DETAILED ACTION
Receipt of Arguments/Remarks filed on September 26 2025 is acknowledged. Claims 2, 13 and 15-16 were/stand cancelled. Claims 1, 3 and 8 were amended. Claims 1, 3-12, 14 and 17-20 are pending. Claims 9-11 and 19-20 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made with traverse in the reply filed on May 17 2025. Claims 1, 3-8, 12, 14 and 17-18 are directed to the elected invention.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Withdrawn Rejections
The amendments filed September 26 2025 are sufficient to overcome the rejection of claim 3 under 35 USC 112(b). The amendments clarify the scope of the claim.
The amendments filed September 26 2025 are sufficient to overcome the rejection of claim 1-8 and 17-18 under 35 USC 102(a)(1) over Barthelemy et al. The amendments exclude SEQ ID NO: 2 from the claims. Since the claims previously positively recited this sequence, the amendment is fully supported to exclude this sequence.
Modified Rejection Based Amendments on in the reply filed on September 26 2025
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3-8, 12, 14 and 17-18 are rejected under 35 U.S.C. 103 as being unpatentable over Readman et al. (Frontiers in Microbiology, 2016, cited on PTO Form 1449) in view of Barthelemy et al. (USPGPUB NO. 20160108398, cited in the Office action mailed on July 2 2025).
Applicant Claims
The instant application claims antisense oligonucleotide modified by substitution at the 5' or the 3' end by a lipid moiety, wherein said antisense oligonucleotide specifically targets an mRNA encoding a CTX-M extended spectrum β-lactamase. Specifically taught sequence is SEQ ID No. 1: GCGCAGTGATTTTTTAACCATGGGA.
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
Readman et al. is directed to translation inhibition of CTX-M extended spectrum β-lactamase in clinical strains of E. coli by synthetic antisense oligonucleotides partially restores sensitivity to cefotaxime. As a consequence of the well documented and ever increasing prevalence of antibiotic resistant bacteria, new methods of combating resistant strains which are pathogenic are urgently required for both animal and human health. Particularly widespread in most countries in the northern hemisphere are the strains of Escherichia coli carrying group 1 blaCTX-M, conferring resistance to third generation cephalosporin antibiotics (page 1, introduction). It is taught that a variety of synthetic anti-sense/anti-gene agents including phosphorodiamidate morpholino oligonucleotides have proven successful in inhibiting the expression of a diverse range of targeted bacterial genes (page 2, left column, first complete paragraph). Restoration of antibiotic sensitivity through translational inhibition of β-lactamase activity potentially might represent a viable therapeutic solution with the flexibility to quickly develop new inhibitory agents targeted to specific genes and perhaps restore the efficacy of certain now obsolete antibiotics. This is a potential alternative strategy at the translational molecular level for the treatment of CTX resistant bacteria. Resistance would be unlikely to evolve quickly in the highly conserved targeted ribosomal binding/translational start region (page 2, left column last complete paragraph). Unmodified synthetic antisense oligonucleotides are known to be unable to efficiently penetrate the bacterial cell wall. At around 2–3 kDa a 10-mer oligonucleotide is too large to enter a bacterial cell by porin-mediated passive transport and therefore a delivery strategy to overcome this barrier is required (page 2 paragraph bridging left and right column). Taught is the formation of a 25 base oligonucleotide designed to target by complementary base pairing of blaCTX-M (Figure 1A). It is taught that the oligonucleotide inhibited β-lactamase in a dose dependent manner (page 5, left column, last paragraph). Increased sensitivity to CTX (cefotaxime) was shown in a dose dependent manner (page 5, right column).
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Readman et al. teaches a 25 base oligonucleotide which was designed to target by complementary base paring of blaCTX-M, Readman et al. does not teach an oligonucleotide of SEQ ID No. 1. While Readman et al. teaches that oligonucleotides at around 2–3 kDa a 10-mer oligonucleotide is too large to enter a bacterial cell, Readman et al. does not expressly teach a lipid to increase entry. However, this deficiency is cured by Barthelemy et al.
Barthelemy et al. is directed to hydrophobically modified antisense oligonucleotides comprising a ketal group. Taught that there is currently substantial interest in the use of nucleic acids for modifying gene expression for therapeutic purposes. The use of oligonucleotide (ON) analogues as potential therapeutic agents for modulating the expression of specific genes has shown promise for different classes of molecules, including aptamers, triplex-forming oligonucleotides, antisense oligonucleotides (ASO) and small interfering RNAs (siRNAs). However, one major barrier in the broad utilization of ON analogues as clinical drugs is their reduced ability to transverse cell membranes (paragraph 0002). Cellular uptake and localization of ONs are crucial problems for their effects on the genetic expressions. Most approaches for their cellular delivery involve cationic lipophilic carriers and/or polymers. While such synthetic carriers can be exceptionally effective for delivering plasmid DNA into the cytoplasm of cells, most are of limited utility because of their toxicity to cells and poor efficiency in the case of ONs. Alternatively, a lipophilic moiety has been covalently tethered to the ON structures with the aim of improving cellular uptake and antisense activity. Lipid conjugated ONs (LONs) feature an oligonucleotide sequence as the polar head and at least one lipid moiety inserted either at the 3′- or 5′-end of the oligonucleotide or within the sequence. Interestingly, LONs self-assemble to give aggregates such as micelles and vesicles. The appended lipidic segment of LONs brings about new properties to these surfactants like enhanced antisense activities, tagging of vesicles or lipid bilayers, and biological membrane (paragraph 0003). Taught are antisense oligonucleotides with high cellular uptake, prolonged half-life on plasma and a high efficiency of gene silencing in vivo (paragraph 0005). Claimed is an oligonucleotide modified by substitution at the 3′ or the 5′ end by a moiety comprising at least one ketal functional group, wherein the ketal carbon of said ketal functional group bears two saturated or unsaturated, linear or branched, hydrocarbon chains comprising from 1 to 22 carbon atoms (claim 1). modified oligonucleotide according to claim 1, of the general formula (I):
PNG
media_image1.png
360
654
media_image1.png
Greyscale
wherein:
Oligo represents an oligonucleotide sequence which may be oriented 3′-5′ or 5′-3′, simple and/or double stranded, ADN, ARN, and/or comprise modified nucleotides;
X represents a divalent linker moiety selected from ether —O—, thio —S—, amino —NH—, and methylene —CH2—; R1 and R2 may be identical or different and represent:
(i) a hydrogen atom, (ii) a halogen atom, in particular fluorine atom, (iii) a hydroxyl group, (iv) an alkyl group comprising from 1 to 12 carbon atoms; L1 and L2 may be identical or different and represent a saturated or unsaturated, linear or branched hydrocarbon chain comprising from 1 to 22 carbon atoms, B is an optionally substituted nucleobase, selected from the group consisting of purine nucleobases, pyrimidine nucleobases, and non-natural monocyclic or bicyclic heterocyclic nucleobases wherein each cycle comprises from 4 to 7 atoms (claim 2).
Aqueous composition are taught. These compositions can also comprise a hydrophobic active (paragraph 0015, 0100, 0104).
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Readman et al. and Barthelemy et al. and utilize an antisense oligonucleotide to target blaCTX-M. One skilled in the art would have been motivated to design oligonucleotides which target blaCTX-M in order to restore antibiotic sensitivity through translational inhibition of β-lactamase activity as taught by Readman et al.
Readman et al. teaches in Figure 1A alignment of blaCTX-M-15 mRNA wherein the sequence of the blaCTX-M-15 mRNA corresponds to:
5’ cuuccagaauaaggaaucccaugguuaaaaaaucacugcgcc 3’.
Instantly claimed SEQ ID No. 1 (QY) is 100% complementary to the mRNA (Db):
PNG
media_image2.png
138
622
media_image2.png
Greyscale
Therefore, one skilled in the art would have been motivated to form an oligonucleotide of instant SEQ ID NO. 1 as it is 100% complementary to blaCTX-M-15 mRNA.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Readman et al. and Barthelemy et al. and utilize the lipid of Barthelemy et al. to modify the oligonucleotide which targets blaCTX-M. Readman et al. teaches that oligonucleotides above 10 nucleotides long can is too large to enter a bacterial cell by porin-mediated passive transport and therefore a delivery strategy to overcome this barrier is required. Barthelemy et al. teaches that the lipids of their invention allow for antisense oligonucleotides with high cellular uptake, prolonged half-life on plasma and a high efficiency of gene silencing in vivo. Since Barthelemy et al. teaches conjugation to oligonucleotides there is a reasonable expectation of success.
Regarding claims 3-4 and 17-18, Barthelemy et al. teach the same structure as instantly claimed formula (I).
Regarding claim 5, Readman et al. reaches a phosphorothioate oligonucleotide. Therefore, it would have been obvious to form an oligonucleotide which targets blaCTX-M-15 mRNA and also is a phosphorothioate.
Regarding claims 12 and 14, Readman et al. teach the combination of the oligonucleotide and cefotaxime. The instant specification teaches that 3rd generation cephalosporin include cefotaxime (page 3). Therefore, the prior art suggests the combination of the oligonucleotide and a 3rd generation cephalosporin. It would have been obvious to one of ordinary skill in the art to utilize a kit for the antisense oligonucleotide and cefotaxime One of ordinary skill in the art would have been motivated to utilize a kit in order to package and ship the formulation as well as to provide instructions for a consumer/provider on how to utilize the product. “Where the printed matter is not functionally related to the substrate, the printed matter will not distinguish the invention from the prior art in terms of patentability.” In re Ngai, 367 F.3d 1336, 70 USPQ2d 1862 (Fed. Cir. 2004). See MPEP 2112.01.
Response to Arguments
Applicants’ arguments filed September 26 2025 have been fully considered but they are not persuasive.
Applicants argue (page 7) that (1) Readman teaches cell penetrating peptides and not a lipid moiety containing a ketal group. Coupling ASOs to CPPs allowed Readman to deliver the ASOs inside various pathogenic bacterial cells (see table 1 and Figures 4 and 5 in Readman). Therefore, Readman proposes to permit the delivery of ASOs inside prokaryotic cells. The problem solved by the present invention was to provide an alternative means to efficiently deliver oligonucleotides inside prokaryotic cells. The solution developed by the present inventors was to couple ASOs to a lipid moiety containing a ketal group. The examples of the application showed that the tested LASOs containing such lipid moiety are active against two different E.Coli strains. When contacted with these LASOs, these bacterial strains show great sensitivity toward ceftriaxone antibiotic. Therefore, the present inventors have shown for the first time that lipid modified ASOs can be efficiently delivered into prokaryotic cells. This result was surprising.
Regarding Applicants first argument, while Readman does not teach the instantly claimed lipid moiety, Readman is not the only reference utilized. While cell penetrating peptides (CPP) are taught in Readman, Readman still teaches that the ASOs can enter the bacterial cell. Therefore, it appears that the instant application utilizes a different method of achieving the same effect, specifically entry into prokaryotic cells. While Applicants contend the instantly claimed result is surprising the examiner cannot agree. Barthelemy et al. teaches that cellular uptake and localization of oligonucleotides are crucial problems. Most approaches for their cellular delivery involve cationic lipophilic carriers and/or polymers. However, the lipophilic moiety taught in Barthelemy et al. is an alternative which aims at improving cellular uptake and antisense activity. Therefore, Barthelemy et al. suggest that using their lipophilic moiety with the ASOs of Readman et al. would be expected to improve cellular uptake. Allain et al. (Nucleic Acids Res. 2001) teaches that hybrid molecules composed of a lipid covalently linked to a nucleotide have been identified in both eukaryotic and prokaryotic cells (introduction). Therefore, it isn’t surprising that the use of the lipophilic moiety of Barthelemy et al. would improve cellular uptake and that this cellular uptake would include prokaryotic cells since nucleotides covalently linked to lipids have been identified in both eukaryotic and prokaryotic cells.
Applicants argue (page 8, first paragraph) that (2) the target enzyme, beta-lactamase, is only expressed by bacterial cells. Barthelemy only proposed tools favoring oligonucleotide delivery into eukaryotic cells. Therefore, there would be no motivation to utilize the delivery system disclosed in Barthelemy for delivery of ASOs across bacterial cell walls.
Regarding Applicants’ second argument, while Barthelemy does teach delivery to cancer cells, nowhere in Barthelemy is it taught that the oligonucleotides cannot be delivered to bacterial cells. Barthelemy is actually silent to delivery to either eukaryotic or prokaryotic cells. It is well settled that "any need or problem known in the field of endeavor at the time of invention and addressed by the patent can provide a reason for combining the elements in the manner claimed." KSR Int 'l Co. v. Teleflex Inc., 550 U.S. 398, 420 (2007). As long as some suggestion to combine the elements is provided by the prior art as a whole, the law does not require that they be combined for the reason or advantage contemplated by the inventor. In re Beattie, 974 F.2d 1309, 1312 (Fed. Cir. 1992); In re Kronig, 539 F.2d 1300, 1304 (CCPA 1976). MPEP 2143.01 and 2144 (IV).
The reason or motivation to modify the reference may often suggest what the inventor has done, but for a different purpose or to solve a different problem. It is not necessary that the prior art suggest the combination to achieve the same advantage or result discovered by applicant. See, e.g., In re Kahn, 441 F.3d 977, 987, 78 USPQ2d 1329, 1336 (Fed. Cir. 2006) (motivation question arises in the context of the general problem confronting the inventor rather than the specific problem solved by the invention); Cross Med. Prods., Inc. v. Medtronic Sofamor Danek, Inc., 424 F.3d 1293, 1323, 76 USPQ2d 1662, 1685 (Fed. Cir. 2005) ("One of ordinary skill in the art need not see the identical problem addressed in a prior art reference to be motivated to apply its teachings."); In re Lintner, 458 F.2d 1013, 173 USPQ 560 (CCPA 1972) (discussed below); In re Dillon, 919 F.2d 688, 16 USPQ2d 1897 (Fed. Cir. 1990), cert. denied, 500 U.S. 904 (1991)
In In re Lintner, the claimed invention was a laundry composition consisting essentially of a dispersant, cationic fabric softener, sugar, sequestering phosphate, and brightener in specified proportions. The claims were rejected over the combination of a primary reference which taught all the claim limitations except for the presence of sugar, and secondary references which taught the addition of sugar as a filler or weighting agent in compositions containing cationic fabric softeners. Appellant argued that in the claimed invention, the sugar is responsible for the compatibility of the cationic softener with the other detergent components. The court sustained the rejection, stating "The fact that appellant uses sugar for a different purpose does not alter the conclusion that its use in a prior art composition would be [sic, would have been] prima facie obvious from the purpose disclosed in the references." 173 USPQ at 562.
Therefore, it is not necessary that the prior art expressly teach delivery to prokaryotic cells. The instant claims are directed to antisense oligonucleotides modified by a lipid moiety. If the claimed antisense oligonucleotides is obvious in light of the prior art for a different reason that the reason applicants have combined the lipid moiety and the antisense oligonucleotide, this does not make the claimed oligonucleotide any less obvious. As set forth above, Barthelemy clearly teaches that the lipid moiety can improve cellular uptake and antisense activity. Thus, its use with the antisense oligonucleotides would have been obvious. Furthermore, substitution of CPPs with lipid moieties would be substitution of one known way of increasing cell penetration with another known way of penetrating cells which in light of KSR would be obvious. Note: MPEP 2143.
Applicants argue (page 8-9) that (3) the main difference between a eukaryotic cell and a prokaryotic cell lies in the composition of the cytoplasmic membrane. Oligonucleotides are large, highly charged molecules, so diffusion across membranes is already difficult in itself and even more so when two membranes must be crossed. That is why in research articles on oligonucleotides crossing bacterial cells walls is often presented as a major challenge. Applicants direct the examiners attention to Santos et al. 2017, Santos et al. 2018, and Sully & Geller 2016. It is argued one skilled in the art would have coupled the inhibitor oligonucleotide to a CPP and not used a ketal as in the present invention.
Regarding Applicants third argument, while Applicants are correct that there are other known systems which could be used to deliver ASOs, that does not mean that the lipophilic moiety taught in Barthelemy is any less obvious. Barthelemy clearly teaches a lipid moiety which is known to enhance cellular transport. While the cited art discusses the difficulty in delivering to bacterial cells (Santos 2017) and negatively charged LPS affect crossing OM (Santos 2018). The examiner cannot agree that this would not be overcome with Barthelemy. Firstly, the lipids are not cationic. Secondly, as taught by Barthelemy the LONs self-assemble to give aggregates such as micelles and vesicles which would meet the required carrier that Santos 2018 states is required. Again, while CPP may be expected to achieve penetration across the bacterial cell membrane, this does not mean that the state of the art does not suggest that there are other methods for achieving the same effect. As taught by Raouana (Bioconjugate Chemistry, 2012), neutral lipids would be expected to avoid the toxicological issue inherent to polycations (conclusion).
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3-8, 12, 14 and 17-18 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-3, 5-8 and 14-15 of U.S. Patent No. 9701962 in view of Readman et al. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant application claims antisense oligonucleotide modified by substitution at the 5' or the 3' end by a lipid moiety, wherein said antisense oligonucleotide specifically targets an mRNA encoding a CTX-M extended spectrum p-lactamase. Specifically taught sequence is SEQ ID No. 1: GCGCAGTGATTTTTTAACCATGGGA.
Patent ‘962 claims a medicament comprising as an active agent, an oligonucleotide modified by substitution at the 3′ or the 5′ end by a moiety comprising at least one ketal functional group, wherein a ketal carbon of the at least one ketal functional group bears two saturated or unsaturated, linear or branched, hydrocarbon chains comprising from 1 to 22 carbon atoms, wherein said oligonucleotide is an antisense oligonucleotide or an interfering RNA which targets an mRNA of interest and is capable of reducing the amount of protein encoded by said mRNA (claim 1). The same formula I is claimed (claim 2). An aqueous composition comprising the oligonucleotides is claimed (claim 14).
While Patent ‘962 claims an oligonucleotide which is an antisense oligonucleotide or an interfering RNA which targets an mRNA of interest and is capable of reducing the amount of protein encoded by said mRNA, Patent ‘962 does not claim a sequence of instantly claimed SEQ ID No. 1. However, this deficiency is cured by Readman et al.
Readman et al. is directed to translation inhibition of CTX-M extended spectrum β-lactamase in clinical strains of E. coli by synthetic antisense oligonucleotides partially restores sensitivity to cefotaxime. As a consequence of the well documented and ever increasing prevalence of antibiotic resistant bacteria, new methods of combating resistant strains which are pathogenic are urgently required for both animal and human health. Particularly widespread in most countries in the northern hemisphere are the strains of Escherichia coli carrying group 1 blaCTX-M, conferring resistance to third generation cephalosporin antibiotics (page 1, introduction). It is taught that a variety of synthetic anti-sense/anti-gene agents including phosphorodiamidate morpholino oligonucleotides have proven successful in inhibiting the expression of a diverse range of targeted bacterial genes (page 2, left column, first complete paragraph). Restoration of antibiotic sensitivity through translational inhibition of β-lactamase activity potentially might represent a viable therapeutic solution with the flexibility to quickly develop new inhibitory agents targeted to specific genes and perhaps restore the efficacy of certain now obsolete antibiotics. This is a potential alternative strategy at the translational molecular level for the treatment of CTX resistant bacteria. Resistance would be unlikely to evolve quickly in the highly conserved targeted ribosomal binding/translational start region (page 2, left column last complete paragraph). Unmodified synthetic antisense oligonucleotides are known to be unable to efficiently penetrate the bacterial cell wall. At around 2–3 kDa a 10-mer oligonucleotide is too large to enter a bacterial cell by porin-mediated passive transport and therefore a delivery strategy to overcome this barrier is required (page 2 paragraph bridging left and right column). Taught is the formation of a 25 base oligonucleotide designed to target by complementary base pairing of blaCTX-M (Figure 1A). It is taught that the oligonucleotide inhibited β-lactamase in a dose dependent manner (page 5, left column, last paragraph). Increased sensitivity to CTX (cefotaxime) was shown in a dose dependent manner (page 5, right column).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘962 and Readman et al. and utilize an antisense oligonucleotide to target blaCTX-M. One skilled in the art would have been motivated to design oligonucleotides which target blaCTX-M in order to restore antibiotic sensitivity through translational inhibition of β-lactamase activity as taught by Readman et al.
Readman et al. teaches in Figure 1A alignment of blaCTX-M-15 mRNA wherein the sequence of the blaCTX-M-15 mRNA corresponds to:
5’ cuuccagaauaaggaaucccaugguuaaaaaaucacugcgcc 3’.
Instantly claimed SEQ ID No. 1 (QY) is 100% complementary to the mRNA (Db):
PNG
media_image2.png
138
622
media_image2.png
Greyscale
Therefore, one skilled in the art would have been motivated to form an oligonucleotide of instant SEQ ID NO. 1 as is 100% complementary to blaCTX-M-15 mRNA.
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Patent ‘962 and Readman et al. and utilize an antisense oligonucleotide to target blaCTX-M as the oligonucleotide which targets an mRNA of interest. Since Readman et al. teaches the reason to target blaCTX-M there is a reasonable expectation of success.
Regarding claims 2-4 and 17-18, Patent ‘962 claims the same structure as instantly claimed formula (I).
Regarding claim 5, Readman et al. reaches a phosphorothioate oligonucleotide. Therefore, it would have been obvious to form an oligonucleotide which targets blaCTX-M-15 mRNA and also is a phosphorothioate.
Regarding claims 12 and 14, Readman et al. teach the combination of the oligonucleotide and cefotaxime. The instant specification teaches that 3rd generation cephalosporin include cefotaxime (page 3). Therefore, the prior art suggests the combination of the oligonucleotide and a 3rd generation cephalosporin. It would have been obvious to one of ordinary skill in the art to utilize a kit for the antisense oligonucleotide and cefotaxime One of ordinary skill in the art would have been motivated to utilize a kit in order to package and ship the formulation as well as to provide instructions for a consumer/provider on how to utilize the product. “Where the printed matter is not functionally related to the substrate, the printed matter will not distinguish the invention from the prior art in terms of patentability.” In re Ngai, 367 F.3d 1336, 70 USPQ2d 1862 (Fed. Cir. 2004). See MPEP 2112.01.
Response to Arguments
Applicants’ arguments filed September 26 2025 have been fully considered but they are not persuasive.
Applicants argue that Readman does not anticipate or make the claimed invention obvious. The rejection should be overcome for at least the same reasons.
Regarding Applicants’ arguments, firstly, the arguments do not establish why Readman does not make the claimed invention obvious. Since Applicants arguments with regards to the 103 are not persuasive for the reasons set forth above, the rejection on the grounds of non-statutory double patenting is maintained.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ABIGAIL VANHORN/ Primary Examiner, Art Unit 1636