Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
This Office Action is a response to Applicant’s Amendment and Remarks filed August 24, 2026.
Claims 1, 3 and 4 have been amended.
Claims 1-7, 24, 39, 78, 97, 106, 108, 116, 123 and 124 are pending in the instant application.
This application contains claims 39, 78, 97, 106, 108, 116, 123 and 124 drawn to an invention nonelected without traverse in the reply filed May 8, 2026. A complete reply to the final rejection must include cancellation of nonelected claims or other appropriate action (37 CFR 1.144). See MPEP § 821.01.
Accordingly, claims 1-7 and 24 have been examined on the merits as detailed below:
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Information Disclosure Statement
Applicant’s information disclosure statements (IDS) filed June 19, 2026 is acknowledged. The submission is in compliance with the provisions of 37 CFR §1.97. Accordingly, the Examiner has considered the information disclosure statement, and a signed copy is enclosed herewith.
Claim Rejections - 35 USC § 112
In the previous Office Action mailed May 28, 2026, claim 4 was rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. This rejection is withdrawn in view of Applicant’s Amendment to the claim filed August 24, 2026.
In the previous Office Action mailed May 28, 2026, claims 1-7 and 24 were rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. This rejection is withdrawn in view of Applicant’s Amendment to the claim 1 filed August 24, 2026 to require, wherein the guide RNA comprises the nucleotide sequence CGCCCACCGAAUGUUGCCCA (SEQ ID NO: 18) or a nucleotide sequence corresponding to ACTCCTCCCAGTCTTTAAACA (SEQ ID NO: 493).
Applicant's amendment to the claims filed August 24, 2026 necessitated the new ground(s) of rejection presented below:
Claim Rejections - 35 USC § 103
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under pre-AIA 35 U.S.C. 103(a) are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4.Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-7 and 24 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2015089465 A1 to Bhatia et al. in view of WO 2019005884 A1 to Broad Institute.
The claims are drawn to a method of editing a nucleobase of a hepatitis B virus (HBV) genome, the method comprising contacting the HBV genome with one or more guide RNAs and a base editor comprising a polynucleotide programmable DNA binding domain and an adenosine deaminase or cytidine deaminase domain, wherein said guide RNA targets said base editor to effect an alteration of the nucleobase of the HBV genome, and wherein the alteration of the nucleobase results in an R87* or W120* termination in an HBV X protein, and wherein the guide RNA comprises the nucleotide sequence CGCCCACCGAAUGUUGCCCA (SEQ ID NO: 18) or a nucleotide sequence corresponding to ACTCCTCCCAGTCTTTAAACA (SEQ ID NO: 493).
Bhatia et al. is relevant and relied upon in its entirety. The reference teaches the delivery, use and therapeutic applications of the crispr-cas systems and compositions for HBV and viral diseases and disorders. More specifically, Bhatia et al. teach a method of editing a nucleobase of a HBV genome, the method comprising contacting the HBV genome with one or more guide RNAs, wherein the guide RNA comprises the nucleotide sequence CGCCCACCGAAUGUUGCCCA (SEQ ID NO: 18) of the present invention. See HBV target DNA hybridizing SpCas9 sgRNA, SEQ ID NO: 736 of Bhatia et al. Also, see sequence alignment below:
PNG
media_image1.png
150
482
media_image1.png
Greyscale
Bhatia et al. teach the guide RNAs of their invention comprise a base editor comprising a polynucleotide programmable DNA binding domain, including programmable sequence-specific endonucleases for mediating genome alteration with high precision.
Bhatia et al. do not necessarily teach the method of their invention comprises cytosine and adenine base editors (e.g. adenine and/or cytidine deaminases).
Broad Institute is relevant and relied upon in its entirety. The reference teaches systems, methods, and compositions for targeting and editing nucleic acids. Bhatia et al. particularly teaches an adenosine deaminase or cytidine deaminase domain for the purpose of making single base edits, therefore avoiding double-stranded breaks during the editing process.
While Bhatia et al. does not necessarily teach the guide RNA (e.g. SEQ ID NO: 736) of their invention targets the base editor to effect an alteration of the nucleobase of the HBV genome, wherein the alteration of the nucleobase results in an R87* termination in an HBV X protein, it is noted that Bhatia et al. teach administration of the same guide RNA as presently claimed. Namely, administration of the nucleotide sequence CGCCCACCGAAUGUUGCCCA (SEQ ID NO: 18) of the present invention. Any underlying mechanism of action would naturally flow and be inherent to administration of the guide RNA to a cell. See MPEP 2112 as it relates to inherency. Also, see In re Spada, 911 F.2d 705, 709, 15 USPQ2d 1655, 1658 (Fed. Cir. 1990) and In re Best, 562 F.2d 1252 (CCPA 1977).
The Examiner has provided sound basis in fact and technical reasoning that reasonably supports the determination that the allegedly inherent characteristic necessarily flows from what has been specifically disclosed within the prior art and has shifted the burden to Applicant to provide evidence to the contrary.
HBV genome editing by CRISPR/Cas technology has been disclosed in the art. Before the effective filing date of the claimed invention, a method of editing a nucleobase of a hepatitis B virus (HBV) genome, the method comprising contacting the HBV genome with one or more guide RNAs comprising CGCCCACCGAAUGUUGCCCA (SEQ ID NO: 18) of the present invention and a base editor comprising a polynucleotide programmable DNA binding domain was taught and suggested in the prior art of Bhatia et al.
It would have been obvious to modify the teachings of Bhatia et al. to include the adenosine deaminase or cytidine deaminase and their use for HBV genome editing of Broad Institute for the purpose of causing a nonsense mutation resulting in a premature stop codon or a missense mutation in the gene.
A person of ordinary skill in the art would have been motivated and expected reasonable success to devise the methods of the claimed invention using the successful teachings of Bhatia et al. in combination with Broad Institute.
Therefore, the subject matter of claims 1-7 and 24 is obvious over Bhatia et al. in view of Broad Institute.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Terra C. Gibbs whose telephone number is 571-272-0758. The Examiner can normally be reached from 8 am - 5 pm M-F.
If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Ram Shukla can be reached on 571-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO's Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO's Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO's PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/TERRA C GIBBS/Primary Examiner, Art Unit 1635
