Prosecution Insights
Last updated: April 18, 2026
Application No. 17/611,497

TREATMENT OF TLR-4 MEDIATED DISEASES AND CONDITIONS WITH APTAMERS TARGETING TLR-4

Non-Final OA §102§103§DP
Filed
May 04, 2022
Examiner
KIM, TAEYOON
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Merck Patent GmbH
OA Round
3 (Non-Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
3y 11m
To Grant
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allow Rate
450 granted / 874 resolved
-8.5% vs TC avg
Strong +51% interview lift
Without
With
+51.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 11m
Avg Prosecution
74 currently pending
Career history
948
Total Applications
across all art units

Statute-Specific Performance

§101
4.8%
-35.2% vs TC avg
§103
34.9%
-5.1% vs TC avg
§102
15.4%
-24.6% vs TC avg
§112
29.2%
-10.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 874 resolved cases

Office Action

§102 §103 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment and response filed on 8/8/2025 has been received and entered into the case. Claims 1-30 have been canceled, claim 51 is newly added, and claims 31-51 have been considered on the merits. All arguments have been considered. Response to Amendment The claim rejection under 35 USC 112(b) has been withdrawn due to the instant amendment. The claim rejections under 102 and 103 based on Lizasoain Hernandez et al. have been modified in order to address the newly added limitation to claim 31 and a new claim, claim 51. Claim Rejections - 35 USC § 102 (modified and maintained) In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 31-32, 43 and 45-51 are rejected under 35 U.S.C. 102(a)(1) and (a)(2) as being anticipated by Lizasoain Hernandez et al. (US2017/0130227). Lizasoain Hernandez et al. teach a method of administering a nucleic acid aptamer with the capability of binding specifically to and inhibiting TLR-4 and comprising a sequence selected from SEQ ID NO:1 and NO:2 (para. 187). Lizasoain Hernandez et al. teach that the pathology characterized by an increase in expression of TLR-4 and/or an increase in activation of TLR-4 includes myocardial infarction (para. 159 and 161; claim 21 at p.23-24). The SEQ ID NO:2 of Lizasoain Hernandez et al. is identical to the nucleic acid sequence of SEQ ID NO:1 of the instant application (see the alignment below). US-15-322-021-2 (NOTE: this sequence has 7 duplicates in the database searched) Sequence 2, US/15322021 Publication No. US20170130227A1 Query Match 100.0%; Score 59; Length 59; Best Local Similarity 100.0%; Matches 59; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAG 59 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GGTGTGCCAATAAACCATATCGCCGCGTTAGCATGTACTCGGTTGGCCCTAAATACGAG 59 Regarding the option of the functional equivalent variant of the aptamers having at least 85% sequence identity to SEQ ID NO:1,2,3 or 4, Lizasoain Hernandez et al. teach the aptamers comprising nucleotide sequences with a sequence identity of at least 85% with SEQ ID NO:2 (para. 43). Regarding the newly added wherein clauses in claim 31, the wherein clauses are directed to the results of the claimed method and this limitation does not provide any active steps to be performed for the claimed method. Therefore, the wherein clause does not provide any weight in determining patentability of the claimed method. Rather, the steps taught by Lizasoain Hernandez et al. are identical to the claimed method steps, the results obtainable from the method taught by Lizasoain Hernandez et al. are expected identical to the claimed method. Regarding claims 32, 45-46, the limitation is directed to the results of the method disclosed in claim 31, and the results do not require any active step for the claimed method and thus, claims 32 and 45-46 are interpreted the same as claim 31. Regarding claim 43, Lizasoain Hernandez et al. teach the administration of the pharmaceutical composition comprising the aptamer for TLR-4 is via intravenous route or pulse infusion (paras. 206-207 and 210). Regarding claims 48-49 directed to the dose between 0.5 mg-10 mg/dose (claim 48), or 0.007 mg/kg/dose – 0.14 mg/kg/dose, Lizasoain Hernandez et al. teach that the typical total daily doses between 0.0001-1 mg/kg of body weight /day, and this range is overlapping with the claimed range of dose. Regarding claim 50, Lizasoain Hernandez et al. teach that the aptamer is applied in a buffer suitable for allowing the binding of the aptamer to the TLR-4 and the buffers induce PBS containing MgCl2 (para. 116). Regarding the new claim 51, the limitation is identical to claim 48 or claim 49 which is dependent on claim 31. As discussed above addressing the limitations of claims 48 and 49, the teaching of Lizasoain Hernandez et al. meet the subject matter of claim 51. Thus, the reference anticipates the claimed invention. Claim Rejections - 35 USC § 103 (maintained) The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 31-51 are rejected under 35 U.S.C. 103 as being unpatentable over Lizasoain Hernandez et al. (supra) in view of Heffernan et al. (US2011/0293601) and Scheller et al. (2003, JACC) as evidenced by White et al. (1998, Circulation). Lizasoain Hernandez et al. anticipate the subject matter of claims 31-32, 43 and 45-51, and thus, render them obvious (see the 102 rejection above). Regarding claims 33-36 directed to the aptamer being administered in combination with artery recanalization, surgical artery catheterization, or stent catheterization, Lizasoain Hernandez et al. do not teach the limitation. Heffernan et al. teach a method of treating ischemia reperfusion injury including myocardial infarction by administering TLR2 antagonistic/modulatory compound including an aptamer (para. 14, 22, 28). Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92). It is understood that angioplasty involves a balloon catheter and a stent, thus, it is artery recanalization or catheterization. Furthermore, Heffernan et al. teach the stenting (para. 309) and it is well known in the art that the acute myocardial infarction is treated with stenting (i.e. stent catheterization) according to Scheller et al. (see entire document). Scheller et al. teach catheterization in femoral artery (p.635, 2nd col.). It would have been obvious to a person skilled in the art to combine other known treatments including angioplasty (catheterization) and thrombolysis taught by Heffernan et al. and Scheller et al. along with aptamers to TLR-4 taught by Lizasoain Hernandez et al. with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because Heffernan et al. teach the use of these well-known treatments along with TLR2 modulating/inhibiting compound including aptamer for the treatment of myocardial infarction. Thus, one skilled in the art would recognize that the method utilized along with TLR2 aptamer or inhibiting compound thereof can be also used for the method of using TLR4 aptamer taught by Lizasoain Hernandez et al. in treating myocardial infarction, and the combining with angioplasty and thrombolysis for the same purpose of treating myocardial infarction would be obvious. Regarding claims 33-34 and 37 directed to the artery recanalization being pharmacological thrombolysis, Lizasoain Hernandez et al. teach that suitable drugs that can be used as functional groups in the complexes formed with the aptamer inhibiting TLR-4 includes the tissue plasminogen activator (tPA), Activase® (para. 70, 73 and 194). It is considered that tPA carry out pharmacological thrombolysis. Furthermore, Scheller et al. teach that thrombolysis is one of treatments along with angioplasty for MI (p.634), and they teach the use of immediate stenting after thrombolysis for treatment of acute MI (Abstract). They teach the use of reteplase, which is one of well-known plasminogen activators (see White et al. p.1641). It would have been obvious to a person skilled in the art to use a thrombolytic agent such as reteplase for treating acute MI taught by Scheller et al. along with the aptamer of Lizasoain Hernandez et al. with a reasonable expectation of success. Regarding claim 38 directed to the order of administering aptamer being prior, during or after artery recanalization, the cited references do not particularly teach the limitation. Lizasoain Hernandez et al. teach that suitable drugs that can be used as functional groups in the complexes formed with the aptamer inhibiting TLR-4 includes the tissue plasminogen activator (tPA) (para. 194). Thus, by using the aptamer inhibiting TLR-4 and the tPA in the complex would meet the limitation of administering aptamer “during” artery recanalization. Furthermore, Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92). Regarding claims 39-42 directed to the timing of the aptamer administration after/prior artery recanalization, the cited references do not particularly disclose the limitations of these claims. However, it is submitted that the timing of the aptamer administration in respect to the another treatment, i.e. artery recanalization, can be readily modified by routine experimentations as the timing of administering aptamer at least 30 minutes prior, immediately after or at least 10 minutes after artery recanalization would be a result-effective parameter in the absence of new and unexpected results of the claimed timing for the treating of acute MI. Regarding claim 44 directed to the intravenous infusion of aptamer having a duration of about 5-30 minutes, the cited references do not particularly teach the limitation. However, one skilled in the art would recognize that the duration of intravenous injection/infusion is determined by the total volume of the solution comprising aptamer to TLR-4, which would be also determined by the concentration of the aptamer, and the speed of infusion. Therefore, the duration of the infusion can be readily modified as desired by routine experimentations. In the absence of any evidence showing the criticality of the infusion duration as claimed, it would have been obvious to a person skilled in the art to modify the infusion duration as desired with a reasonable expectation of success. Therefore, the invention as a whole would have been prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention. Double Patenting (maintained) The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 31-51 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-16 of U.S. Patent No. 10,196,642 in view of Heffernan et al. (supra) and Scheller et al. (supra). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of the ‘642 patent disclose a method for treating of a pathology characterized by an increase in expression of TR-4 comprising administering an aptamer having a sequence at least 70% identical to SEQ ID NO:1 or 2. It is noted that the ‘642 patent is identical to Lizasoain Hernandez et al. (US2017/0130227) supra, and thus, SEQ ID NO:2 of the ‘642 patent is 100% identical to SEQ ID NO:1 of the instant application (see alignment above). Regarding claims 33-36 directed to the aptamer being administered in combination with artery recanalization, surgical artery catheterization, or stent catheterization, the claims of the ‘642 patent do not teach the limitation. Heffernan et al. teach a method of treating ischemia reperfusion injury including myocardial infarction by administering TLR2 antagonistic/modulatory compound including an aptamer (para. 14, 22, 28). Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92). Furthermore, it is well known in the art that the acute myocardial infarction is treated with stenting (i.e. stent catheterization; artery recanalization) according to Scheller et al. (see entire document). Scheller et al. teach catheterization in femoral artery (p.635, 2nd col.). It would have been obvious to a person skilled in the art to combine other known treatments including angioplasty (catheterization) and thrombolysis taught by Heffernan et al. and Scheller et al. in addition to the aptamer of the claims of the ‘642 patent with a reasonable expectation of success. A person of ordinary skilled in the art would have been motivated to do so because stenting is one of the well-known treatments for acute MI and the use of stenting (stent catheterization) taught by Scheller et al. and the aptamer of the claims of the ‘642 patent is obvious combination for the same purpose. Scheller et al. teach that thrombolysis is one of treatments along with angioplasty for MI (p.634), and they teach the use of immediate stenting after thrombolysis for treatment of acute MI (Abstract). They teach the use of reteplase, which is one of well-known plasminogen activators. It would have been obvious to a person skilled in the art to use a thrombolytic agent such as reteplase for treating acute MI taught by Scheller et al. along with the aptamer of the claims of the ‘642 patent with a reasonable expectation of success. Regarding claim 38-42 directed to the order of administering aptamer being prior, during or after artery recanalization, the claims of the ‘642 patent do not particularly teach the limitation. Heffernan et al. teach that the TLR2 modulatory compound is administered to a subject prior to, during, or following the subject undergoing a procedure including angioplasty or thrombolysis (para. 55 and 92). Furthermore, it is submitted that the timing of the aptamer administration in respect to the another treatment, i.e. artery recanalization, can be readily modified by routine experimentations as the timing of administering aptamer at least 30 minutes prior, immediately after or at least 10 minutes after artery recanalization would be a result-effective parameter in the absence of new and unexpected results of the claimed timing for the treating of acute MI. Regarding claim 44 directed to the intravenous infusion of aptamer having a duration of about 5-30 minutes, the claims of the ‘642 patent do not particularly teach the limitation. However, one skilled in the art would recognize that the duration of intravenous injection/infusion is determined by the total volume of the solution comprising aptamer to TLR-4, which would be also determined by the concentration of the aptamer, and the speed of infusion. Therefore, the duration of the infusion can be readily modified as desired by routine experimentations. In the absence of any evidence showing the criticality of the infusion duration as claimed, it would have been obvious to a person skilled in the art to modify the infusion duration as desired with a reasonable expectation of success. Therefore, the claims of the ‘642 patent in view of Heffernan et al. and Scheller et al. would render the claims of the instant application obvious. Response to Arguments Applicant's arguments filed 8/8/2025 have been fully considered but they are not persuasive. Applicant argued that Lizasoain Hernandez et al. teach that the aptamers may be useful for treating myocardial infarction but does not necessarily improve cardiac function following myocardial infarction. While Lizasoain Hernandez et al. do not particularly disclose the outcome of the method, however, as discussed in the claim rejection above, the results of the claimed invention do not limit the claimed method only the active steps required to be performed would determine the patentability. As discussed, Lizasoain Hernandez et al. teach the identical method steps as claimed for the identical , and the same method steps would inherently produce the same results. The discovery of a new use for an old structure based on unknown properties of the structure might be patentable to the discoverer as a process of using. In re Hack, 245 F.2d 246, 248, 114 USPQ 161, 163 (CCPA 1957). However, when the claim recites using an old composition or structure and the "use" is directed to a result or property of that composition or structure, then the claim is anticipated. In re May, 574 F.2d 1082, 1090, 197 USPQ 601, 607 (CCPA 1978) and In re Tomlinson, 363 F.2d 928, 150 USPQ 623 (CCPA 1966). See M.P.E.P. § 2112.02. Regarding the 103 rejection, applicant asserted that (1) the Examiner has not established that one having ordinary skill in the art would have been motivated to combine the teachings of Lizasoain Hernandez with the teachings of Heffernan and the teachings of Scheller; and (2) the Examiner has not established that one having ordinary skill in the art would have had a reasonable expectation of success of arriving at the claimed methods in view of the combined teachings of Lizasoain Hernandez, Heffernan, and Scheller. Particularly, applicant stated that the teachings of Heffernan relate to TLR-2 modulatory agents (e.g., aptamers). TLR-2 and TLR-4 have different signaling pathways and different structures. In addition, the aptamers themselves (targeting TLR-2 and TLR-4) would have different structures and would bind to different sites. Applicant is reminded that the teachings of Heffernan et al. and Scheller et al. are cited in order to address the deficiency of Lizasoain Hernandez et al. with regard to the artery recanalization, surgical artery catheterization or stent catheterization. These treatments are well known in the art utilized for treating of myocardial infarction as taught by Heffernan et al. and Scheller et al. It is noted that the claim rejection does not rely on the use of TLR-2 aptamer taught by Heffernan et al. and as indicated above, the deficiency is the catheterization or recanalization, and Heffernan et al. and Scheller et al. teach that these treatments are used for treating myocardial infarction, and thus, the use of these treatment in the method of Lizasoain Hernandez et al. is obvious. Applicant asserted that the claimed aptamers have structural and anatomical effects, including regeneration of cardiac tissue and reduction of fibrosis or necrosis. These effects are surprising and could not have been expected in view of the combined teachings of Lizasoain Hernandez, Heffernan, and Scheller. The Examiner respectfully disagrees with this allegation. First, there is no showing of any surprising and unexpected results from using the claimed TLR-4 aptamers along with other treatments. As stated by applicant, the claimed aptamers have effects including regeneration of cardiac tissue and reduction of fibrosis or necrosis. There is no evidence that these effects are derived from the combination of TLR-4 aptamers and the artery recanalization, surgical artery catheterization or stent catheterization. Second, as applicant stated, the alleged effects appear due to the TLR-4 aptamers per se, not the combined treatment. It is noted that the method of treating myocardial infarction with the TLR-4 aptamer is anticipated by Lizasoain Hernandez et al. Thus, the alleged unexpected results would be applicable to the teaching of Lizasoain Hernandez et al. However, the argument based on any unexpected results cannot overcome the 102 rejection. Evidence of secondary considerations, such as unexpected results or commercial success, is irrelevant to 35 U.S.C. 102 rejections and thus cannot overcome a rejection so based. In re Wiggins, 488 F.2d 538, 543, 179 USPQ 421, 425 (CCPA 1973). See M.P.E.P. § 2131.04. Regarding the double patenting rejection, applicant stated that the disclosure of the '642 Patent corresponds to the disclosure of Lizasoain Hernandez, and the deficiencies in the combined teachings of Lizasoain Hernandez, Heffernan, and Scheller are discussed in the response to the 103 rejection. The argument is not persuasive as it is the Examiner’s position that the combined teachings of the cited reference render the claimed invention obvious, and thus, the double patenting rejection would be maintained. Conclusion No claims are allowed. Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TAEYOON KIM whose telephone number is (571)272-9041. The examiner can normally be reached 9-5 EST Monday-Friday. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JAMES SCHULTZ can be reached at 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TAEYOON KIM/Primary Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

May 04, 2022
Application Filed
Nov 12, 2022
Response after Non-Final Action
May 05, 2025
Non-Final Rejection — §102, §103, §DP
Aug 08, 2025
Response Filed
Aug 22, 2025
Final Rejection — §102, §103, §DP
Nov 26, 2025
Request for Continued Examination
Dec 01, 2025
Response after Non-Final Action
Apr 09, 2026
Non-Final Rejection — §102, §103, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12594301
COMPOSITIONS AND METHODS FOR TREATMENT OF LIQUID CANCERS
2y 5m to grant Granted Apr 07, 2026
Patent 12583894
MATERIALS AND METHODS FOR THE TREATMENT OF LEWY BODY DISORDERS
2y 5m to grant Granted Mar 24, 2026
Patent 12582699
COMPOSITIONS AND METHODS FOR ENHANCED LYMPHOCYTE-MEDIATED IMMUNOTHERAPY
2y 5m to grant Granted Mar 24, 2026
Patent 12582724
Compositions and Methods for the Treatment of Genetic Diseases
2y 5m to grant Granted Mar 24, 2026
Patent 12577535
GENERATION OF A MESENCHYMAL STROMAL CELL BANK FROM THE POOLED MONONUCLEAR CELLS OF MULTIPLE BONE MARROW DONORS
2y 5m to grant Granted Mar 17, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+51.1%)
3y 11m
Median Time to Grant
High
PTA Risk
Based on 874 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month