said portion consists of the nucleotide sequence from … to 2473 of SEQ ID NO:1, and wherein said portion of the nucleotide sequence of SEQ ID NO:1 has promoter activity," the court stated that the use of "consists" in the body of the claims did not limit the open-ended "comprising" language in the claims (emphases added). Id. at 1257, 73 USPQ2d at 1367. The court held that the claimed promoter sequence designated as SEQ ID NO:1 was obtained by sequencing the same prior art plasmid and was therefore anticipated by the prior art plasmid which necessarily possessed the same DNA sequence as the claimed oligonucleotides. Id. at 1256 and 1259, 73 USPQ2d at 1366 and 1369. The court affirmed the Board’s interpretation that the transition phrase "consists" did not limit the claims to only the recited numbered nucleotide sequences of SEQ ID NO:1 and that "the transition language ‘comprising’ allowed the claims to cover the entire involucrin gene plus other portions of the plasmid, as long as the gene contained the specific portions of SEQ ID NO:1 recited by the claim[s]." Id. at 1256, 73 USPQ2d at 1366.).
MPEP 2111.03
Markush
Applicant’s arguments over the Markush rejections are not persuasive because the MPEP requires that all items on a list share a “single structural similarity” and a common use.
A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use.
Membership in the same recognized physical or chemical class does not apply to Claim 41 because CFTR potentiators, CFTR correctors, translational read-thru agents, and CFTR amplifiers do not share a common use because they are classified as potentiators, correctors, translational read-thru agents, or amplifiers. A potentiator cannot serve as a translational read-thru agent because it potentiates. Membership in the same recognized physical or chemical class does not apply to Claim 42 because antibiotics, bronchodilators, and corticosteroids belong to different physical/chemical classes. Corticosteroids can be endogenous hormones that exist in a mammal but mammals do not produce any antibiotic.
The MPEP also discusses a second case: Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature.
That does not apply to the items in the lists in Claims 41-42 because searching indicates the compounds have different structures and Applicant has not pointed to a single structural similarity shared by the items in each list.
102
Applicant’s arguments (Remarks, pp. 19-20) against the 102 rejections are not persuasive because a claim is anticipated if the reference, within the entirety of the document, teaches the claim limitations. That is the case here because even though App010 teaches full sequences that are 25-mers, the reference also teaches that their invention encompasses synthetic oligont that are 18-mer.
Applicant argues that the 25-mers don’t comprise 17-nt fragments: The Examiner also alleged that the 25-nucletotide App'010 sequences comprise 17-nucleotide fragments of claimed SEQ D Nos: 2-3, 5-6, 8, and 10. Applicants respectfully disagree. But how can that be true when by definition, SEQ ID NOs 2-6, 8, 10, 17, and 41-48 each comprise a 17 nt fragment of their respective sequences (i.e., each SEQ ID NO is itself and is at least 17-mer, so each SEQ inherently comprises a 17-nt fragment of itself). Then, how does a sequence that comprises 100% of SEQ ID NO 5 (i.e., App010’s SEQ ID NO 6) not also comprise a 17-nt fragment of SEQ ID NO 5? Applicant has not explained their logic.
Applicant argues that App010 discloses only 25-mers and that the reference does not actually teach oligont as short as 18-mer. That is not found persuasive because App010 clearly discloses 18-mers. ¶39 and 60 are presented here (emphasis added):
PNG
media_image8.png
370
427
media_image8.png
Greyscale
PNG
media_image9.png
180
429
media_image9.png
Greyscale
¶39 …the present invention provides a synthetic polynucleotide molecule, … wherein said synthetic polynucleotide molecule is capable of binding to a pre-mRNA transcript of the CFTR gene, and suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA. .... In certain embodiments, said nucleotide sequence is complementary to the nucleotide sequence set forth in SEQ ID NO: 3, or to a fragment thereof.
¶60: For example, if the synthetic polynucleotide molecule of the present invention comprises a sequence of 18 consecutive nucleotides, the fragment of the nucleotide sequence in SEQ ID NO: 2 or SEQ ID NO: 3 to which it binds is also 18 nucleotides in length.
Those passages clearly demonstrate that App010 envisioned sequences for suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA that are as short as 18-mer.
Applicant also asserts that (p. 20): App'010 does not teach oligos as short as 18-mers that consist of one of the claimed sequences or even oligos that comprise the specific claimed sequences. The first part of that sentence is not accurate, as shown by the App010 passages excerpted above. App010’s teachings encompass oligos that consist of 18 nt. The second part of that sentence is not accurate because the alignments in the rejection show that the claimed sequences are indeed comprised by App010’s sequences. This shows that claimed SEQ ID NO 5 is comprised by App010 SEQ ID NO 6:
RESULT 6
US-14-667-285A-6
(NOTE: this sequence has 1 duplicate in the database searched.
See complete list at the end of this report)
Sequence 6, US/14667285A
Patent No. 10428328
GENERAL INFORMATION
APPLICANT: Yissum Research Development Company of The Hebrew
APPLICANT: University of Jerusalem Ltd.
APPLICANT: The University of Western Australia
TITLE OF INVENTION: RESTORATION OF THE CFTR FUNCTION BY SPLICING MODULATION
FILE REFERENCE: YISSUM-0106
CURRENT APPLICATION NUMBER: US/14/667,285A
CURRENT FILING DATE: 2015-03-24
PRIOR APPLICATION NUMBER: 61/704859
PRIOR FILING DATE: 2012-09-24
NUMBER OF SEQ ID NOS: 28
SEQ ID NO 6
LENGTH: 25
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Antisense Oligonucleotide
Query Match 100.0%; Score 20; Length 25;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AUCAAGAUGACAAGUCAACU 20 SEQ ID NO 5
||||||||||||||||||||
Db 3 AUCAAGAUGACAAGUCAACU 22 App010 SEQ ID NO 6
Note that since the claims recite both comprises and consists of they are indefinite. See 112(b) rejection.
103
Applicant argues the 103 rejections on pp. 20-22. Applicant argues that, despite the fact that App010 discloses sequences as short as 18-mer at different locations (at least ¶14, 18, 60), an artisan would not have had a reasonable expectation of success in making shorter oligont.
Applicant argues that Harding (not cited in any rejection) teaches shorter ASOs have decreased binding affinity so an artisan wouldn’t have been motivated to try shorter ASOs and would not have had an expectation that results would be consistent with the results obtained using longer ASOs. Applicant discusses that longer ASOs persist longer in the nucleus and longer ASOs more effectively block regions essential to splicing process. Applicant argues that since the claimed ASOs are shorter than those tested in App010, an artisan would not have expected the observed efficacy of the claimed ASOs.
Those arguments are not found persuasive for several reasons.
First, those arguments are not found persuasive because App010 clearly discloses 18-mers. The document is directed to ASOs for exon skipping. It stands to reason that the inventors of App010 would not have suggested shortening their 25-mer ASOs to 18-mers if the shorter version weren’t expected to work.
Second, App010 discloses modified ASOs and teaches (¶7) modifications maintain ASO stabilization, improve target affinity, and provide favorable pharmacokinetic properties and biological stability. There is no reason why an artisan would have expected shortening App010 sequences to be wholly unsuccessful since App010 discloses shorter sequences and teaches modifications to enhance stability. Notably, Harding teaches (§Discussion p. 164 full ¶2) the chemistry of the modified bases and nature of the backbone affect ASO activity.
Third, the claims do not specify any requisite extent of exon skipping, only that some suppression of cryptic exon 22 inclusion occurs.
Fourth, Harding teaches that (§Discussion p. 164 full ¶1) 31-mers were the most effective exon-skippers. Yet, App010 shows (Fig. 8) successful exon skipping with their 25-mers. That shows that Harding’s “25-mer” rule is not determinative and that variation is expected, especially among different genes and different targets.
Furthermore, Harding was published in 2007 and App010 would have been aware of it. Yet, they still disclose an invention that encompasses 18-mers.
Finally, the art of Aartsma-Rus (et al. 2009. Guidelines for Antisense Oligonucleotide Design and Insight Into Splice-modulating Mechanisms. Molec. Ther. 17[3]:548-553, “Aartsma-Rus”) teaches (§Discussion ¶1) they did not find a difference in length between effective and ineffective ASOs. They suggest an “optimal” length of ≈20 nt which an artisan would reasonably interpret to mean 20±20% which would incorporate lengths of 16-24-mers. Furthermore, Aartsma-Rus teaches (same §):
Others and we have found that for some AONs increasing the length can improve their efficiency and the data from Wee et al. support this19,20 (Heemskerk et al., manuscript submitted). However, this rule does not apply to all AONs and for some increasing the length even decreases efficiency19 (Heemskerk et al., manuscript submitted). [emphasis added.]
Aartsma-Rus also teaches (§Introduction ¶2) ASOs are generally 17-25 nt long. That indicates that it was routine and customary to make exon-skipping ASOs with lengths as short as 17-, 18-, 19-, 20-, and 21-mer.
NSDP
Applicant discusses the NSDP rejections on pp. 23-25. Aside from the NSDP rejection over App485 (which Applicant has requested to hold in abeyance) and App286 (now allowed; Applicant says a TD will be filed upon indication of allowable subject matter), all NSDP rejections are made in view of App010 and Turnbull. All of the patented or copending claims recite an additional therapeutic agent and since the claimed invention would have been obvious in view of App010 and Turnbull, those patented or copending claims encompass the claimed invention.
Applicant argues that App010 does not teach or suggest oligont consisting of SEQ ID NOs… or consisting of SEQ ID NOs…. (One of those instances of consisting is interpreted as comprising because it seems like a typo and because Claim 32(a) recites comprises.)
Those arguments are not found persuasive because App010 clearly teaches ASOs that comprise as few as 18 nt:
¶39 …the present invention provides a synthetic polynucleotide molecule, … wherein said synthetic polynucleotide molecule is capable of binding to a pre-mRNA transcript of the CFTR gene, and suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA. .... In certain embodiments, said nucleotide sequence is complementary to the nucleotide sequence set forth in SEQ ID NO: 3, or to a fragment thereof.
¶60: For example, if the synthetic polynucleotide molecule of the present invention comprises a sequence of 18 consecutive nucleotides, the fragment of the nucleotide sequence in SEQ ID NO: 2 or SEQ ID NO: 3 to which it binds is also 18 nucleotides in length.
Those passages clearly demonstrate that App010 envisioned sequences for suppressing intron 22 cryptic exon inclusion in the mature CFTR mRNA that are as short as 18-mer. Therefore all the NSDP rejections are maintained.
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to RUTHIE S ARIETI whose telephone number is (571)272-1293. The examiner can normally be reached M-Th 8:30AM-4PM, alternate Fridays 8:30AM-4PM (ET).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached on (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
RUTHIE S ARIETI
Examiner (Ruth.Arieti@uspto.gov)
Art Unit 1635
/RUTH SOPHIA ARIETI/Examiner, Art Unit 1635
/NANCY J LEITH/Primary Examiner, Art Unit 1636
Prosecution Insights