Prosecution Insights
Last updated: April 19, 2026
Application No. 17/610,111

OPTIMIZED PHENYLANANINE HYDROXYLASE EXPRESSION

Final Rejection §102§103§112
Filed
Nov 09, 2021
Examiner
MARVICH, MARIA
Art Unit
1634
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
American Gene Technologies International Inc.
OA Round
2 (Final)
55%
Grant Probability
Moderate
3-4
OA Rounds
4y 2m
To Grant
82%
With Interview

Examiner Intelligence

Grants 55% of resolved cases
55%
Career Allow Rate
529 granted / 967 resolved
-5.3% vs TC avg
Strong +27% interview lift
Without
With
+26.9%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
53 currently pending
Career history
1020
Total Applications
across all art units

Statute-Specific Performance

§101
2.9%
-37.1% vs TC avg
§103
26.7%
-13.3% vs TC avg
§102
19.8%
-20.2% vs TC avg
§112
34.9%
-5.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 967 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This office action is in response to an amendment filed 12/01/2025. Claims 1, 3, 5, 7, 9, 11, 13 and 15-25 are pending. Claims 5, 7, 9, 11, 13, 15, 24 and 25 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention there being no allowable generic or linking claim. This application is a 371 filing of PCT/US2020/035584 filed 6/1/2020 which claims priority to provisional application 62/855,506 filed 5/31/2019. Response to Amendments The previous objections have been overcome. Claim Objections Claims 1 and 22 are objected to because of the following informalities: claim 1 refers to PAH by abbreviation and should spell out the term fully –phenylalanine hydroxylase-- on its first occurrence. Claim 22 is missing the verb --is--. Appropriate correction is required. Claim Rejections - 35 USC § 112, first paragraph The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 1, 3 and 16-23 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Applicants argue that the amendment is sufficient to overcome the rejections. However, the variant is not limited in structure. It is newly extended to claim 3 as the variant thereof is removed from this claim. Hence, should the claims be limited to the variant it no longer is limited by the structure of claim 3. Hence, this claim is in part a new rejection necessitated by applicants’ amendment. Claim 1 is drawn a vector comprises a codon optimized coding sequence of the PAH or a variant. The codon-optimized PAH sequence is limited to one with at least 95% identity to SEQ ID NO:70. However, the variant thereof is not limited. Specifically, the claim recites “a codon optimized PAH sequence or variant thereof” “wherein the codon optimized PAH sequence comprise a sequence…”. . Because the claim excludes the variant, it suffers from the lack of description previously noted for the claims. Therefore, the variant of claim 1 is not limited by structure or function and can therefore be any kind of variant. The disclosure only teaches, [0088] As used herein, the term “variant” refers to a nucleotide sequence that, when compared to a reference sequence, contains at least one of a single nucleotide polymorphism, a single nucleotide variation, a conversion, an inversion, a duplication, a deletion, or a substitution. A “variant” includes amino acid sequences that derive from “variant” nucleotide sequences, as well as post-transcriptional and post-translational modifications thereto. [0149] In an aspect, a codon-optimized PAH sequence or variant thereof for use in treating PKU in a subject is provided. In another aspect, a codon-optimized PAH sequence or variant thereof to formulate a medicament for use in treating PKU in a subject is provided. So, the description invokes a function of therapy for PKU but otherwise, there is no description of the structure that is needed. Hence, the claims are drawn to a variant with no structural characterization that must also have functional properties. However, there is no disclosure of structures that are variants and that can be used to treat PKU. The specification only teaches the non-variant sequences found in the sequence of SEQ ID NO:70. As well, there is no disclosure of the structural properties that are required of the variants to mediate the required functional properties. The claims thus are drawn to a large genus of proteins which are not sufficiently described in the specification. The written description requirement for genus claims may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant identifying characteristics, i.e. structure or other physical and/or chemical properties, by functional characteristics coupled with known or disclosed correlations between function and structure, or by a combination of such characteristics sufficient to show that the applicant was in possession of the claimed genus. To this end, the MPEP provides such guidance (emphasis added). If the application as filed does not disclose the complete structure (or acts of a process) of the claimed invention as a whole, determine whether the specification discloses other relevant identifying characteristics sufficient to describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize applicant was in possession of the claimed invention. For example, if the art has established a strong correlation between structure and function, one skilled in the art would be able to predict with a reasonable degree of confidence the structure of the claimed invention from a recitation of its function. Thus, the written description requirement may be satisfied through disclosure of function and minimal structure when there is a well-established correlation between structure and function. In contrast, without such a correlation, the capability to recognize or understand the structure from the mere recitation of function and minimal structure is highly unlikely. In this latter case, disclosure of function alone is little more than a wish for possession; it does not satisfy the written description requirement. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406 (written description requirement not satisfied by merely providing "a result that one might achieve if one made that invention"); In re Wilder, 736 F.2d 1516, 1521, 222 USPQ 369, 372-73 (Fed. Cir. 1984) (affirming a rejection for lack of written description because the specification does "little more than outline goals appellants hope the claimed invention achieves and the problems the invention will hopefully ameliorate"). Compare Fonar, 107 F.3d at 1549, 41 USPQ2d at 1805 (disclosure of software function adequate in that art). Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 3 and 17-21 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Wilson et al (WO 2018126112). Applicants argue that the amendment is sufficient to overcome the rejections. However, the variant is not limited in structure. It is newly extended to claim 3 as the variant thereof is removed from this claim. Hence, should the claims be limited to the variant it no longer is limited by the structure of claim 3. Hence, this claim is in part a new rejection necessitated by applicants’ amendment. Wilson et al teach PAH therapy for PKU (see page 1, line 19-32). The sequence is 92% related to SEQ ID NO:70. RESULT 1 US-16-474-960-23 Sequence 23, US/16474960 Patent No. 11382941 GENERAL INFORMATION APPLICANT: Trustees of the University of Pennsylvania TITLE OF INVENTION: GENE THERAPY FOR TREATING PHENYLKETONURIA FILE REFERENCE: UPN-16-7939PCT CURRENT APPLICATION NUMBER: US/16/474,960 CURRENT FILING DATE: 2019-06-28 PRIOR APPLICATION NUMBER: 62/440,651 PRIOR FILING DATE: 2016-12-30 PRIOR APPLICATION NUMBER: 62/469,898 PRIOR FILING DATE: 2017-03-10 PRIOR APPLICATION NUMBER: 62/505,373 PRIOR FILING DATE: 2017-05-12 NUMBER OF SEQ ID NOS: 31 SEQ ID NO 23 LENGTH: 2203 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: constructed sequence Query Match 91.9%; Score 1248.6; Length 2203; Best Local Similarity 94.9%; Matches 1290; Conservative 0; Mismatches 69; Indels 0; Gaps 0; Qy 1 ATGTCTACCGCCGTGCTGGAAAATCCTGGCCTGGGCAGAAAGCTGAGCGACTTCGGCCAA 60 |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| Db 443 ATGTCTACCGCCGTGCTGGAAAATCCCGGCCTGGGCAGAAAGCTGAGCGACTTCGGCCAG 502 Qy 61 GAGACAAGCTACATCGAGGACAACTGCAACCAGAACGGCGCCATCAGCCTGATCTTCAGC 120 || || |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 503 GAAACCAGCTACATCGAGGACAACTGCAACCAGAACGGCGCCATCAGCCTGATCTTCAGC 562 Qy 121 CTGAAAGAAGAAGTGGGCGCCCTGGCCAAGGTGCTGAGACTGTTCGAAGAGAACGACGTG 180 |||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||| Db 563 CTGAAAGAAGAAGTGGGCGCCCTGGCCAAGGTGCTGCGGCTGTTCGAAGAGAACGACGTG 622 Qy 181 AACCTGACACACATCGAGAGCAGACCCAGCAGACTGAAGAAGGACGAGTACGAGTTCTTC 240 |||||||| |||||||||||| | |||||||||||||||||||||||||||||||||||| Db 623 AACCTGACCCACATCGAGAGCCGGCCCAGCAGACTGAAGAAGGACGAGTACGAGTTCTTC 682 Qy 241 ACCCACCTGGACAAGCGGAGCCTGCCTGCTCTGACCAACATCATCAAGATCCTGCGGCAC 300 |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||| Db 683 ACCCACCTGGACAAGCGGAGCCTGCCCGCCCTGACCAACATCATCAAGATCCTGCGGCAC 742 Qy 301 GACATCGGCGCCACAGTGCACGAACTGAGCCGGGACAAGAAAAAGGACACCGTGCCATGG 360 |||||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||| Db 743 GACATCGGCGCCACCGTGCACGAGCTGAGCCGGGACAAGAAAAAGGACACCGTGCCCTGG 802 Qy 361 TTCCCCAGAACCATCCAAGAGCTGGACAGATTCGCCAACCAGATCCTGAGCTATGGCGCC 420 |||||| | |||||||| || |||||||||||||||||||||||||||||||| |||||| Db 803 TTCCCCCGGACCATCCAGGAACTGGACAGATTCGCCAACCAGATCCTGAGCTACGGCGCC 862 Qy 421 GAGCTGGACGCTGATCACCCTGGCTTTAAGGACCCCGTGTACCGGGCCAGAAGAAAGCAG 480 ||||||||||| |||||||| |||||||||||||||||||||||||||||| | |||||| Db 863 GAGCTGGACGCCGATCACCCCGGCTTTAAGGACCCCGTGTACCGGGCCAGACGGAAGCAG 922 Qy 481 TTTGCCGATATCGCCTACAACTACCGGCACGGCCAGCCTATTCCTCGGGTCGAGTACATG 540 |||||||||||||||||||||||||||||||||||||| || || ||||| ||||| ||| Db 923 TTTGCCGATATCGCCTACAACTACCGGCACGGCCAGCCCATCCCCCGGGTGGAGTATATG 982 Qy 541 GAAGAGGAAAAGAAAACCTGGGGCACCGTGTTCAAGACCCTGAAGTCCCTGTACAAGACC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 983 GAAGAGGAAAAGAAAACCTGGGGCACCGTGTTCAAGACCCTGAAGTCCCTGTACAAGACC 1042 Qy 601 CACGCCTGCTACGAGTACAACCACATCTTCCCACTGCTCGAGAAGTACTGCGGCTTCCAC 660 |||||||||||||||||||||||||||||||||||||| || |||||||||||||||||| Db 1043 CACGCCTGCTACGAGTACAACCACATCTTCCCACTGCTGGAAAAGTACTGCGGCTTCCAC 1102 Qy 661 GAGGACAATATCCCTCAGCTCGAGGACGTGTCCCAGTTCCTGCAGACCTGCACCGGCTTT 720 |||||||||||||| ||||| || ||||||||||||||||||||||||||||||||||| Db 1103 GAGGACAATATCCCCCAGCTGGAAGACGTGTCCCAGTTCCTGCAGACCTGCACCGGCTTC 1162 Qy 721 AGACTGAGGCCTGTTGCCGGACTGCTGAGCAGCAGAGATTTTCTCGGCGGCCTGGCCTTC 780 |||||||||||||| ||||||||||||||||||||||||||||| ||||| ||||||||| Db 1163 AGACTGAGGCCTGTGGCCGGACTGCTGAGCAGCAGAGATTTTCTGGGCGGACTGGCCTTC 1222 Qy 781 AGAGTGTTCCACTGTACCCAGTACATCAGACACGGCAGCAAGCCCATGTACACCCCTGAG 840 | ||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||| Db 1223 CGGGTGTTCCACTGCACCCAGTACATCAGACACGGCAGCAAGCCCATGTACACCCCCGAG 1282 Qy 841 CCTGATATCTGCCACGAGCTGCTGGGACATGTGCCCCTGTTCAGCGATAGAAGCTTCGCC 900 || |||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| Db 1283 CCCGATATCTGCCACGAGCTGCTGGGACACGTGCCCCTGTTCAGCGACAGAAGCTTCGCC 1342 Qy 901 CAGTTCAGCCAAGAGATCGGACTGGCTTCTCTGGGAGCCCCTGACGAGTACATTGAGAAG 960 ||||||||||| || ||||| ||||| |||||||||||||| |||||||| || |||||| Db 1343 CAGTTCAGCCAGGAAATCGGCCTGGCCTCTCTGGGAGCCCCCGACGAGTATATCGAGAAG 1402 Qy 961 CTGGCCACCATCTACTGGTTCACCGTGGAGTTCGGCCTGTGCAAGCAGGGCGATAGCATC 1020 ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| Db 1403 CTGGCCACCATCTACTGGTTCACCGTGGAATTCGGCCTGTGCAAGCAGGGCGACAGCATC 1462 Qy 1021 AAGGCTTATGGCGCTGGCCTGCTGTCTAGCTTTGGCGAGCTGCAGTACTGTCTGAGCGAG 1080 ||||| || ||||||||||||||||| ||||||||||||||||||||||||||||||||| Db 1463 AAGGCCTACGGCGCTGGCCTGCTGTCCAGCTTTGGCGAGCTGCAGTACTGTCTGAGCGAG 1522 Qy 1081 AAGCCTAAGCTGCTGCCCCTGGAACTGGAAAAGACCGCCATCCAGAACTACACCGTGACC 1140 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1523 AAGCCCAAGCTGCTGCCCCTGGAACTGGAAAAGACCGCCATCCAGAACTACACCGTGACC 1582 Qy 1141 GAGTTCCAGCCTCTGTACTACGTGGCCGAGAGCTTCAACGACGCCAAAGAAAAAGTGCGG 1200 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Db 1583 GAGTTCCAGCCCCTGTACTACGTGGCCGAGAGCTTCAACGACGCCAAAGAAAAAGTGCGG 1642 Given the large breadth of small RNA sequences (instant claim 20) the RNA present in the vectors of Wilson encompass this. Expression is from AAV and driven from a liver specific promoter (page 2, last ¶). The construct includes a beta globin intron (see claim 13) and liver specific promoters (see page 14, line 11-26) which includes hAAT (SEQ ID NO:10). Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 1, mRNA (cDNA clone MGC:9222 IMAGE:3859644), complete cds Sequence ID: BC011991.1Length: 1584Number of Matches: 1 Related Information Gene-associated gene details GEO Profiles-microarray expression data Range 1: 39 to 227GenBankGraphicsNext MatchPrevious Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 342 bits(185) 1e-89 188/189(99%) 1/189(0%) Plus/Plus Query 30 AGG-GGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTCCGATAACTG 88 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 39 AGGCGGGCGACTCAGATCCCAGCCAGTGGACTTAGCCCCTGTTTGCTCCTCCGATAACTG 98 Query 89 GGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCT 148 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 99 GGGTGACCTTGGTTAATATTCACCAGCAGCCTCCCCCGTTGCCCCTCTGGATCCACTGCT 158 Query 149 TAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGG 208 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 159 TAAATACGGACGAGGACAGGGCCCTGTCTCCTCAGCTTCAGGCACCACCACTGACCTGGG 218 Query 209 ACAGTGAAT 217 ||||||||| Sbjct 219 ACAGTGAAT 227 Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 3 and 16-23 are rejected under 35 U.S.C. 103 as being unpatentable over Wilson et al ( in IDS submitted 5/18/2022) in view of Wilson2 et al (US 20180363000). Applicants argue that the amendment is sufficient to overcome the rejections. However, the variant is not limited in structure. It is newly extended to claim 3 as the variant thereof is removed from this claim. Hence, should the claims be limited to the variant it no longer is limited by the structure of claim 3. Hence, this claim is in part a new rejection necessitated by applicants’ amendment. Wilson2 et al et al teach liver therapy with vectors such as lentivirus vector wherein hAAT promoters with prothrombin enhancers are used (see e.g. ¶0068, 0070 and 0099). Based on such teachings, it would have prima facie been obvious to one of ordinary skill in the art at the time the invention was made to incorporate the regulatory sequences as taught by Wilson2 et al in the liver therapy as taught by Wilson et al. Such a modification would have resulted in a vector encompassed by claim 16, 22 and 23. As noted above: 1) Wilson et al teach use of viral vectors encoding PAH a liver related disorder; 2) Wilson2 et al teach taught use of liver specific promoters and enhancers that include hAAT and prothrombin. Thus, a person of ordinary skill in the art, absent evidence to the contrary, would have reasonably expected that the liver therapy could be treated by using liver specific regulatory sequences. Conclusion Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MARIA MARVICH whose telephone number is (571)272-0774. The examiner can normally be reached 8 am - 5 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Maria Leavitt can be reached on 571-272-1085. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MARIA MARVICH/ Primary Examiner, Art Unit 1634
Read full office action

Prosecution Timeline

Nov 09, 2021
Application Filed
May 28, 2025
Non-Final Rejection — §102, §103, §112
Dec 01, 2025
Response Filed
Dec 29, 2025
Final Rejection — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600986
NUCLEIC ACID MOLECULES CONTAINING SPACERS AND METHODS OF USE THEREOF
2y 5m to grant Granted Apr 14, 2026
Patent 12590321
METHODS AND COMPOSITIONS FOR GENETICALLY MODIFYING AND EXPANDING LYMPHOCYTES AND REGULATING THE ACTIVITY THEREOF
2y 5m to grant Granted Mar 31, 2026
Patent 12589151
T Cell Modification
2y 5m to grant Granted Mar 31, 2026
Patent 12589128
ONCOLYTIC ADENOVIRUS COMPOSITIONS
2y 5m to grant Granted Mar 31, 2026
Patent 12571002
GENE THERAPIES FOR LYSOSOMAL DISORDERS
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
55%
Grant Probability
82%
With Interview (+26.9%)
4y 2m
Median Time to Grant
Moderate
PTA Risk
Based on 967 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month