DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s amendment and response filed on 7/14/2026 has been received and entered into the case.
Claims 1-30, 32 and 47 have been canceled, and claims 31, 33-46 and 48-52 have been considered on the merits. All arguments have been considered.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 31, 33-46 and 48-52 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 31 and 51 disclose the term “at least about”. The term “at least” which requires a number for the lower end, i.e. at the minimum requirement, and the term “about” does not provide clear boundary of the range. Thus, one cannot determine what the minimum number of the claimed range, and thus, it is indefinite by using “at least” and “about” together in defining the range in the claims.
In determining the range encompassed by the term "about", one must consider the context of the term as it is used in the specification and claims of the application. Ortho-McNeil Pharm., Inc. v. Caraco Pharm. Labs., Ltd., 476 F.3d 1321, 1326, 81 USPQ2d 1427, 1432 (Fed. Cir. 2007). In< W.L. Gore & Associates, Inc. v. Garlock, Inc., 721 F.2d 1540, 220 USPQ 303 (Fed. Cir. 1983), the court held that a limitation defining the stretch rate of a plastic as "exceeding about 10% per second" is definite because infringement could clearly be assessed through the use of a stopwatch. However, the court held that claims reciting "at least about" were invalid for indefiniteness where there was close prior art and there was nothing in the specification, prosecution history, or the prior art to provide any indication as to what range of specific activity is covered by the term "about." Amgen, Inc. v. Chugai Pharmaceutical Co., 927 F.2d 1200, 18 USPQ2d 1016 (Fed. Cir. 1991).
Applicant is advised to replace the term with “at least”.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 31, 33-46 and 48-52 are rejected under 35 U.S.C. 103 as being unpatentable over Lizasoain Hernandez et al. (US2017/0130227; of record) in view of Gavagan et al. (1996, Am. Fam. Physician; Abstract only; of record), Heffernan et al. (US2011/0293601; of record) and Scheller et al. (2003, JACC; of record) as evidenced by White et al. (1998, Circulation; of record).
Lizasoain Hernandez et al. teach a method of administering a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from SEQ ID NO:1 and NO:2 (para. 187). Lizasoain Hernandez et al. teach that the pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 includes myocardial infarction (para. 159 and 161; claim 21 at p.23-24).
The SEQ ID NO:2 of Lizasoain Hernandez et al. is identical to the nucleic acid sequence of SEQ ID NO:1 of the instant application (see the alignment below).
US-15-322-021-2
(NOTE: this sequence has 7 duplicates in the database searched)
Sequence 2, US/15322021
Publication No. US20170130227A1
Query Match 100.0%; Score 59; Length 59;
Best Local Similarity 100.0%;
Matches 59; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAG 59
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAG 59
Regarding the first dose of the aptamer being administered less than 24 hours after the cardiac infarction (claims 31 and 51), Lizasoain Hernandez et al. do not teach the limitation.
However, it is extremely well known in the art that rapid postinfarction intervention in the first 24 hours decrease mortality according to Gavagan et al. (see Abstract). Furthermore, Scheller et al. teach that the time from symptom to thrombolysis are within 12 hours according to Fig. 1, and about 3.2+2.2 h for immediate stenting (Table 3). Thus, it would have been obvious to a person skilled in the art to administer the aptamers of Lizasoain Hernandez et al. to the patients having cardiac infarction within 24 hours of the onset with a reasonable expectation of success as it is a well-known practice in the art.
Regarding the first dose comprising an amount of the single-stranded nucleic acid comprising SEQ ID NO:1 being at least about 0.07 mg/kg of the subject (claim 31) or about 0.2 mg/kg of the subject (claims 48-49 and 51-52), Lizasoain Hernandez et al. teach that the typical total daily doses between 0.0001-1 mg/kg of body weight /day, and this range is overlapping with the claimed range of dose. Thus, the dose taught by Lizasoain Hernandez et al. is considered to meet the claimed limitation of claims 31, 48-49 and 51-52.
Regarding the intended purpose of the claimed invention directed to improving cardiac function (claims 31 and 51) or decreasing fibrosis and/or necrosis (claim 52), while Lizasoain Hernandez et al. in view of the cited reference do not particularly disclose the limitation, however, it is submitted that the intended results would be obtainable from the combined teachings of the cited references as the combined teachings would arrive to the identical method as claimed.
Regarding claims 33-34 and 37 directed to the artery recanalization being pharmacological thrombolysis, Lizasoain Hernandez et al. teach that suitable drugs that can be used as functional groups in the complexes formed with the aptamer inhibiting TLR-4 includes the tissue plasminogen activator (tPA), Activase® (para. 70, 73 and 194). It is considered that tPA carry out pharmacological thrombolysis. Furthermore, Scheller et al. teach that thrombolysis is one of treatments along with angioplasty for MI (p.634), and they teach the use of immediate stenting after thrombolysis for treatment of acute MI (Abstract). They teach the use of reteplase, which is one of well-known plasminogen activators (see White et al. p.1641).
It would have been obvious to a person skilled in the art to use a thrombolytic agent such as reteplase for treating acute MI taught by Scheller et al. along with the aptamer of Lizasoain Hernandez et al. with a reasonable expectation of success.
Regarding claims 33-36 directed to the aptamer being administered in combination with artery recanalization, surgical artery catheterization, or stent catheterization, Lizasoain Hernandez et al. do not teach the limitation.
Heffernan et al. teach a method of treating ischemia reperfusion injury including myocardial infarction by administering TLR2 antagonistic/modulatory compound including an aptamer (para. 14, 22, 28). Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92). It is understood that angioplasty involves a balloon catheter and a stent, thus, it is artery recanalization or catheterization. Furthermore, Heffernan et al. teach the stenting (para. 309) and it is well known in the art that the acute myocardial infarction is treated with stenting (i.e. stent catheterization) according to Scheller et al. (see entire document). Scheller et al. teach catheterization in femoral artery (p.635, 2nd col.).
It would have been obvious to a person skilled in the art to combine other known treatments including angioplasty (catheterization) and thrombolysis taught by Heffernan et al. and Scheller et al. along with aptamers to TLR-4 taught by Lizasoain Hernandez et al. with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because Heffernan et al. teach the use of these well-known treatments along with TLR2 modulating/inhibiting compound including aptamer for the treatment of myocardial infarction. Thus, one skilled in the art would recognize that the method utilized along with TLR2 aptamer or inhibiting compound thereof can be also used for the method of using TLR4 aptamer taught by Lizasoain Hernandez et al. in treating myocardial infarction, and the combining with angioplasty and thrombolysis for the same purpose of treating myocardial infarction would be obvious.
Regarding claim 38 directed to the order of administering aptamer being prior, during or after artery recanalization, the cited references do not particularly teach the limitation. Lizasoain Hernandez et al. teach that suitable drugs that can be used as functional groups in the complexes formed with the aptamer inhibiting TLR-4 includes the tissue plasminogen activator (tPA) (para. 194). Thus, by using the aptamer inhibiting TLR-4 and the tPA in the complex would meet the limitation of administering aptamer “during” artery recanalization. Furthermore, Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92).
Regarding claims 39-42 directed to the timing of the aptamer administration after/prior artery recanalization, the cited references do not particularly disclose the limitations of these claims. However, it is submitted that the timing of the aptamer administration in respect to the another treatment, i.e. artery recanalization, can be readily modified by routine experimentations as the timing of administering aptamer at least 30 minutes prior, immediately after or at least 10 minutes after artery recanalization would be a result-effective parameter in the absence of new and unexpected results of the claimed timing for the treating of acute MI.
Regarding claim 43, Lizasoain Hernandez et al. teach the administration of the pharmaceutical composition comprising the aptamer for TLR-4 is via intravenous route or pulse infusion (paras. 206-207 and 210).
Regarding claim 44 directed to the intravenous infusion of aptamer having a duration of about 5-30 minutes, the cited references do not particularly teach the limitation. However, one skilled in the art would recognize that the duration of intravenous injection/infusion is determined by the total volume of the solution comprising aptamer to TLR-4, which would be also determined by the concentration of the aptamer, and the speed of infusion. Therefore, the duration of the infusion can be readily modified as desired by routine experimentations. In the absence of any evidence showing the criticality of the infusion duration as claimed, it would have been obvious to a person skilled in the art to modify the infusion duration as desired with a reasonable expectation of success.
Regarding claims 45-46, the limitation is directed to the results of the method disclosed in claim 31, and the results do not require any active step for the claimed method and thus, claims 32 and 45-46 are interpreted the same as claim 31.
Regarding claims 48-49 directed to the dose between 0.5 mg-10 mg (claim 48), or 0.007 – 0.14 mg/kg of the subject [body weight], Lizasoain Hernandez et al. teach that the typical total daily doses between 0.0001-1 mg/kg of body weight /day, and this range is overlapping with the claimed range of dose. This is because considering the human patients being about 50-100 kg, the dose would be 0.005-1000mg which overlaps with the claimed 0.5-10 mg or 0.007-0.14 mg/kg of the subject.
Regarding claim 50, Lizasoain Hernandez et al. teach that the aptamer is applied in a buffer suitable for allowing the binding of the aptamer to the TLR-4 and the buffers induce PBS containing MgCl2 (para. 116).
Regarding claim 51, the limitation is identical to claim 48 or claim 49 which is dependent on claim 31. As discussed above addressing the limitations of claims 48 and 49, the teaching of Lizasoain Hernandez et al. meet the subject matter of claim 51.
Regarding claim 52, the claimed method steps are identical to claims 31 or 51 except it is broader not requiring specific administering time window or dose. As the combined teachings of the cited references meet the aptamer and the subject, the same teaching would meet the subject matter of claim 52. As discussed above, the intended outcome is inherent as the method of the combined teachings is identical to the claimed method.
Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 31, 33-46 and 48-52 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-16 of U.S. Patent No. 10,196,642 in view of Heffernan et al. (supra), Gavagan et al. (supra) and Scheller et al. (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘642 patent disclose a method for treating of a pathology characterized by an increase in expression of TR-4 comprising administering an aptamer having a sequence at least 70% identical to SEQ ID NO:1 or 2. It is noted that the ‘642 patent is identical to Lizasoain Hernandez et al. (US2017/0130227) supra, and thus, SEQ ID NO:2 of the ‘642 patent is 100% identical to SEQ ID NO:1 of the instant application (see alignment above). The claims of the ‘642 patent disclose that the pathology includes acute myocardial infarction.
Regarding the first dose being administered less than 24 hours (claims 31 and 51), while the claims of the ‘642 patent do not disclose the limitation, however, when the aptamer of the ‘642 patent is utilized for treating cardiac infarction, it would have been obvious to administer the aptamer to a subject having the infarction within 24 hours of the onset as it is a well-known practice in the art in treating cardiac infarction according to Gavagan et al. (Abstract) as well as Scheller et al. (see Fig. 1 and Table 3).
Regarding claims 33-36 directed to the aptamer being administered in combination with artery recanalization, surgical artery catheterization, or stent catheterization, the claims of the ‘642 patent do not teach the limitation. Heffernan et al. teach a method of treating ischemia reperfusion injury including myocardial infarction by administering TLR2 antagonistic/modulatory compound including an aptamer (para. 14, 22, 28). Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92). Furthermore, it is well known in the art that the acute myocardial infarction is treated with stenting (i.e. stent catheterization; artery recanalization) according to Scheller et al. (see entire document). Scheller et al. teach catheterization in femoral artery (p.635, 2nd col.).
It would have been obvious to a person skilled in the art to combine other known treatments including angioplasty (catheterization) and thrombolysis taught by Heffernan et al. and Scheller et al. in addition to the aptamer of the claims of the ‘642 patent with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because stenting is one of the well-known treatments for acute MI and the use of stenting (stent catheterization) taught by Scheller et al. and the aptamer of the claims of the ‘642 patent is obvious combination for the same purpose.
Scheller et al. teach that thrombolysis is one of treatments along with angioplasty for MI (p.634), and they teach the use of immediate stenting after thrombolysis for treatment of acute MI (Abstract). They teach the use of reteplase, which is one of well-known plasminogen activators. It would have been obvious to a person skilled in the art to use a thrombolytic agent such as reteplase for treating acute MI taught by Scheller et al. along with the aptamer of the claims of the ‘642 patent with a reasonable expectation of success.
Regarding claim 38-42 directed to the order of administering aptamer being prior, during or after artery recanalization, the claims of the ‘642 patent do not particularly teach the limitation. Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92). Furthermore, it is submitted that the timing of the aptamer administration in respect to the another treatment, i.e. artery recanalization, can be readily modified by routine experimentations as the timing of administering aptamer at least 30 minutes prior, immediately after or at least 10 minutes after artery recanalization would be a result-effective parameter in the absence of new and unexpected results of the claimed timing for the treating of acute MI.
Regarding claim 44 directed to the intravenous infusion of aptamer having a duration of about 5-30 minutes, the claims of the ‘642 patent do not particularly teach the limitation. However, one skilled in the art would recognize that the duration of intravenous injection/infusion is determined by the total volume of the solution comprising aptamer to TLR-4, which would be also determined by the concentration of the aptamer, and the speed of infusion. Therefore, the duration of the infusion can be readily modified as desired by routine experimentations. In the absence of any evidence showing the criticality of the infusion duration as claimed, it would have been obvious to a person skilled in the art to modify the infusion duration as desired with a reasonable expectation of success.
Regarding the doses disclosed in claims 31, 48-49 and 51-52, the claims of the ‘642 patent do not particularly teach the dose for treating cardiac infarction as claimed. However, claim 16 of the ‘642 patent discloses acute myocardial infarction as one of pathology being treated by the aptamer having SEQ ID NO:1. Thus, it would have been obvious to a person skilled in the art to determine the effective dose of the aptamer for the acute myocardial infarction with a reasonable expectation of success.
Regarding the first dose effective to reduce infarcted area, decrease fibrosis or necrosis, reduce degradation of ECM, improve cardiac remodeling, preserve ventricular anatomy, etc. in claim 31 or 51-52, they are directed to the results of the method. As the claims of the ‘642 patent in view of the cited references teach the identical method steps, one skilled in the art would expect the same results as the method of the instant application.
Therefore, the claims of the ‘642 patent in view of Heffernan et al. and Scheller et al. would render the claims of the instant application obvious.
Response to Arguments
Applicant's arguments filed 7/14/2026 have been fully considered but they are not persuasive.
Regarding the 103 rejection, applicant alleged that a single administration (i.e. a first dose) of the claimed aptamers can clearly provide improvement. It is acknowledged that the specification discloses some improvement upon a single dose (para. 289 of PGPub). However, there is no evidence to support that a single administration of the claimed aptamers producing functional recovery is unexpected. There is no evidence or basis why one skilled in the art would not expect improvement after a single dose or a first dose of the aptamer taught by Lizasoain Hernandez et al. Furthermore, it is noted that the instant claims disclose “a first dose” and the claims do not exclude any additional dosage.
Applicant argued that total daily doses taught by Lizasoain Hernandez does not read upon an individual dose as claimed. The examiner does not agree with this assertion. While total dose can be multiple doses of the aptamer, however, that does not exclude that total daily dose can be from a single dose. Particularly, Lizasoain Hernandez et al. teach that the administration is one or more time a day, for example 1,2, 3 or 4 times a day with typical total daily doses of 0.0001 to 1 mg/kg of body weight per day (para. 212). Thus, a single dose per day is within the scope of the teaching, and thus, a single dose can have the range of 0.0001 to 1 mg/kg of body weight per day of the aptamer.
Applicant asserted that the combined teachings of the cited references do not teach or suggest the claimed effective outcome. It is submitted that the combined teachings of references do not need to provide evidence showing any therapeutic effect of the claimed method. Patentability of the claimed method is determined by the active steps required by the claimed method, not the results. The outcome of the method taught by the combined teachings would be inherent if the method steps are identical. The 103 rejection above has addressed that the claimed method steps are taught by the combined teachings of the cited references, and thus, the outcome/results are expected the same.
The discovery of a new use for an old structure based on unknown properties of the structure might be patentable to the discoverer as a process of using. In re Hack, 245 F.2d 246, 248, 114 USPQ 161, 163 (CCPA 1957). However, when the claim recites using an old composition or structure and the "use" is directed to a result or property of that composition or structure, then the claim is anticipated. In re May, 574 F.2d 1082, 1090, 197 USPQ 601, 607 (CCPA 1978) and In re Tomlinson, 363 F.2d 928, 150 USPQ 623 (CCPA 1966). See M.P.E.P. § 2112.02.
Regarding the double patenting rejection, it is noted that the rejection has been modified per the instant amendment. Applicant’s argument based on the argument against the 103 rejection is not persuasive as it is the Examiner’s position that the combined teachings of the cited reference render the claimed invention obvious, and thus, the double patenting rejection would be maintained.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TAEYOON KIM/Primary Examiner, Art Unit 1631
Prosecution Insights