MEDIATORS OF GENE SILENCING

Application No. 17/609,691

• Filed: Nov 08, 2021
• Priority: May 24, 2019 — GB 1907380.8
  • May 22, 2020 — nonprovisional of PCTGB2020051257
• Examiner: SULLIVAN, STEPHANIE LAUREN
• Art Unit: 1635
• Tech Center: 1600 — Biotechnology & Organic Chemistry
• Assignee: Cancer Research Technology Limited
• OA Round: 4 (Final)

Office Action

DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .

Response to Amendment/Status of Claims

Receipt of Arguments/Remarks filed on 07/10/2026 is acknowledged. Claims 3,7,20,51 and 52 were/stand cancelled. Claims 15 and 28 were amended. Claims 56 and 57 are new. Claims 1-3,5-6,8-10,12,15,23,28,38-39,41,47-50 and 53-57 are pending. Claims 1-3,5-6,8-10,12,23,38-39 and 41 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 12/05/2024. Claims 15,28,47-50 and 53-57 are under examination.

Rejections Necessitated by Amendment
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.

The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.

Claims 15,28,47-50 and 53-57 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 15 and 28 recite the limitation "wherein the breast or lung cancer gene is…” in lines 13 and 11, respectively. There is insufficient antecedent basis for this limitation in the claim, as there is no prior recitation of a breast or lung cancer gene, only a cancer associated target gene.
Claims 47-50 and 53-57 are included in the rejection because claims 47 and 57 depend from claim 15, and claims 48-50 and 53-56 depend from claim 28 and do not correct the issue.

Claim Rejections-Written Description

The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.

The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 15,28,47-50 and 53-57 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
Claims 15 and 47 encompass an in vivo method of inhibiting the expression of a cancer associated gene or a cancer associated long non-coding RNA in mammalian breast or lung cancer cells wherein the cancer is breast or lung cancer and the breast or lung cancer gene is selected from BCL2, PTEN, EGFR, HLA-DRB1, IGF1, MTHFR, ERBB2, ACE, ABCB1, CCND1, MYC, EGF, FAS, MTOR, FN1, MDM2, SMAD4, MET, IGF1R, CDKN1A, TGFBR2, MLH1, MGMT, JAG1, CASP8, TCF4, COL11A2, AHR, SMAD3, CLU, HSPG2, EGR1, ISG20, MYD88, IL15, HMGA2, GLI3, BMP2, ARID1A, COL4A1, GATA3, SKI, EPCAM, KITLG, CDK6, TRPS1, BRD2, SETBP1, SLC22A3, SMAD2, DNMT3A, SDC1, PDE4D, FLT3, GATA6, TNFRSF11A, AKT2, HDAC9, STAT4, TFPI, SCN9A, KRT19, RBMS3, MLXIPL, HLA-DQA1, ENPP1, VCAN, GRIP1, KIF1B, NKX2-1, EGRF or SPINT1 and wherein the cancer associated long-noncoding RNA is LINC00665, by introducing a large genera of tRNA-derived polynucleotides comprising a sequence that is at least 90% or at least 95% complementary to any intronic region of the cancer associated target genes or cancer associated long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides (tsRNA) and the tRNA comprises a stem-loop/hairpin structure. Claim 57 limits the breast or lung cancer gene to BCL2, EGRF, MET or SPINT1. It is noted that claim 15 does not recite any specific structural requirements for the tRNA derived polynucleotide fragment (tsRNA) that is common to species of the claimed genus. All the wherein clauses either recite a general structure of the tRNA (hairpin/stem-loop, recognized by Dicer and processed into tsRNA in the nucleus) or a function of tsRNA (guides Ago2 to target RNA for degradation.
Claims 28,48-50 and 53-56 encompass a method of treating cancer which is breast or lung cancer, comprising administering by a genus of administration routes, an effective amount of a pharmaceutical composition comprising a large genus of tRNA-derived polynucleotides comprising a sequence that is at least 90% or at least 95% complementary to an intronic region of a genus of cancer associated target genes or intronic region of a genus of cancer associated long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides (tsRNA) and wherein the tRNA comprises a stem-loop/hairpin structure, to a mammalian subject in need thereof and wherein the breast or lung cancer gene is selected from BCL2, PTEN, EGFR, HLA-DRB1, IGF1, MTHFR, ERBB2, ACE, ABCB1, CCND1, MYC, EGF, FAS, MTOR, FN1, MDM2, SMAD4, MET, IGF1R, CDKN1A, TGFBR2, MLH1, MGMT, JAG1, CASP8, TCF4, COL11A2, AHR, SMAD3, CLU, HSPG2, EGR1, ISG20, MYD88, IL15, HMGA2, GLI3, BMP2, ARID1A, COL4A1, GATA3, SKI, EPCAM, KITLG, CDK6, TRPS1, BRD2, SETBP1, SLC22A3, SMAD2, DNMT3A, SDC1, PDE4D, FLT3, GATA6, TNFRSF11A, AKT2, HDAC9, STAT4, TFPI, SCN9A, KRT19, RBMS3, MLXIPL, HLA-DQA1, ENPP1, VCAN, GRIP1, KIF1B, NKX2-1, EGRF or SPINT1 and wherein the cancer associated long-noncoding RNA is LINC00665. It is noted that claim 28 does not recite any specific structural requirements for the tRNA derived polynucleotide fragment (tsRNA) that is common to species of the claimed genus. All the wherein clauses either recite a general structure of the tRNA (hairpin/stem-loop, recognized by Dicer and processed into tsRNA in the nucleus) or a function of tsRNA (guides Ago2 to target RNA for degradation.
Regarding the state of the art of tRNA-derived polynucleotides, Li et al. (Genes, Review, 9, 246, Published 10 May 2018) teach that high-throughput sequencing has unveiled various tsRNAs in bacteria, fungi, plants and mammals, and that various types of tsRNA can be generated from diverse tRNA sources (Section 2, page 2). Li et al. teach tRFs are evolutionarily ancient and present in both prokaryotes and eukaryotes, and that some tsRNAs preferentially associate with Ago1, Ago3, and Ago4 proteins but not Ago2 in a cell type specific manner, which indicates that tRFs have other functions than direct binding with the target genes as miRNAs (Section 3.1, page 4).
Maute et al. (PNAS Vol. 110, No. 4, Published 22 January 2013, pages 1404-1409) teach a class of abundantly expressed small RNAs whose sequences matched either to mature or precursor tRNA transcripts and that other groups have reported similar small RNA species expressed in a variety of human cell types and other organisms, yet the role of how these small RNAs act has not been determined (page 1404). Maute et al. teach three categories of tRNA fragments, tRF-5, tRF-3 and tRF-1, and that tRF-3s are the most abundant expressed in mature B cells (page 1404). Maute et al. teach a tRF-3 designated CU1276 which is a 22-nt small RNA differentially expressed in three stages of mature B-cell differentiation and one GC-derived lymphoma cell line (page 1404). Maute et al. teach that the tRNA-derived CU1276 can repress mRNA targets in an Argonaute-dependent, miRNA-like fashion (page 1405), and therefore the data presented demonstrates that a tRNA fragment can post-transcriptionally regulate endogenous genes in a sequence-specific, miRNA-like fashion (page 1408).
There is a lack of teaching in the state of the art in regards to tRNA-derived polynucleotides from tRNA comprising a stem-loop/hairpin structure and their use for inhibiting gene expression of breast or lung cancer associated genes long non-coding RNA and treating breast or lung cancer therewith.
Regarding the state of the art of the genus of cancer associated genes or cancer associated long non-coding RNA and treating a genus of cancers, Kryzyszczyk et al. (Technology, 2018; 6(3-4): 79-100, pages 1-27) teach cancer is a complex and heterogeneous condition, and there are over 100 types of cancers, located in different organs and sub-tissues and originating from different cell types, and some cancer types such as colon, breast and non-Hodgkin’s lymphoma contain even more specific classifications based on their molecular subtypes (Intro, page 2). Kryzyszczyk et al. teach expression of markers within the same tumor can change depending on the location or stage of cancer (Intro, page 2).
Therefore, the state of the art shows the large genus of tsRNAs, and that the tRNA fragments can repress mRNA targets and can post-transcriptionally regulate endogenous genes in a sequence-specific fashion, as well as the complexity and heterogeneity of different cancers and molecular subtypes even within the same cancer.
The specification discloses tsRNAs having the sequence comprising SEQ ID NOs: 4,5 or 6 (pages 10,38 and 39). Example 2, pages 37-38 discloses transfecting tsRNAs in cells, and Figures 13A,B shows levels of EGFR mRNA were reduced upon transfection of tsRNA EGFR. Example 3, page 38 discloses transfecting tsRNAs into cells, and that MET mRNA levels were reduced upon transfection with tsRNA MET (Figures 13A, B). However, these examples do not disclose the structure of the tsRNA necessary for performing this function. Example 4, page 38, discloses transfecting BT549 cells with tsRNA EGFR/MET, and that the tsRNA is single stranded and has SEQ ID NO: 4, and Figure 15 shows the number of dead cells increased with increasing amount of tsRNA EGFR/MET, and Figure 16 shows the number of live cells decreased with increasing amount of tsRNA EGFR/MET. Example 5, page 39 discloses transfecting MCF7 (breast cancer cell line) cells with tsRNAs of SEQ ID NO: 5 to target BCL2 which led to downregulation of steady state BCL2 mRNA levels (Figure 18), and that BCL-2 levels decreased with increasing amount of tsRNA (Figure 19). Example 6, pages 39-40 discloses transfecting BT549 cells with tsRNA LINC00665 of SEQ ID NO: 6, and that LINC0665 levels were reduced (Figure 22, 23A,B), and fewer live cells (Figure 25). Therefore, the specification has provided the sequence structure of 3 tsRNAs (SEQ ID NOs: 4-6), and has not provided any guidance about the core structure of the tsRNA that would be common to the tsRNAs that target the genes recited in claims 15 and 28.
Figure 9d shows a pie chart showing that there is a different structure requirement for tsRNA that targets exclusively in exon vs exclusively in intron vs target in both. No guidance is given regarding the structure of the tsRNA that targets only an exon vs only an intron.
Claims 15,28,47-50 and 53-57 are directed to encompass the recited method of using tsRNAs which only correspond in some undefined way to specifically instantly disclosed tsRNAs of SEQ ID NOs: 4,5 and 6 and their respective specific cancer associated genes EGFR/MET, BCL2 and LINC00665. The specification lacks chemical structural information for what they are and chemical structures are highly variant and encompass thousands of possible tsRNAs for the recited breast or lung cancer genes or lncRNA.. The specification provides insufficient written description to support the genus encompassed by the claim.
The recitation of the specific breast or lung cancer genes in the amended claims that the tsRNA is complementary to without reciting more specific structure of the tsRNA itself is likened to Amgen Inc. v. Sanofi. See MPEP 2163 (II)(A)(3)(a)(ii), “However, the claimed invention itself must be adequately described in the written disclosure and/or the drawings. For example, disclosure of an antigen fully characterized by its structure, formula, chemical name, physical properties, or deposit in a public depository does not, without more, provide an adequate written description of an antibody claimed by its binding affinity to that antigen, even when preparation of such an antibody is routine and conventional. See Amgen Inc. v. Sanofi, 872 F.3d 1367, 1378, 124 USPQ2d 1354, 1361 (Fed. Cir. 2017)("knowledge of the chemical structure of an antigen [does not give] the required kind of structure-identifying information about the corresponding antibodies"); see also Centocor Ortho Biotech, Inc. v. Abbott Labs., 636 F.3d 1341, 1351-52, 97 USPQ2d 1870, 1877 (Fed. Cir. 2011)(patent disclosed the antigen the claimed antibody was supposed to bind, but did not disclose any antibodies with the specific claimed properties). It is noted that the stem-loop/hairpin structure is a structure of the tRNA, not the tsRNA, and therefore does not distinguish the tsRNA. While the specification discusses how tRNA can be processed to form the fragment by Dicer, the specification does not discuss the required structure of the tsRNA.
Vas-Cath Inc. v. Mahurkar, 19 USPQ2d 1111, (Fed. Cir. 1991), makes clear that "applicant must convey with reasonable clarity to those skilled in the art that, as of the
filing date sought, he or she was in possession of the invention. The invention is, for purposes of the 'written description' inquiry, whatever is now claimed." (See page 1117.) The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed." (See Vas-Cath at page 1116.)
With the exception of the tsRNAs having the sequence comprising SEQ ID NOs:

4,5 or 6 wherein SEQ ID NO: 4 corresponds to the target gene EGFR/MET in a breast cancer cell line, SEQ ID NO: 5 corresponds to the target gene BCL2 in a breast cancer cell line and lung cancer cell line, and SEQ ID NO: 6 which corresponds to the target LINC0665 in breast cancer cell lines and lung cancer cell lines, and which reduce gene expression thereof, the skilled artisan cannot envision the detailed chemical structure of the encompassed tsRNAs with the recited functions, as there is no structure-function correlation.
University of California v. Eli Lilly and Co., 43 USPQ2d 1398, 1404, 1405 (Fed.

Cir. 1997) held that:

...To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that "the inventor invented the claimed invention." Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gosteli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) (" [T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed."). Thus, an applicant complies with the written description requirement "by describing the invention, with all its claimed limitations, not that which makes it obvious," and by using "such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention." Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966.

Furthermore, to the extent that a functional description can meet the requirement for an adequate written description, it can do so only in accordance with PTO guidelines stating that the requirement can be met by disclosing “sufficiently detailed, relevant identifying characteristics,” including “functional characteristics when coupled with a known or disclosed correlation between function and structure.” Univ. of Rochester v. G.D. Searle, 68 USPQ2d 1424, 1432 (DC WNY 2003).
Therefore, only the above chemically structurally defined tsRNAs of SEQ ID NOs: 4,5 and 6 and their respective target genes in the cancer cell lines as stated above, but not the full breadth of the claim(s) meet the written description provision of 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph. The species specifically disclosed are not representative of the genus because the genus is highly variant. Applicant is reminded that Vas-Cath makes clear that the written description provision of 35 USC § 112 is severable from its enablement provision. (See page 1115.)

Response to Arguments
Applicant's arguments filed 07/10/2026 have been fully considered but they are not persuasive.
Applicant cites MPEP 2163(II)(A.3)(a)(ii) citing Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406; Juno Therapeutics, Inc. v. Kite Pharma, Inc., 10 F.4th 1330, 1337, 2021 USPQ2d 893 (Fed. Cir. 2021), Ariad Pharmaceuticals, Inc. v. Eli Lilly, Co., 598 F.3d at 1353-54 on page 8 of response and that to expedite prosecution, claims 15 and 28 have been amended to recite that the specific cancer is breast or lung cancer, that the breast or lung cancer gene is selected from BCL2, PTEN, EGFR, HLA-DRB1, IGF1, MTHFR, ERBB2, ACE, ABCB1, CCND1, MYC, EGF, FAS, MTOR, FN1, MDM2, SMAD4, MET, IGF1R, CDKN1A, TGFBR2, MLH1, MGMT, JAG1, CASP8, TCF4, COL11A2, AHR, SMAD3, CLU, HSPG2, EGR1, ISG20, MYD88, IL15, HMGA2, GLI3, BMP2, ARID1A, COL4A1, GATA3, SKI, EPCAM, KITLG, CDK6, TRPS1, BRD2, SETBP1, SLC22A3, SMAD2, DNMT3A, SDC1, PDE4D, FLT3, GATA6, TNFRSF11A, AKT2, HDAC9, STAT4, TFPI, SCN9A, KRT19, RBMS3, MLXIPL, HLA-DQA1, ENPP1, VCAN, GRIP1, KIF1B, NKX2-1, EGRF or SPINT1, and that the cancer associated long non-coding RNA is LINC00665. Applicant argues on page 9 of response that as acknowledged by the Examiner on page 7 of the Office Action, Applicant has shown that expression of a breast or lung cancer gene or of a breast or lung associated long non-coding RNA in a mammalian cell can be inhibited, as required by claim 15, or that breast or lung cancer can be treated, as required by claim 28, and Applicant has demonstrated possession of the recited target genes and cancer associated long non-coding RNA at the time the application was filed by reciting them in the figures and specification (page 24 and Fig 10-12) along with exemplification of a representative number of species. Applicant argues that the claims as amended describe identifying functional characteristics correlated with structure, as the amended claims clarify that the tRNA polynucleotide fragment (From which the tsRNA is derived) comprises a stem-loop/hairpin structure and that tsRNAs are generated in a Dicer dependent manner by including the wording that the tRNA is recognized by Dicer and processed into tsRNA in the nucleus. Claims 15 and 28 have been amended to emphasize that the tsRNA guides Ago2 to target RNA for degradation, which the Examiner rejected previous arguments on the basis that the claims did not require the tsRNAs to be generated in a Dicer dependent manner.
Applicant argues on pages 9-10 of response, regarding the Examiner’s objection regarding the alleged recitation of genera, that the claims as amended are limited to specific target genes and long non-coding RNA, and Applicant has provided sufficient written description to demonstrate possession of any alleged genus recited. The Application describes a novel gene silencing pathway mediated by Dicer dependent tsRNAs. See Application, page 2. tsRNAs guide Ago2 proteins to target protein coding transcripts and long non-coding RNA in the nucleus leading to RNA silencing. See id. at 3. tsRNAs are generated from tRNAs that are folded into a non-canonical secondary structure, namely a stem-loop / hairpin structure. See id. at 2-3. Dicer binds to these tRNAs and processes them into tsRNAs.. Unlike other RNA molecules, tsRNAs are generated in the nucleus by Dicer cleavage of the tRNA species. See id. at 3. tsRNAs target genes in nucleus. Applicant has demonstrated that tsRNA target genes are significantly associated with various diseases, e.g., lung and breast cancer, and specifically target the introns of such genes. See id. at 3.
This is not found persuasive. Regarding the above arguments, the claims as amended still do not have adequate written description for the genus of tsRNAs that will perform the recited functions of the instant claims. Just because methodology has been provided for the gene silencing pathway does not mean there is adequate written description. The recitation of the specific breast or lung cancer genes in the amended claims that the tsRNA is at least 90% or at least 95% complementary to without reciting more specific structure of the tsRNA is likened to Amgen Inc. v. Sanofi. See MPEP 2163 (II)(A)(3)(a)(ii), “However, the claimed invention itself must be adequately described in the written disclosure and/or the drawings. For example, disclosure of an antigen fully characterized by its structure, formula, chemical name, physical properties, or deposit in a public depository does not, without more, provide an adequate written description of an antibody claimed by its binding affinity to that antigen, even when preparation of such an antibody is routine and conventional. See Amgen Inc. v. Sanofi, 872 F.3d 1367, 1378, 124 USPQ2d 1354, 1361 (Fed. Cir. 2017)("knowledge of the chemical structure of an antigen [does not give] the required kind of structure-identifying information about the corresponding antibodies"); see also Centocor Ortho Biotech, Inc. v. Abbott Labs., 636 F.3d 1341, 1351-52, 97 USPQ2d 1870, 1877 (Fed. Cir. 2011)(patent disclosed the antigen the claimed antibody was supposed to bind, but did not disclose any antibodies with the specific claimed properties). It is noted that the stem-loop/hairpin structure is a structure of the tRNA, not the tsRNA, and therefore does not distinguish the tsRNA. While the specification discusses how tRNA can be processed to form the fragment by Dicer, the specification does not discuss the required structure of the tsRNA. What is needed is additional structure for the tsRNA, not the tRNA it is derived from. All the wherein clauses either recite a general structure of the tRNA (hairpin/stem-loop, recognized by Dicer and processed into tsRNA in the nucleus) or a function of tsRNA (guides Ago2 to target RNA for degradation.
Applicant argues on page 10 regarding the state of the art cited by the Examiner shows that a large genus of tRNA fragments can repress mRNA targets and regulate gene expression, none of the art discloses any tRNA molecule that is alternatively folded, comprises a stem-loop/hairpin structure, is recognised by Dicer and is processed into tsRNA in the nucleus to yield tsRNA and guides Ago2 to target RNA for degradation. The Application as filed demonstrates that tsRNAs are generated in a Dicer dependent manner wherein Dicer binds to tRNAs that are folded into a non-canonical secondary structure and processes them into tsRNAs. See id. at 2-3. These Dicer-dependent tsRNAs are functional and specifically target the introns of many protein coding genes and long non-coding RNA, leading to the degradation of their nascent RNA in an Argonaute 2 (Ago2)- dependent manner. See id. This distinguishes the mechanism from other RNA mechanisms mediated by known siRNAs. Furthermore, tsRNAs act in the nucleus whereas other known siRNA act in the cytoplasm. Targeting of the introns of genes or long non-coding RNA leads to immediate degradation of the RNA as soon as it is made in the nucleus. See id. at 3.
This is not found persuasive. If the state of the art does not teach the presently recited tRNA derived polynucleotide fragments from tRNA comprising a stem-loop/hairpin structure, and the required structure for performing the recited functions, then the state of the knowledge in the art is low and the specification must provide sufficient support for the claimed genus. Again, just because methodology has been provided for the gene silencing pathway does not mean there is adequate written description. The ordinary artisan would not know what the core structure is of the tRNA-derived polynucleotide that is required achieve the claimed. How the tsRNAs are generated from tRNA and the structure of the tRNA that the tsRNAs are derived from does not provide written description support for the structure of the genus of tsRNAs with the recited functions in the instant claims.
Applicant argues on pages 10-11, regarding the Examiner’s assertion that there is no structure-function correlation provided, the claimed tsRNA targets the intron of a cancer associated gene or of a cancer associated long non-coding RNA in a breast or lung cancer mammalian cell and the claimed tsRNA comprises a sequence that is at least 90% or at least 95% complementary to an intronic region of a breast or lung cancer associated target gene or an intronic region of a breast or lung associated long non-coding RNA as required in the claims. The tsRNA has 14-35 nucleotides and therefore specific sequence requirements are recited, and the requirements is a structural feature that correlates with function, and it would be clear to those skilled in the art from the written description which of the tRNA structure features are required to achieve the technical features of the claimed methods. In addition, claims 15 and 28 recite the tRNA from which the tsRNA is derived, comprises a stem-loop/hairpin structure and that the tRNA is recognized by Dicer and processed into tsRNA in the nucleus, and that specific examples are provided in the Examples section. The application provides clear direction how the tsRNAs can be designed (Fig. 4 and Examples).
This is not found persuasive. As stated in the written description rejection above, applicant has provided three species of tsRNAs (SEQ ID NOs: 4,5,6) which correspond only to a few cancer associated target genes or cancer associated long non-coding RNA in breast cancer or lung cancer cell lines. An artisan would be faced with designing and using tsRNAs with the instruction of 3 structures (SEQ ID NOs: 4,5,6) with no more specific guidance about the structural requirement that would perform the recited functions. Aligning the three tsRNA sequences among each other does not provide any structural similarity except for a “gugg” structure, see below:
SEQ ID NO: 4 ucccugguggucuagugguuag
SEQ ID NO: 5 uaagccagggauuguggguucg
SEQ ID NO: 6 ggggguguagcucaguggua
In addition, the three sequences are directed to different genes, two against different breast or lung cancer genes and one against lncRNA, and the specification has not provided any guidance about the core structure of the tsRNA that would be common to the tsRNA that target the list of genes in claims 15 and 28. The Examiner maintains that this is not a representative number of species by actual reduction to practice.
There are many possible introns and intronic regions within the cancer associated target genes. The specification only provides written description for 3 different tsRNA sequences (SEQ ID NOs: 4,5,6) that each pertain to a specific cancer associated target gene or long non-coding RNA (EGFR/MET, BCL2, and LINC00665), and which show reduced expression of the target gene, and reduce cell proliferation in vitro in either breast cancer cells lines or lung cancer cell lines. 3 disclosed sequences for 3 cancer associated target genes or lncRNA is not a sufficient number to provide sufficient written support for the claimed genus, and therefore the written description rejection is maintained.

Claim Rejections- Scope of Enablement
Claims 15,47 and 57 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for inhibiting gene expression of target genes EGFR and MET comprising introducing a tRNA-derived polynucleotide of SEQ ID NO: 4, inhibiting gene expression of target gene BCL2 comprising introducing a tRNA-derived polynucleotide of SEQ ID NO: 5, and inhibiting gene expression of target gene LINC00665 comprising introducing a tRNA-derived polynucleotide of SEQ ID NO: 6 mammalian breast or lung cancer cells, does not reasonably provide enablement for inhibiting the expression of the breast or lung cancer genes recited in claims 15 and 57, the method comprising introducing a tRNA-derived polynucleotide comprising a sequence that is at least 90% or 95% complementary to a genus of intronic regions of cancer associated target genes or genus of cancer associated long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides (tsRNA). The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
As stated in MPEP §2164.01(a), “there are many factors to consider when determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any experimentation is ‘undue’.” These factors include, but are not limited to:
1. The breadth of the claims;
2. The nature of the invention;
3. The state of the prior art;
4. The level of skill in the art;
5. The level of predictability in the art;
6. The amount of direction provided by the inventor;
7. The presence or absence of working examples;
8. The quantity of experimentation necessary needed to make or use the invention based on the disclosure.
The Breadth of the Claims and Nature of the Invention
Claims 15 and 47 encompass an in vivo method of inhibiting the expression of a cancer associated target gene or cancer associated long non-coding RNA in a mammalian breast or lung cancer cell by introducing into the mammalian breast or lung cancer cells a large genera of tRNA-derived polynucleotides comprising a sequence that is at least 90% or 95% complementary to a genus of intronic regions of cancer associated target genes or genus of cancer associated long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides (tsRNA), wherein the cancer is breast or lung cancer, and wherein the breast or lung cancer genes are those recited in claim 15. Claim 57 limits the breast or lung cancer gene to BCL2, EGFR, MET or SPINT1 but still encompass using a genus of tsRNAs.
The State of the Prior Art
Li et al. (Genes, Review, 9, 246, Published 10 May 2018) teach that high-throughput sequencing has unveiled various tsRNAs in bacteria, fungi, plants and mammals, and that various types of tsRNA can be generated from diverse tRNA sources (Section 2, page 2). Li et al. teach tRFs are evolutionarily ancient and present in both prokaryotes and eukaryotes, and that some tsRNAs preferentially associate with Ago1, Ago3, and Ago4 proteins but not Ago2 in a cell type specific manner, which indicates that tRFs have other functions than direct binding with the target genes as miRNAs (Section 3.1, page 4).
Maute et al. (PNAS Vol. 110, No. 4, Published 22 January 2013, pages 1404-1409) teach a class of abundantly expressed small RNAs whose sequences matched either to mature or precursor tRNA transcripts and that other groups have reported similar small RNA species expressed in a variety of human cell types and other organisms, yet the role of how these small RNAs act has not been determined (page 1404). Maute et al. teach three categories of tRNA fragments, tRF-5, tRF-3 and tRF-1, and that tRF-3s are the most abundant expressed in mature B cells (page 1404). Maute et al. teach a tRF-3 designated CU1276 which is a 22-nt small RNA differentially expressed in three stages of mature B-cell differentiation and one GC-derived lymphoma cell line (page 1404). Maute et al. teach that the tRNA-derived CU1276 can repress mRNA targets in an Argonaute-dependent, miRNA-like fashion (page 1405), and therefore the data presented demonstrates that a tRNA fragment can posttranscriptionally regulate endogenous genes in a sequence-specific, miRNA-like fashion (page 1408).
Therefore, the state of the art shows the large genus of tsRNAs and large genus of possible gene targets, and that the tRNA fragments can repress mRNA targets in an Argonaute-dependent, miRNA-like fashion and can posttranscriptionally regulate endogenous genes in a sequence-specific fashion. The state of the art is limited regarding a method of inhibiting the expression of a cancer-associated target gene or of a cancer-associated long non-coding RNA in a mammalian cell using a tRNA-derived polynucleotide fragment (tsRNA) from tRNA comprising a stem-loop/hairpin structure.

The Amount of Direction Provided by the Inventor and The presence or Absence of Working Examples
The specification discloses tsRNAs having the sequence comprising SEQ ID NOs: 4,5 or 6 (pages 10,38 and 39). Example 2, pages 37-38 discloses transfecting tsRNAs in cells, and Figures 13A,B shows levels of EGFR mRNA were reduced upon transfection of tsRNA EGFR. Example 3, page 38 discloses transfecting tsRNAs into cells, and that MET mRNA levels were reduced upon transfection with tsRNA MET (Figures 13A, B). However, these examples do not disclose the structure of the tsRNA necessary for performing this function. Example 4, page 38, discloses transfecting BT549 cells with tsRNA EGFR/MET, and that the tsRNA is single stranded and has SEQ ID NO: 4, and Figure 15 shows the number of dead cells increased with increasing amount of tsRNA EGFR/MET, and Figure 16 shows the number of lives cells decreased with increasing amount of tsRNA EGFR/MET. Example 5, page 39 discloses transfecting MCF7 (breast cancer cell line) cells with tsRNAs of SEQ ID NO: 5 to target BCL2 which led to downregulation of steady state BCL2 mRNA levels (Figure 18), and that BCL-2 levels decreased with increasing amount of tsRNA (Figure 19). Example 6, pages 39-40 discloses transfecting BT549 cells with tsRNA LINC00665 of SEQ ID NO: 6, and that LINC0665 levels were reduced (Figure 22, 23A,B), and fewer live cells (Figure 25).
The Level of Predictability in the Art
Regarding claims 15,47 and 57, the instant claimed invention is highly unpredictable due to the claims encompassing the recited method of introducing a large genus of tRNA-derived polynucleotides comprising a sequence that is at least 90 or 95% complementary to a genus of intronic regions of cancer associated target genes or genus of cancer associated long non-coding RNA, wherein the tRNA-derived polynucleotide fragment has 14-35 nucleotides (tsRNA) and the tRNA comprises a stem-loop/hairpin structure and wherein the breast or lung cancer gene is selected from those recited in claims 15 and 57 and resulting in inhibiting expression of a cancer associated gene or cancer associated lncRNA.
The large number of species encompassed by the genus of tsRNAs and genus of intronic regions of a cancer associated gene or cancer associated long non-coding RNA adds to the unpredictability of the claimed invention, and therefore one skilled in the art cannot use the information provided by the specification regarding the tsRNAs of SEQ ID NOs: 4,5 and 6 which are used to inhibit expression of EGFR and MET, BCL2 and LINC00665, respectively, and apply to the other species of the genus. If one skilled in the art cannot readily anticipate the effect of a change within the subject matter to which that claimed invention pertains, then there is a lack of predictability in the art. The court has indicated that the more unpredictable an area is, the more specific enablement is necessary in order to satisfy the statute. (See In re Fisher, 427 F.2d 833, 166 USPQ 18 (CCPA 1970)). This is because it is not obvious from the disclosure of one species, what other species will work.
The Quantity of Experimentation Necessary
Regarding claims 15,47 and 57, in light of the unpredictability surrounding the breadth of the claimed in vivo method, one wishing to practice the presently claimed invention would be unable to do so without engaging in undue experimentation. One of ordinary skill in the art would not be able to use the information provided by the instant specification to carry out the full scope of the invention as claimed, as there is no instruction as to how to use other tsRNAs to carry out the claimed invention. The specification only shows that three tsRNA sequences are capable of decreasing expression of 4 different target genes, all of which are associated with cancer, and occurring in breast and lung cancer cell lines. An artisan would be faced with designing and using tsRNAs with the instruction of 3 structures (SEQ ID NOs: 4,5,6) with no more specific guidance about the structural requirement that would perform the recited functions. In absence of such information in the specification as well as the state of the art, a person of ordinary skill in the art would reasonably require an undue quantity of experimentation to practice the full scope of the claimed method.
Conclusion of 35 U.S.C. 112(a) (Enablement) Analysis

After applying the Wands factors and analysis to claims 15,47 and 57, in view of the applicant’s entire disclosure, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claims 15,47 and 58 are rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable a person of skill in the art to use the invention commensurate in scope with these claims.

Response to Arguments
Applicant's arguments filed 07/10/2026 have been fully considered but they are not persuasive.
Applicant cites MPEP 2164 and MPEP 2164.01 on pages 11-12 of response, and to expedite prosecution the claims have been amended to recite that the specific cancer is breast or lung cancer and to recite specific target genes and long non-coding RNA and goes through the Wands factors. Applicant argues on page 13 that the breadth of claim 15 has been significantly narrowed by amendments requiring the method to be in vivo and the cells are breast or lung cancer cells, and the genus of tRNA-derived polynucleotides has been narrowed to include tRNAs that not only comprise a sequence with at least 90-95%complementarity to an intronic region of a cancer associated target gene or an intronic region of a cancer associated long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14-35 nt (tsRNA) but are also recognized by Dicer and processed into tsRNA in the nucleus wherein the tsRNA guides Ago2 to target RNA by degradation, and the claims have been narrowed to only specific breast or lung cancer target genes and long non-coding RNA.
Regarding the state of the art, Applicant argues on page 14 that the Examiner acknowledges that tRNAs are known in the art, and it is known that tRNAs can repress mRNA targets in an Argonaute-dependent manner and that a tRNA fragment can post-transcriptionally regulate endogenous genes in a sequence specific manner. Applicant argues that advanced molecular biology techniques are available to a skilled person in the art and all methods needed to practice the invention are known. Regarding the amount of direction provided and the presence or absence of working examples, Applicant submits that the specification as filed provides ample direction and working examples to allow the skilled person to identify a tRNA-derived polynucleotide which can be used in a method of inhibiting expression of a breast or lung cancer associated gene or long non-coding RNA or in a method of treating cancer based on extensive experimental details and data provided in the Application. Applicant argues on page 15 that the pending claims define a tsRNA that targets a specific subset of genes or lncRNA which is cancer associated and it is well within the ability of the skilled person to identify suitable breast or lung cancer associated genes and lncRNAs based on the examples and figures in the application, and would be able to follow the teaching in the application to identify and/or design tRNA derived molecules that are complementary to intronic regions of these breast or lung cancer associated genes and lncRNAs. Applicant states that Example 1 provides methods to predict tsRNA targets and determine tsRNA disease-association (pages 27-36) and Figure 4a is a bioinformatic workflow utilized by the Inventor to predict genes which are targeted by Dicer and Ago-associated tsRNAs and the inventor extracted sequences from PAR-CLIP experiments, and the data was mapped to tRNA genes, the inventor sequenced mRNA from wildtype and Dicer knockdown cells and determined genes upregulated in Dicer knockdown and employed miRanda to generate a list of genes that are predicted to be targeted by Dicer- and Ago-associated tsRNAs. Example 1 also provides details on methods employed by the inventor to identify genes that are regulated globally by the distinct gene silencing mechanism and performed chrRNA-seq to detect levels of nascent tsRNA transcripts in 4 different cell lines. Fig. 7b shows a workflow for predicted target genes using chrRNA-seq data followed by disease-gene association analysis, and the analysis can be validated as shown in Fig. 9.
Regarding Applicants arguments above regarding the specification disclosing how to identify tsRNAs and predicting target genes, this is not found persuasive. While applicant has pointed out that Example 1 shows how to predict tsRNA targets and determine disease association with genes, it does not show how to use them commensurate in scope with the claims regarding using the instantly claimed genus of tRNA-derived polynucleotides in mammalian cells breast or lung cancer cells to inhibit expression of a genus of cancer associated genes or cancer associated long non-coding RNA. The instant specification only provides 3 tsRNA sequences specific for 4 cancer associated genes/long non-coding RNA (MET/EGFR, BCL2, AND LINC00665 respectively) shown in in vitro cell experiments in cancer cells lines (breast cancer and lung cancer cells).
Applicant argues on page 16 that the description teaches a skilled person once they have identified tsRNAs that can target the intronic region of a target gene, they can also determine which of these tsRNAs are associated with various diseases such as cancer as depicted in Figures 10,11 and 12, and a skilled person can use known techniques to generate a heat-map of gene-disease associations and would be able to determine which tsRNAs can target a cancer-associated target gene or lncRNA, i.e., a breast or lung cancer associated gene. Applicant maintains that the experimental examples provide more than sufficient details to enable one skilled in the art to arrive at a tRNA-derived polynucleotide that is suitable for use in the recited methods.
This is not found persuasive. As stated above, showing how to identify tsRNAs and their target cancer associated genes does not provide enablement for how to use the identified tsRNAs commensurate in scope with the claims. MPEP 2164.03 states “in applications directed to inventions in arts where the results are unpredictable, the disclosure of a single species usually does not provide an adequate basis to support generic claims. In re Soll, 97 F.2d 623, 624, 38 USPQ 189, 191 (CCPA 1938). In cases involving unpredictable factors, such as most chemical reactions and physiological activity, more may be required. In re Fisher, 427 F.2d 833, 839, 166 USPQ 18, 24 (CCPA 1970) (contrasting mechanical and electrical elements with chemical reactions and physiological activity). See also In re Wright, 999 F.2d 1557, 1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993); In re Vaeck, 947 F.2d 488, 496, 20 USPQ2d 1438, 1445 (Fed. Cir. 1991). This is because in art areas having a high degree of uncertainty (i.e. the unpredictable arts) it is not reasonably predictable from the disclosure of one species, what other species will work”. In the instant case, Applicants have provided 3 species of tsRNAs that correspond to specific cancer-associated genes and long non-coding RNA in specific cancer cell-lines. While this is more than a single species referred to in MPEP above, there is unpredictability in the field regarding physiological activity.
Applicant cites Amgen v. Sanofi on page 16 and that the disclosure meets this test, as the class of tRNA-derived polynucleotides claims has a general quality of inhibiting the expression of a cancer associated gene or a cancer associated lncRNA in a mammalian breast or lung cancer cell-running through the class and this general quality gives the class of tRNA-derived polynucleotides a peculiar fitness for a particular purpose, for treating breast or lung cancer.
This is not found persuasive. MPEP 2164.01 states that In Amgen Inc. et al. v. Sanofi et al., 598 U.S. 594, 2023 USPQ2d 602 (2023), the Supreme Court, held that claims drawn to a genus of monoclonal antibodies, which were functionally claimed by their ability to bind to a specific protein, PCSK9, were invalid due to lack of enablement. The claims at issue were functional, in that they defined the genus by its function (the ability to bind to specific residues of PCSK9) as opposed to reciting a specific structure (the amino acid sequence of the antibodies in the genus). The Supreme Court concluded that the patents at issue failed to adequately enable the full scope of the genus of antibodies that performed the function of binding to specific amino acid residues on PCSK9 and blocking the binding of PCSK9 to a particular cholesterol receptor, LDLR. The Court clarified that the specification does not always need to "describe with particularity how to make and use every single embodiment within a claimed class." Id. at 610-11. However, "[i]f a patent claims an entire class of processes, machines, manufactures, or compositions of matter, the patent’s specification must enable a person skilled in the art to make and use the entire class….The more one claims, the more one must enable." Id. The court reaffirmed that if a patent claims an entire class of compositions, the specification must enable a skilled artisan to make and use the whole class. Amgen said its broad claims are enabled because scientists can make and use every undisclosed but functional antibody if they simply follow the company’s “roadmap” or its proposal for “conservative substitution.” We cannot agree. These two approaches amount to little more than two research assignments. The first merely describes step-by-step Amgen’s own trial-and-error method for finding functional antibodies—calling on scientists to create a wide range of candidate antibodies and then screen each to see which happen to bind to PCSK9 in the right place and block it from binding to LDL receptors. See Part I–B, supra; 987 F. 3d, at 1088; 2019 WL 4058927, *10–*13. The second isn’t much different. It requires scientists to make substitutions to the amino acid sequences of antibodies known to work and then test the resulting antibodies to see if they do too—an uncertain prospect given the state of the art. See Parts I–A, I–B, supra; 987 F. 3d, at 1088; 2019 WL 4058927, *10–*13. Whether methods like a “roadmap” or “conservative substitution” might suffice to enable other claims in other patents—perhaps because, as this Court suggested in Incandescent Lamp, the inventor identifies a quality common to every functional embodiment, supra, at 13—they do not here. Instead, the court stressed, the problem it saw is the same problem we see: Amgen offers persons skilled in the art little more than advice to engage in “trial and error”.
The Examiner maintains that the above case law pertaining to a genus of monoclonal antibodies functionally claimed by their ability to bind to a specific protein were not enabled is applicable to the instant situation. The instant specification similarly provides a roadmap (using a bioinformatic workflow to predict genes which are targeted by Dicer and Ago-associating tsRNAs (pages 27-36 of specification, and pages 15-16 of arguments), while only disclosing the structure of 3 tsRNAs.
Regarding the level of skill in the art, Applicant argues on page 17 that the level of skill in the relevant art is high and one would have extensive knowledge and experience with biochemistry and molecular biology lab techniques, and therefore would be able to perform necessary experiments to practice the scope of the invention without undue burden. Applicant argues the level of predictability in the art is higher than the Examiner asserts and that the amendments to the claims have narrowed the scope. Applicant argues that MPEP emphasizes that the specification may require a reasonable amount of experimentation and that does not amount to undue experimentation and that a skilled person would be able to use tsRNAs other than those exemplified and administer those to a mammalian subject to treat breast or lung cancer without undue experimentation.
This is not found persuasive. One of ordinary skill in the art would not be able to use the information provided by the instant specification to carry out the full scope of the invention as claimed, as there is no instruction as to how to use other tsRNAs to carry out the claimed invention. The specification only shows that three tsRNA sequences are capable of decreasing expression of 4 different target genes, all of which are associated with cancer, and occurring in breast and lung cancer cell lines. An artisan would be faced with designing and using tsRNAs with the instruction of 3 structures (SEQ ID NOs: 4,5,6) with no more specific guidance about the structural requirement that would perform the recited functions, and therefore the Examiner maintains there would be undue experimentation to carry out the recited method.
Regarding enablement for in vivo applications, Applicant also argues on page 18 of response that MPEP and case law clearly indicate that in vitro examples can constitute a working example that supports enablement if the example correlates with a disclosed or claimed method of invention (MPEP 2164.02 (II)). Applicant submits that the use of in vitro data in the present examples support and enable claims for in vivo application as the art clearly recognizes the use of the in vitro models used in the examples (MCF-7 and A549 breast and lung cancer cell lines) as correlating to in vivo breast and lung cancer models and applications and the Examiner has not provided reasons as to why examples using MCF-7 and A549 cell lines would not correlate to in vivo applications. Applicant argues it is also well known in the art that in vitro experimental results from MCF-7 breast cancer and A549 lung cancer cells can be extrapolated to in vivo cancer treatment. MCF-7 breast cancer and A549 lung cancer cells are well-established human tumour cell lines used to generate subcutaneous or orthotopic xenografts in immunodeficient mice. In an MCF-7 or A549 xenograft study, the antisense oligonucleotide (ASO) can be analyzed for target knockdown, showing whether it achieves pharmacodynamic activity in vivo. These xenograft models therefore demonstrate whether a tested ASO has in vivo stability, tumour exposure, target engagement, dose-response activity, therapeutic efficacy, and preliminary tolerability. For RNA targets such as oncogenic mRNAs, miRNAs, or long non-coding RNAs, MCF-7 and A549 xenografts are useful for linking molecular knockdown to phenotypic outcomes such as reduced proliferation, increased apoptosis, impaired invasion/metastasis, or enhanced response to chemotherapy.
Applicant presents examples from scientific literature to demonstrate that in vitro
experimental data from A549 and MCF-7 are known in the art to correlate to in vivo applications. In Gutschner (Gutschner et al., The noncoding RNA MALAT1 is a critical regulator of the metastasis phenotype of lung cancer cells, Cancer Res. 2013 Feb 1;73(3):1180-9), in vitro experiments carried out in A549 lung adenocarcinoma cells were subsequently validated in a mouse xenograft. In Fu (Fu et al., MDM2 Molecular Imaging for the Prediction of Chemotherapeutic Sensitivity in Human Breast Cancer Xenograft, Molecular Imaging. 2014;13(6)), in vitro experiments where MCF-7 cells were transfected with MDM2 antisense oligonucleotides (ASONs) were subsequently correlated with a response to chemotherapy in a breast cancer xenograft model. Thus, based on what is known in the art, a skilled person would understand that the results from experiments in MCF-7 and A549 cells can be correlated and extrapolated to in vivo cancer treatment.
While the Examiner notes the above references provided by Applicant, the Examiner maintains that there is unpredictability in extrapolating in vitro results to in vivo results for breast cancer and lung cancer. The claims encompass many types of breast cancer. Holen et al. (Disease Models and Mechanisms (2017) 10; 359-371) teach one of the main challenges in developing in vivo models has been the increasing understanding of the many different subtypes of breast cancer (page 361, left column). Holen et al. teach one of the simplest and therefore most commonly used model systems is based on engraftment of human cell lines to immunocompromised animals [cell-derived xenografts (CDX) and have been used for assessment of breast cancer genetics, biological processes, and to some degree, metastatic potential; but are limited by their reduced intra-tumoural heterogeneity and their poor record of predicting clinically effective therapies (Whittle et al., 2015 and references therein). The lines used are frequently derived from highly aggressive malignant tumours or plural effusions (fluids drained from lung metastasis) such as the frequently studied MDA-MB-231 line, making these less useful for modelling early events in the evolution of the primary tumour. Although well-characterised cell lines representing the common clinical subtypes– luminal A (e.g. MCF 7, T47D), luminal B (e.g. BT474, MDA-MB-361), HER2+ (e.g. SKBR3, HCC202) and triple negative (e.g. BT20, MDA-MB-231, MDA-MB-468)– have been extensively studied, not all can be established in vivo (pages 361-362). Holen et al. teach there is a concern that models of breast cancer do not always reflect the pathology of the human disease (page 363, right column). Holliday et al. (Breast Cancer Research 2011, 13:215) teach that MCF-7 was established in 1973 and the popularity of MCF-7 is largely due to its exquisite hormone sensitivity through expression of oestrogen receptor (ER), making it an ideal model to study hormone response (Introduction, page 1). Holliday et al. teach long before the advent of modern molecular profiling techniques, histopathologists recognised that breast cancer was heterogeneous through morphological observations, and the development of molecular profiling using DNA microarrays proved this heterogeneity, and that breast cancer could be classified into at least five subtypes: luminal A, luminal B, HER2, basal and normal and each subtype has different prognosis and treatment response (page 1 left page). Holliday et al. teach of the cell lines commonly incorporated into xenograft models, ER-positive luminal A cell lines such as MCF-7 and T47D will only form tumours in the presence of oestrogen and, unsurprisingly, growth can be inhibited by anti-oestrogen therapy. Cell lines representing other subtypes (for example, BT474, MDA-MB-468 and MDA MB-231) have also been shown to be tumourigenic (page 4), and that an unexpected finding with xenograft models is the limited ability of tumours to invade and metastasise, particularly given the often metastatic origin of cell lines (page 5).
Regarding lung cancer and lung cancer cell line A549, Tieche et al. teach the A549 adenocarcinoma cell line was derived from human carcinomatous lung tissue by Giard et al. and has been widely studied, but that no report characterizes the distinct cell types composing the parental A549 cell line in detail. Our study indicates that an untreated in vitro culture of the parental cell line A549 is composed of unique subpopulations of cells characterized by distinct features, i.e., tumor initiation capacity, chemotherapy resistance, EMT, and migration/invasion capacity (Introduction page 185). Tieche et al. teach their study suggests that that the parental cell line A549 contains subpopulations characterized by distinct epigenetic states and phenotypical features and their analysis indicates that, at least in lung cancer, the situation might be more complex (Conclusion page 195).

Claim Rejections- Scope of Enablement
Claims 28,48-50 and 53-56 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method of treating breast cancer or lung cancer in vitro comprising administering an effective amount of a pharmaceutical composition comprising a tsRNA having SEQ ID NO: 4,5 or 6 to a breast or lung cancer cell in vitro, does not reasonably provide enablement for a method of treating a genus of breast or lung cancers comprising administering an effective amount of a pharmaceutical composition comprising a genus of tRNA-derived polynucleotides comprising a sequence that is at least 90 or 95% complementary to a genus of intronic regions of a cancer associated target gene or genus of intronic region of a cancer associated long non-coding RNA, wherein said tRNA-derived polynucleotide fragment has 14-35 nucleotides, and wherein the breast or lung cancer gene or cancer associated long noncoding RNA is selected from those recited in claims 28 and 56, in vivo to a human subject in need thereof. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims.
As stated in MPEP §2164.01(a), “there are many factors to consider when determining whether there is sufficient evidence to support a determination that a disclosure does not satisfy the enablement requirement and whether any experimentation is ‘undue’.” These factors include, but are not limited to:
1. The breadth of the claims;
2. The nature of the invention;
3. The state of the prior art;
4. The level of skill in the art;
5. The level of predictability in the art;
6. The amount of direction provided by the inventor;
7. The presence or absence of working examples;
8. The quantity of experimentation necessary needed to make or use the invention based on the disclosure.

The Breadth of the Claims and Nature of the Invention
Claims 28,48-50 and 53-56 encompass a method of treating a genus of breast or lung cancers, comprising administering by any route of administration, a large genus of isolated tRNA-derived polynucleotides comprising a sequence that is at least 90 or 95% complementary to an intronic region of a large genus of cancer associated target gene or an intronic region of a cancer associated long non-coding RNA, wherein said tRNA-derived polynucleotide fragment has 14-35 nucleotides, and wherein the breast or lung cancer gene or lncRNA is selected from those recited in claims 28 and 56 to a mammalian subject in need thereof.
The State of the Prior Art
Li et al. (Genes, Review, 9, 246, Published 10 May 2018) teach that high-throughput sequencing has unveiled various tsRNAs in bacteria, fungi, plants and mammals, and that various types of tsRNA can be generated from diverse tRNA sources (Section 2, page 2). Li et al. teach tRFs are evolutionarily ancient and present in both prokaryotes and eukaryotes, and that some tsRNAs preferentially associate with Ago1, Ago3, and Ago4 proteins but not Ago2 in a cell type specific manner, which indicates that tRFs have other functions than direct binding with the target genes as miRNAs (Section 3.1, page 4).
Maute et al. (PNAS Vol. 110, No. 4, Published 22 January 2013, pages 1404-1409) teach a class of abundantly expressed small RNAs whose sequences matched either to mature or precursor tRNA transcripts and that other groups have reported similar small RNA species expressed in a variety of human cell types and other organisms, yet the role of how these small RNAs act has not been determined (page 1404). Maute et al. teach three categories of tRNA fragments, tRF-5, tRF-3 and tRF-1, and that tRF-3s are the most abundant expressed in mature B cells (page 1404). Maute et al. teach a tRF-3 designated CU1276 which is a 22-nt small RNA differentially expressed in three stages of mature B-cell differentiation and one GC-derived lymphoma cell line (page 1404). Maute et al. teach that the tRNA-derived CU1276 can repress mRNA targets in an Aurgonaute-dependent, miRNA-like fashion (page 1405), and therefore the data presented demonstrates that a tRNA fragment can posttranscriptionally regulate endogenous genes in a sequence-specific, miRNA-like fashion (page 1408).
Holle et al. (Advanced Drug Delivery Reviews 97 (2016), 270-279) teach that there are many examples of drugs that have cytotoxic behavior in cancer cells in vitro but losing efficacy in vivo which is the result of poorly understood chemoresistant effects conferred by the cancer environment (Abstract).
Kryzyszczyk et al. (Technology, 2018; 6(3-4): 79-100, pages 1-27) teach cancer is a complex and heterogenous condition, and some cancer types such as colon, breast and non-Hodgkin’s lymphoma contain even more specific classifications based on their molecular subtypes (Intro, page 2). Kryzyszczyk et al. teach expression of markers within the same tumor can change depending on the location or stage of cancer (Intro, page 2).
The claims encompass many types of breast cancer. Holen et al. (Disease Models and Mechanisms (2017) 10; 359-371) teach one of the main challenges in developing in vivo models has been the increasing understanding of the many different subtypes of breast cancer (page 361, left column). Holen et al. teach one of the simplest and therefore most commonly used model systems is based on engraftment of human cell lines to immunocompromised animals [cell-derived xenografts (CDX) and have been used for assessment of breast cancer genetics, biological processes, and to some degree, metastatic potential; but are limited by their reduced intra-tumoural heterogeneity and their poor record of predicting clinically effective therapies (Whittle et al., 2015 and references therein). The lines used are frequently derived from highly aggressive malignant tumours or plural effusions (fluids drained from lung metastasis) such as the frequently studied MDA-MB-231 line, making these less useful for modelling early events in the evolution of the primary tumour. Although well-characterised cell lines representing the common clinical subtypes– luminal A (e.g. MCF 7, T47D), luminal B (e.g. BT474, MDA-MB-361), HER2+ (e.g. SKBR3, HCC202) and triple negative (e.g. BT20, MDA-MB-231, MDA-MB-468)– have been extensively studied, not all can be established in vivo (pages 361-362). Holen et al. teach there is a concern that models of breast cancer do not always reflect the pathology of the human disease (page 363, right column). Holliday et al. (Breast Cancer Research 2011, 13:215) teach that MCF-7 was established in 1973 and the popularity of MCF-7 is largely due to its exquisite hormone sensitivity through expression of oestrogen receptor (ER), making it an ideal model to study hormone response (Introduction, page 1). Holliday et al. teach long before the advent of modern molecular profiling techniques, histopathologists recognised that breast cancer was heterogeneous through morphological observations, and the development of molecular profiling using DNA microarrays proved this heterogeneity, and that breast cancer could be classified into at least five subtypes: luminal A, luminal B, HER2, basal and normal and each subtype has different prognosis and treatment response (page 1 left page). Holliday et al. teach of the cell lines commonly incorporated into xenograft models, ER-positive luminal A cell lines such as MCF-7 and T47D will only form tumours in the presence of oestrogen and, unsurprisingly, growth can be inhibited by anti-oestrogen therapy. Cell lines representing other subtypes (for example, BT474, MDA-MB-468 and MDA MB-231) have also been shown to be tumourigenic (page 4), and that an unexpected finding with xenograft models is the limited ability of tumours to invade and metastasise, particularly given the often metastatic origin of cell lines (page 5).
The claims also encompass a genus of lung cancer. Regarding lung cancer and lung cancer cell line A549, Tieche et al. (Neoplasia Vol. 21, No. 2, 2019, pages 185-196) teach the A549 adenocarcinoma cell line was derived from human carcinomatous lung tissue by Giard et al. and has been widely studied, but that no report characterizes the distinct cell types composing the parental A549 cell line in detail. Our study indicates that an untreated in vitro culture of the parental cell line A549 is composed of unique subpopulations of cells characterized by distinct features, i.e., tumor initiation capacity, chemotherapy resistance, EMT, and migration/invasion capacity (Introduction page 185). Tieche et al. teach their study suggests that that the parental cell line A549 contains subpopulations characterized by distinct epigenetic states and phenotypical features and their analysis indicates that, at least in lung cancer, the situation might be more complex (Conclusion page 195).
Therefore, the state of the art shows the large genus of tsRNAs and large genus of possible gene targets, as well as the unpredictability of in vitro to in vivo correlation of results regarding cancer treatment.

The Level of Predictability in the Art
Regarding claims 28,48-50 and 53-56, the instant claimed invention is highly unpredictable due to the claims encompassing treating a genus of breast or lung cancer by administering by any route of administration, an effective amount of a pharmaceutical composition comprising a large genera of tRNA-derived polynucleotides as instantly recited in claim 28 and wherein the breast or lung cancer genes or lncRNA is selected from those recited in claims 28 and 56. The large number of species encompassed by the genus of tRNA-derived fragments, and the number of species encompassed by all of the possible intronic regions of any of the recited breast or lung cancer associated target genes or long non-coding RNA, as well as administration to the mammalian subject by any route and which results in treating breast or lung cancer adds to the unpredictability of the claimed invention. The genus of isolated tRNA-derived polynucleotides comprising a sequence that is at least 90% or at least 95% complementary to an intronic region of a cancer associated target gene or of a cancer associated long non-coding RNA encompasses thousands of different structures, and therefore one skilled in the art cannot use the information provided by the specification regarding SEQ ID NOs: 4-6 as the tsRNAs and the target genes EGFR/MET, BCL2 and LINC00665 and apply to the other species of the genus and use them commensurate in scope with the claims.
The specification does not show in vivo treatment of cancer with any specific tsRNAs in a subject. As shown by Holle et al. above, there are many examples of drugs that have cytotoxic behavior in cancer cells in vitro but losing efficacy in vivo which is the result of poorly understood chemoresistant effects conferred by the cancer environment. If one skilled in the art cannot readily anticipate the effect of a change within the subject matter to which that claimed invention pertains then there is a lack of predictability in the art. The court has indicated that the more unpredictable an area is, the more specific enablement is necessary in order to satisfy the statute. (See In re Fisher, 427 F.2d 833, 166 USPQ 18 (CCPA 1970)). This is because it is not obvious from the disclosure of one species, what other species will work.
For example, it would be unpredictable that administering a pharmaceutical composition comprising a tsRNA as recited in the instant claims that is at least 90% or 95% complementary to a gene associated with leukemia can be administered to any subject by any route of administration to treat breast cancer. In addition, different types of cancers start in different cells and parts of the body. A drug that would be able to treat tissue cancers that start in epithelial cells may be able to treat other tissue cancers that start in epithelial cells, but it would not be predictable that a drug that can treat a tissue cancer would be capable of treating cancers that begin in different cells, such as leukemia, lymphoma and myeloma. See Kryzyszczyk et al. above regarding the unpredictability in different cancers.
Also as shown by Holle et al., Holen et al., Holliday et al. and Tieche et al. above, there is a high level of unpredictably in the art of breast and lung cancer treatment with limitations in the in vitro and in vivo studies.
The Amount of Direction Provided by the Inventor and The presence or Absence of Working Examples
The specification discloses tsRNAs having the sequence comprising SEQ ID NO:s 4,5 or 6 (pages 10,38 and 39). Example 2, pages 37-38 discloses transfecting tsRNAs in cells, and Figures 13A,B shows levels of EGFR mRNA were reduced upon transfection of tsRNA EGFR. Example 3, page 38 discloses transfecting tsRNAs into cells, and that MET mRNA levels were reduced upon transfection with tsRNA MET (Figures 13A, B). However, these examples do not disclose the structure of the tsRNA necessary for performing this function. Example 4, page 38, discloses transfecting BT549 cells with tsRNA EGFR/MET, and that the tsRNA is single stranded and has SEQ ID NO: 4, and Figure 15 shows the number of dead cells increased with increasing amount of tsRNA EGFR/MET, and Figure 16 shows the number of lives cells decreased with increasing amount of tsRNA EGFR/MET. Example 5, page 39 discloses transfecting MCF7 (breast cancer cell line) cells with tsRNAs of SEQ ID NO: 5 to target BCL2 which led to downregulation of steady state BCL2 mRNA levels (Figure 18), and that BCL-2 levels decreased with increasing amount of tsRNA (Figure 19). Example 6, pages 39-40 discloses transfecting BT549 cells with tsRNA LINC00665 of SEQ ID NO: 6, and that LINC0665 levels were reduced (Figure 22, 23A,B), and fewer live cells (Figure 25).
The specification provides no guidance on how to practice the claimed invention for treating cancer as recited in claims 28 and 48-55. The specification only shows a method of decreasing expression of a few cancer associated target genes in a few cancer cell lines.
The Quantity of Experimentation Necessary
Regarding claims 28,48-50 and 53-56, in light of the unpredictability surrounding the breadth of the claimed method of treating breast or lung cancer comprising administering an effective amount of a pharmaceutical composition comprising a tRNA-derived polynucleotide as recited in instant claim 28, one wishing to practice the presently claimed invention would be unable to do so without engaging in undue experimentation. One of ordinary skill in the art would not be able to use the information provided by the instant specification to carry out the full scope of the invention as claimed, as there is no instruction as to how to use other tsRNAs to carry out the claimed invention and no instruction on how to administer the recited tsRNA to a mammalian subject to treat breast or lung cancers. In absence of such information in the specification as well as the state of the art, a person of ordinary skill in the art would reasonably require an undue quantity of experimentation to practice the full scope of the claimed method.
Conclusion of 35 U.S.C. 112(a) (Enablement) Analysis

After applying the Wands factors and analysis to claims 28,48-50 and 53-56, in view of the applicant’s entire disclosure, it is concluded that the specification is not enabled for the full scope as discussed above. Therefore, claims 28,48-50 and 53-56 are rejected under 35 U.S.C. §112(a) for failing to disclose sufficient information to enable a person of skill in the art to use the invention commensurate in scope with these claims.

Response to Arguments
Applicant's arguments filed 07/10/2026 have been fully considered but they are not persuasive.
Applicant states on pages 20-21 of response that regarding claims 50-52 with regards to the specification not showing how to carry out the claimed invention with a genus of dsRNAs, claim 50 has been amended in the response filed 05/19/2026 to remove “double stranded” and claims 51-52 are cancelled and therefore the rejection with regards to 50-52 have been rendered moot. Regarding claims 28,45-49 and 53-55 Applicant submits the claims are enabled for the same reasons stated above with respect to claims 15,20 and 47, the level of skill in the art is high and all methods required to practice the method of treating breast cancer or lung cancer by administering the claimed composition are well known tin the art.
This is not found persuasive. As stated in the above enablement rejection, the instant specification does not show how to use the claimed invention using a genus of tsRNAs. No additional arguments have been presented than those provided regarding claims 15,20 and 47 and the response thereto has been provided above. It is noted that no specific route of administration is claimed or exemplified that would result in treatment. Holle et al. and Kryzyszczyk et al. cited in the enablement rejection and the additional references (Holen et al., Holliday et al., Tieche et al.) provided by the Examiner provide support regarding the unpredictability in different cancers and high level of unpredictably in the art of cancer treatment with limitations in the in vitro and in vivo studies. Therefore, the claimed invention remains unpredictable.

Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 15,28,47-50,53-57 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 15,28,29 and 37 of copending Application No. 18/254,324 (‘324) (reference application).
Although the claims at issue are not identical, they are not patentably distinct from each other because claim 15 of ‘324 is directed to an in vitro or ex vivo method of inhibiting expression of a target gene or of long non-coding RNA in a biological system comprising introducing the tRNA-derived polynucleotide comprising a sequence that is complementary to an exonic region of a target gene or of a long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14-35 nucleotides (tsRNA), into the biological system, claim 28 is directed to a method for treating cancer in a subject in need thereof comprising administering to the subject an effective amount of the tRNA-derived polynucleotide; claim 29 is a method of inhibiting expression of a gene or of long non-coding RNA in a biological system; and claim 37 is a method of mediating target specific RNA interference by introducing a tRNA-derived polynucleotide of claim 1 into a biological system.
Instant claims 15 and 47 are directed to a method of inhibiting expression of a cancer associated gene or a cancer associated long non-coding RNA in a mammalian cell comprising introducing a tRNA-derived polynucleotide comprising a sequence that is at least 90 or 95% complementary to an intronic region of a cancer associated target gene or an intronic region of a cancer associated long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14-35 nucleotides (tsRNA) and comprises a stem-loop/hairpin structure. Instant claims 28 and 48-55 are directed to a method for treatment of cancer comprising administering to a mammalian subject an effective amount of the tRNA-derived polynucleotide comprising a sequence that is at least 90 or 95% complementary to an intronic region of a cancer associated target gene or an intronic region of a cancer associated long non-coding RNA wherein said tRNA-derived polynucleotide is a tRNA-derived polynucleotide fragment that has 14-35 nucleotides (tsRNA) and comprises a stem-loop/hairpin structure. The specification of ‘324 recognizes that the sequences of the tsRNA are SEQ ID NOs: 4-6 as shown in examples 4-6, which are the same sequences exemplified in examples 4-6 of the instant specification. Therefore, it doesn’t appear that the sequences of the tsRNA that are claimed in the copending application are of a different structure than those in the instant claims.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.

Response to Arguments
Applicant states on page 21 of the response that under MPEP 804(I)(B)(1)(b)(i), if a provisional nonstatutory double patenting rejection is the only remaining rejection in an application with an earlier patent term filing date, the examiner should withdraw the rejection in the application with the earlier patent term filing date.
While the instant application has the earlier patent term filing date of November 8, 2021, at this time this is not the only rejection remaining in the application, and therefore the rejection is maintained.

Conclusion
Claims 15,28,47-50 and 53-57 are rejected.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to STEPHANIE L SULLIVAN whose telephone number is [phone]. The examiner can normally be reached Monday-Friday, 7:30-3:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram R Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.

/STEPHANIE L SULLIVAN/Examiner, Art Unit 1635
/RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635

Prosecution Timeline

• Nov 08, 2021: Application Filed
• Feb 14, 2025: Non-Final Rejection mailed — §112, §DP
• May 16, 2025: Response Filed
• Aug 11, 2025: Final Rejection mailed — §112, §DP
• Oct 13, 2025: Response after Non-Final Action
• Nov 10, 2025: Request for Continued Examination
• Nov 13, 2025: Response after Non-Final Action
• Feb 20, 2026: Non-Final Rejection mailed — §112, §DP
• May 19, 2026: Response Filed
• Jul 08, 2026: Examiner Interview Summary
• Jul 31, 2026: Final Rejection mailed — §112, §DP
• Jul 31, 2026: Response after Non-Final Action